ID: 934575970

View in Genome Browser
Species Human (GRCh38)
Location 2:95401871-95401893
Sequence CCGTCTGAGGAAAGGTGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934575970_934575980 18 Left 934575970 2:95401871-95401893 CCCAGACACCTTTCCTCAGACGG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575970_934575979 12 Left 934575970 2:95401871-95401893 CCCAGACACCTTTCCTCAGACGG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 934575979 2:95401906-95401928 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934575970_934575978 11 Left 934575970 2:95401871-95401893 CCCAGACACCTTTCCTCAGACGG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 934575978 2:95401905-95401927 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934575970 Original CRISPR CCGTCTGAGGAAAGGTGTCT GGG (reversed) Intergenic
900434900 1:2625254-2625276 TCATCTGAGACAAGGTGTCTCGG + Intronic
900758821 1:4456643-4456665 GTGGCTGAGGAAAGGTGTTTGGG - Intergenic
901128277 1:6944554-6944576 CCGCCTGGGGAAGGGTGTCCAGG - Intronic
903341244 1:22655850-22655872 GCCTCTGAGGAAAGGTTTCCTGG + Intronic
903421630 1:23221710-23221732 GTGTCTGGGGACAGGTGTCTGGG + Intergenic
903610420 1:24607575-24607597 CCTTCTGAGGCCAGGTGTCGTGG + Exonic
913157132 1:116110887-116110909 GCATCTGATGACAGGTGTCTGGG + Intergenic
916365638 1:164024447-164024469 TGATCTGAAGAAAGGTGTCTTGG + Intergenic
916384668 1:164254055-164254077 TGTTCTGAGGAAGGGTGTCTTGG - Intergenic
917210452 1:172626546-172626568 CTGTCTGAGGAAAGTTGACATGG + Intergenic
918332015 1:183470905-183470927 CTGTCTGGTGAAAGGAGTCTAGG - Intergenic
919675602 1:200379299-200379321 CAGTCTGTGGCCAGGTGTCTGGG - Intergenic
922212735 1:223498085-223498107 CAGACTGAGAAAGGGTGTCTTGG - Intergenic
1063119193 10:3092859-3092881 CTGTCTGAGGAAAGGGGTGTGGG + Intronic
1064876018 10:19995331-19995353 CCGTGTGTGGAAAGGACTCTTGG - Intronic
1067170811 10:43904432-43904454 GCACCTGAGTAAAGGTGTCTGGG - Intergenic
1067513078 10:46911498-46911520 CCAGGTGAGGAAAGGTGGCTGGG + Intronic
1067649175 10:48140344-48140366 CCAGGTGAGGAAAGGTGGCTGGG - Intergenic
1068263500 10:54616537-54616559 CTGTATCTGGAAAGGTGTCTGGG - Intronic
1076521148 10:131082245-131082267 CAGTCTGGGGACAGGTGGCTGGG - Intergenic
1077006994 11:363117-363139 CCGTCTGGAGAGAGGTGTCCCGG + Intergenic
1077007032 11:363232-363254 CCGTCTGGGGAGAGCTGTCCCGG + Intergenic
1077007076 11:363378-363400 CCGTCTGGGGAGAGGTGTCCCGG + Intergenic
1077007102 11:363464-363486 CCGTCTGCAGAGAGGTGTCCCGG + Intergenic
1077007120 11:363520-363542 CCGTCTGGGGAGAGGTGTCCCGG + Intergenic
1077007145 11:363608-363630 CCGTCTGGAGAGAGGTGTCCCGG + Intergenic
1077007155 11:363636-363658 CCGTCTGGGGAAAGCTGTCCCGG + Intergenic
1077007193 11:363757-363779 CCGTCTGGAGAGAGGTGTCCCGG + Intergenic
1077007210 11:363813-363835 CCGTCTGGAGAGAGGTGTCCCGG + Intergenic
1077007219 11:363841-363863 CCGTCTGGAGAGAGGTGTCCCGG + Intergenic
1077007236 11:363897-363919 CCGTCTGGAGAGAGGTGTCCCGG + Intergenic
1077007247 11:363926-363948 CCGTCTGGGGAGAGCTGTCCCGG + Intergenic
1077761452 11:5104182-5104204 CTGTCAGAAAAAAGGTGTCTGGG - Intergenic
1084772471 11:71352729-71352751 CCATCTTAGGAGAGGTGGCTGGG - Intergenic
1085711574 11:78833728-78833750 CTGTCTGAGAAAAGGTGAATCGG + Intronic
1087337803 11:96866314-96866336 ACGTCGGAGGAAAGCAGTCTGGG - Intergenic
1090306941 11:125699315-125699337 AGGTCTGATGAAAGGTGTTTTGG + Intergenic
1094158860 12:27368588-27368610 AGCTCTGAAGAAAGGTGTCTAGG + Intronic
1097682370 12:62660775-62660797 TGGTCTGAGCAAAGGTTTCTTGG + Intronic
1099392867 12:82102154-82102176 TCGACAGAGGAATGGTGTCTTGG - Intergenic
1101332367 12:103767716-103767738 CCTTCTGAAGGAAGGGGTCTCGG - Intergenic
1104695781 12:130862564-130862586 CCATCTTAGGGAAGGTCTCTTGG + Intergenic
1105740927 13:23322529-23322551 CCTTCTGAGCTAAGGAGTCTGGG - Intronic
1108682244 13:52790351-52790373 AAGTGGGAGGAAAGGTGTCTGGG - Intergenic
1109737399 13:66504756-66504778 CCTGCTGAGAAAAGGTGTCAGGG + Intronic
1112640564 13:101269372-101269394 CCTTCTGAGGAAAGTAGCCTCGG + Intronic
1114589168 14:23843937-23843959 TGGTCTGAAGAAATGTGTCTTGG - Intergenic
1114805777 14:25834839-25834861 CAGTCTGAGGCACGGTGTCATGG + Intergenic
1119236753 14:73026633-73026655 CCGGCTGGGGAGAGGTGTCGAGG - Intronic
1119388558 14:74274867-74274889 CAGTCAGAGAAAAGGGGTCTGGG - Intergenic
1127039115 15:54953932-54953954 CTGTCTGGGGAAAGCTGGCTTGG - Intergenic
1127109019 15:55647671-55647693 CCATGTGAGTAAAGGTGCCTGGG + Intronic
1130793169 15:87178357-87178379 CTGTCTGAGGAAAGGTGGGGAGG + Intergenic
1132106498 15:99066634-99066656 CATTCAGAGGACAGGTGTCTGGG + Intergenic
1137835032 16:51583756-51583778 CCTTCTGAGGCAGAGTGTCTGGG - Intergenic
1138600286 16:58049947-58049969 CAGCCTGAGGACAGGTGCCTGGG + Intergenic
1140932553 16:79641034-79641056 CCGTCTGAGGCAAGGGGTGTTGG + Intergenic
1141042484 16:80684175-80684197 CCCGCTGAGGACACGTGTCTTGG + Intronic
1142974469 17:3635529-3635551 CCGGCTGACCAAAGGTTTCTTGG + Intronic
1142996475 17:3763660-3763682 CTGTGTCAGGAAAGGTGGCTGGG + Intronic
1147920720 17:43915330-43915352 CCTTCTGAGGAAAGAGGCCTCGG - Intergenic
1148280401 17:46342570-46342592 CCCTCAGAGGAAGGCTGTCTAGG + Intronic
1148302629 17:46560507-46560529 CCCTCAGAGGAAGGCTGTCTAGG + Intronic
1150237096 17:63601832-63601854 CCTTCCAAGGAAATGTGTCTTGG - Intronic
1150399603 17:64846821-64846843 CCCTCAGAGGAAGGCTGTCTAGG - Intergenic
1150412300 17:64955487-64955509 CCTTCTTAGGAAAGGTATTTGGG + Intergenic
1152621703 17:81368186-81368208 CCGTCTGTTGAAAGGTGGCTTGG - Intergenic
1152715562 17:81898911-81898933 CCCCCTGAGGAGAGGGGTCTGGG - Intronic
1153178894 18:2410117-2410139 ACCTCTTAAGAAAGGTGTCTAGG - Intergenic
1153414841 18:4835415-4835437 CCTTTTCAGGAAAGGTGTTTGGG - Intergenic
1153728906 18:7987286-7987308 CAGTCAGAGGAAAGTTGACTTGG + Intronic
1158110963 18:53941162-53941184 CCAGCTGAGGAAAGGTATGTGGG - Intergenic
1159974402 18:74692571-74692593 GAGGCTGAGGAAAGGTGTCAAGG - Intronic
1160482483 18:79254840-79254862 CTCTCTGAGGAAAGGTATTTAGG - Intronic
1162136935 19:8561237-8561259 CTGTCTGGGGAAAGGTGTGGAGG + Intronic
1162935773 19:13980764-13980786 CCTTCTCAGGAGAGCTGTCTGGG + Intronic
1164526797 19:29018938-29018960 GTGTCTGAGGAAAGGTGCCTGGG + Intergenic
1164965742 19:32481105-32481127 CCTTCTGAGGAAAGTGTTCTTGG + Intronic
1167250417 19:48396048-48396070 CCGTCTGAGGAAGGCAGGCTGGG + Intronic
1168302010 19:55410460-55410482 CTGTCTGAGGAAAGGTCATTTGG + Intergenic
927205106 2:20604017-20604039 CCTTCTGAGGGCAGGGGTCTTGG - Intronic
933172855 2:79142571-79142593 TTGTCTGAGGAAAGGTCTGTGGG + Intergenic
934575970 2:95401871-95401893 CCGTCTGAGGAAAGGTGTCTGGG - Intergenic
934638142 2:96009728-96009750 CTGTCTAAGGAAAGGTATCTGGG - Intergenic
934795510 2:97095682-97095704 CCGTCTAAGGAAAGGTATCTGGG + Intergenic
942985181 2:182132163-182132185 CTGTCTGAGGAAAGGTTTGATGG + Intergenic
946018087 2:216620232-216620254 CTGTCTGAGCAAACTTGTCTAGG - Intergenic
947047309 2:226002519-226002541 CTGCCTAAGGAAGGGTGTCTTGG + Intergenic
947574735 2:231264058-231264080 TCCTCTGATGAAAGGTGTGTTGG + Intronic
948551807 2:238777945-238777967 CCCTCTGAGGACAGGTCTCCAGG + Intergenic
1171023406 20:21607601-21607623 TCATTTGAGGAGAGGTGTCTGGG + Intergenic
1171196905 20:23206961-23206983 CTGTCTGAGGAAGGGAGTCCAGG - Intergenic
1173933763 20:46843892-46843914 CTGTCTGAGTAAATGTGTTTGGG + Intergenic
1180093528 21:45544021-45544043 CCTTCTGTGGGAAGGGGTCTAGG - Intronic
1181838033 22:25627028-25627050 CCATCTGGGGACAGGTGTCATGG + Intronic
1184582665 22:45428083-45428105 CCAAGTGAGGAAAGGTGTTTGGG + Intronic
1184690042 22:46113387-46113409 CCTGCTCAGGAAAGGTGCCTTGG - Intronic
1185293884 22:50043524-50043546 CCATCTAACGAAGGGTGTCTCGG - Intronic
949466773 3:4352509-4352531 CCATCTGGGGAAAGATGGCTGGG + Intronic
953494957 3:43377932-43377954 CCATCTGAGAAAAGATGCCTTGG + Intronic
953704153 3:45218818-45218840 TCGTCTGAGGACAGGTGGCATGG - Intergenic
954629348 3:52039780-52039802 CCCTCTGTGGAAAGGGGGCTGGG - Intergenic
955186314 3:56718619-56718641 CCTTCAGAGGAGAGGTCTCTAGG - Intergenic
960826647 3:121793060-121793082 CCCTCTGAGGCACAGTGTCTTGG - Intronic
960874751 3:122285262-122285284 TCCTCAGAGGAAAGGAGTCTGGG - Exonic
962350831 3:134654587-134654609 CTGGCTGAGGAAAGGTTTCTGGG - Intronic
963302163 3:143610697-143610719 CCCTGTGTGGAAAGGGGTCTGGG - Intronic
964383756 3:156125434-156125456 CCTCCTGAGGAAAAGTGACTTGG + Intronic
964699011 3:159542613-159542635 CCCTCTGTTGAAAGGAGTCTAGG + Intronic
967409521 3:189153475-189153497 CAATCTGAGGCAAGGTATCTTGG + Intronic
968893945 4:3388006-3388028 CCCTCTGAGGAAGTGTGTCCTGG + Intronic
969716599 4:8871089-8871111 CCTTCTGTGGAACGGCGTCTGGG - Intronic
981657557 4:147129281-147129303 CCTTCTGAAGAAAGGAGTATGGG + Intergenic
985226100 4:187763479-187763501 CCCTCTGAGGATAGGTGAGTAGG + Intergenic
991443533 5:66676455-66676477 CCTTGTGAGGAAAAGAGTCTTGG - Intronic
993004481 5:82415748-82415770 CCTTCTGAGGACAGGTCACTGGG + Intergenic
995364951 5:111348002-111348024 CAGTCTGAGGAAATCTTTCTCGG - Intronic
997144470 5:131417762-131417784 CCGTCAAAGGACAGGTGTCCAGG - Intergenic
1000390563 5:160718780-160718802 GGGTCTGATGAAAGGTGTTTGGG - Intronic
1004011142 6:11688901-11688923 CTGTCTAAGGAAAGGTTCCTCGG + Intergenic
1007362338 6:41367947-41367969 CAGGCTGGGGAAAGGTCTCTGGG - Intergenic
1015024969 6:128520926-128520948 CCGTCCGAGGAGAGGCGTCCTGG + Intergenic
1017775574 6:157678293-157678315 ACGTCTGAGGAAAGCAATCTGGG - Intergenic
1018369645 6:163156067-163156089 CCGTGTGCGGAAAGCTGCCTTGG + Intronic
1019421232 7:952240-952262 CCGTGTGAGGGAAGCAGTCTTGG - Intronic
1019983259 7:4637442-4637464 CCTGCGGAGGAACGGTGTCTGGG + Intergenic
1020145966 7:5643343-5643365 CCTTCAGAGGAAAGGTGGTTTGG + Intronic
1020223097 7:6256576-6256598 CCTTCTCAGGAGAGGAGTCTGGG - Intronic
1021385171 7:20020459-20020481 CCAGCTGGGGAAAGGTGACTGGG - Intergenic
1024976242 7:55116451-55116473 CCCTCTGAGCAAAGCTGCCTGGG - Intronic
1030641094 7:112007350-112007372 GCCACTGAGGAATGGTGTCTAGG + Intronic
1032202860 7:129835261-129835283 CCCCCTGAGGAAAGGGGTATTGG + Intronic
1036781468 8:11650791-11650813 TGGTCTGTGGGAAGGTGTCTCGG - Intergenic
1043405235 8:79925380-79925402 CAGTTTGAGGAAATGTGTTTTGG - Intronic
1047647881 8:126887827-126887849 CTCTGTGAGGAAAGGAGTCTAGG - Intergenic
1049065516 8:140310697-140310719 GCCTCTCAGGAAAGGTGTCCTGG + Intronic
1049068949 8:140342098-140342120 CAGGCTGAGTAATGGTGTCTTGG + Intronic
1049874996 8:145011681-145011703 CCCTCTGAGGGAAGGAGTCATGG - Intergenic
1056528877 9:87469602-87469624 CAGTCTCAGGAAAGGCCTCTAGG - Intergenic
1062243493 9:135551880-135551902 GCAGGTGAGGAAAGGTGTCTCGG - Intergenic
1188301575 X:28510835-28510857 AATTCTGAGGAATGGTGTCTTGG - Intergenic
1188998957 X:36922631-36922653 CCTTCTGGGGAAAGCTTTCTAGG + Intergenic
1192241124 X:69329499-69329521 TGGTCTGAGGAAAGATGTTTGGG - Intergenic
1194835196 X:98672891-98672913 CCCTCTGTGGCAAGGTTTCTGGG + Intergenic