ID: 934575972

View in Genome Browser
Species Human (GRCh38)
Location 2:95401872-95401894
Sequence CCCGTCTGAGGAAAGGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934575972_934575979 11 Left 934575972 2:95401872-95401894 CCAGACACCTTTCCTCAGACGGG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 934575979 2:95401906-95401928 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934575972_934575980 17 Left 934575972 2:95401872-95401894 CCAGACACCTTTCCTCAGACGGG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575972_934575978 10 Left 934575972 2:95401872-95401894 CCAGACACCTTTCCTCAGACGGG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 934575978 2:95401905-95401927 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934575972 Original CRISPR CCCGTCTGAGGAAAGGTGTC TGG (reversed) Intergenic
901571978 1:10168249-10168271 CCGGTCTGAGGAAGGGCTTCTGG - Exonic
903864985 1:26391540-26391562 CCAGTCTGTGGCATGGTGTCTGG + Intergenic
904633428 1:31860798-31860820 CCAGGCTGAGGAAAAGCGTCAGG - Intergenic
905263349 1:36734401-36734423 CTCGTCTGAGGAACAGTGTGAGG - Intergenic
905947812 1:41918264-41918286 CCTTTCTTAGGCAAGGTGTCCGG - Intronic
911036948 1:93560549-93560571 CCTGTATGAGGACAGGTGTGTGG + Intergenic
920312110 1:205054580-205054602 ACCATCTGAGGAAAGGGGTATGG + Intronic
1062918831 10:1264728-1264750 CCCTTCTGAGGGAAGTGGTCCGG - Intronic
1063119192 10:3092858-3092880 CCTGTCTGAGGAAAGGGGTGTGG + Intronic
1063946350 10:11180131-11180153 CCCGTCTGAGCCATGATGTCTGG + Intronic
1065762690 10:28997222-28997244 CCCATCTGAGGAAAGGTAAGTGG - Intergenic
1067170812 10:43904433-43904455 CGCACCTGAGTAAAGGTGTCTGG - Intergenic
1067513076 10:46911497-46911519 CCCAGGTGAGGAAAGGTGGCTGG + Intronic
1067649177 10:48140345-48140367 CCCAGGTGAGGAAAGGTGGCTGG - Intergenic
1069077873 10:64057062-64057084 CCCATTTGGGAAAAGGTGTCTGG + Intergenic
1069570334 10:69491017-69491039 CCCCACTGTGGAAAGCTGTCAGG + Intronic
1073426800 10:103459842-103459864 CCTGTCTGGGGAAAGGGGTGGGG + Intergenic
1075090676 10:119442524-119442546 GCAGACTGAGGAAAGGTGGCAGG - Intronic
1076521149 10:131082246-131082268 CCAGTCTGGGGACAGGTGGCTGG - Intergenic
1077761453 11:5104183-5104205 CCTGTCAGAAAAAAGGTGTCTGG - Intergenic
1084498450 11:69519690-69519712 CCCTTCAGTGGAAAGGTGTGAGG + Intergenic
1085034939 11:73293964-73293986 CCTGTGTGAGGAGAGGGGTCAGG + Intronic
1105295626 13:19086110-19086132 CCAGTCTGAGAAAAGGTCCCAGG - Intergenic
1108682245 13:52790352-52790374 CAAGTGGGAGGAAAGGTGTCTGG - Intergenic
1109737397 13:66504755-66504777 ACCTGCTGAGAAAAGGTGTCAGG + Intronic
1112337293 13:98525738-98525760 CTCCTCTGAGGAAAGGGTTCAGG + Intronic
1113192924 13:107771014-107771036 CCCCTTTGAGGAAACATGTCAGG - Intronic
1117294111 14:54363255-54363277 ACCGTCTGAGGAAAGGAGCTAGG + Intergenic
1119388559 14:74274868-74274890 CCAGTCAGAGAAAAGGGGTCTGG - Intergenic
1119662232 14:76460245-76460267 CCCCACTGAGGACAGGTGCCTGG - Intronic
1120891577 14:89496459-89496481 CCTCTCTGAGGAGTGGTGTCAGG - Intronic
1127864208 15:63018703-63018725 CCCGTTTGATGACAGGTCTCTGG + Intergenic
1128768430 15:70265070-70265092 CCTGGCTGAGGATAGGTGTGTGG + Intergenic
1128788749 15:70417149-70417171 ACTGTCTGAGGGAAGGTGTTTGG - Intergenic
1129324996 15:74795108-74795130 GCAGTCTGAGCAAAGGTGTCAGG - Intronic
1135205565 16:20480907-20480929 CCCGTCCGAGGAGAGGTGATGGG + Exonic
1135213342 16:20542906-20542928 CCCGTCCGAGGAGAGGTGATGGG - Exonic
1138600285 16:58049946-58049968 CCAGCCTGAGGACAGGTGCCTGG + Intergenic
1143854599 17:9839431-9839453 CCCATCTAAGGAATGGTCTCAGG + Intronic
1145767466 17:27468806-27468828 GCCGTCTGAGAACAGGTTTCAGG - Intronic
1147068962 17:37937043-37937065 CCCGGCCGAGGGGAGGTGTCGGG + Intergenic
1147096433 17:38140540-38140562 CCCGGCCGAGGGGAGGTGTCGGG + Intergenic
1147320821 17:39644937-39644959 CCTCCCTGAAGAAAGGTGTCTGG + Intronic
1147761883 17:42803633-42803655 CCTGTCTGAACAATGGTGTCTGG + Exonic
1150412298 17:64955486-64955508 CCCTTCTTAGGAAAGGTATTTGG + Intergenic
1151353172 17:73543402-73543424 CCACTCTGAGGACAGGTGTGTGG + Intronic
1158954446 18:62524663-62524685 CCTCTCGGAGGAAAAGTGTCGGG + Intronic
1160548588 18:79679151-79679173 CCCGTCTGGGGCAAGGCGCCCGG - Intergenic
1162935771 19:13980763-13980785 CCCTTCTCAGGAGAGCTGTCTGG + Intronic
1164526796 19:29018937-29018959 AGTGTCTGAGGAAAGGTGCCTGG + Intergenic
1166109668 19:40614297-40614319 CACGTCTGAGGAGAGAGGTCGGG - Exonic
1168137845 19:54363404-54363426 CTCGTCTGGGGAAAAGTGCCGGG + Intronic
1168160177 19:54505229-54505251 CTCGTCTGGGGAAAAGTGCCGGG - Intronic
926335872 2:11862368-11862390 CACATCTGTGGAAAGGTGCCAGG + Intergenic
926688416 2:15716281-15716303 GCCTTGTGAGGAAAGATGTCTGG - Intronic
926695743 2:15769277-15769299 CCCTTCTGAGGAAAAATGACAGG + Intergenic
927099943 2:19780423-19780445 CCCCTGTGAGCAAAGGTGTGCGG - Intergenic
927673706 2:25089698-25089720 CCTGCCTGAGAAAAGGTGTTGGG - Intronic
933224719 2:79734101-79734123 CCCATCTCAGGAAAGCTGTTTGG - Intronic
933290514 2:80433297-80433319 CCCGTCTGGGGAAGGGGCTCAGG + Intronic
934575972 2:95401872-95401894 CCCGTCTGAGGAAAGGTGTCTGG - Intergenic
934638143 2:96009729-96009751 CCTGTCTAAGGAAAGGTATCTGG - Intergenic
934795508 2:97095681-97095703 CCCGTCTAAGGAAAGGTATCTGG + Intergenic
935232314 2:101109666-101109688 CCCATCTGCGGAAAGGTGGTGGG - Intronic
936858931 2:116992972-116992994 CCAGGCTGTGGGAAGGTGTCTGG - Intergenic
938458691 2:131483804-131483826 GGGTTCTGAGGAAAGGTGTCTGG - Intronic
1169537962 20:6566585-6566607 CCTGTCTTAGGAAAGGTCTGTGG + Intergenic
1171163319 20:22948473-22948495 CTCTTCTGAGAAAAAGTGTCTGG + Intergenic
1176078690 20:63260874-63260896 CCCCTCTGAAGACAGGGGTCAGG - Intronic
1180960811 22:19761478-19761500 CCCGGCGGAGGATAGGTGTTAGG - Intronic
950332777 3:12169718-12169740 CCCAGGTGAGGAAAGGGGTCTGG - Intronic
951728986 3:25790109-25790131 CCCGACTGTGGAGAAGTGTCCGG + Exonic
954448224 3:50557874-50557896 GCCGTCTGAGGAAATGCCTCTGG - Intergenic
954629350 3:52039781-52039803 CCCCTCTGTGGAAAGGGGGCTGG - Intergenic
955199711 3:56839930-56839952 CCTGTCAGATGAAACGTGTCCGG - Intronic
959275137 3:104269110-104269132 TCTGTCAGAGGAAAGGTGTAGGG + Intergenic
962120826 3:132558099-132558121 TCTGTCTGAGGAAAGCTGGCTGG - Intergenic
962350832 3:134654588-134654610 ACTGGCTGAGGAAAGGTTTCTGG - Intronic
969716601 4:8871090-8871112 CCCTTCTGTGGAACGGCGTCTGG - Intronic
970664381 4:18320092-18320114 ACCCTCTGAGGAAAGATGTGTGG + Intergenic
981536105 4:145801556-145801578 CCCATCTCAGGACAGGTGACGGG - Intronic
986757601 5:10852811-10852833 TATGTTTGAGGAAAGGTGTCAGG + Intergenic
990012833 5:51021069-51021091 CCTGGCTGAGGGAAGGTGGCAGG + Intergenic
991187929 5:63832303-63832325 CCAGTCTGATGAAAGGTTTCTGG + Intergenic
991647687 5:68817981-68818003 CCAGACTGAGGAAAGCAGTCAGG - Intergenic
999275967 5:150330455-150330477 CCCGTCTGGAGAATGGTGGCAGG + Intronic
999858607 5:155621292-155621314 CCGGTCAGAGGAAAGATGACAGG - Intergenic
1006795678 6:36730850-36730872 CCATTCTGAGGAAATGGGTCAGG + Intronic
1017775575 6:157678294-157678316 CACGTCTGAGGAAAGCAATCTGG - Intergenic
1017875000 6:158516998-158517020 CCCTTCTCAGGGAAGGTGACGGG + Intergenic
1017949793 6:159127143-159127165 GCCTTCTTAGGAAAGGTGACTGG - Intergenic
1019983257 7:4637441-4637463 CCCTGCGGAGGAACGGTGTCTGG + Intergenic
1020182679 7:5934520-5934542 ACCATCTGAGCAGAGGTGTCAGG - Intronic
1020300233 7:6790237-6790259 ACCATCTGAGCAGAGGTGTCAGG + Intronic
1035370637 7:158377000-158377022 CCCGTCTCAGGACATGTGACAGG - Intronic
1036958261 8:13214663-13214685 CTCTTCTGGGGAAAGGTGTAAGG + Intronic
1045413173 8:101940393-101940415 TCCGTCAGAGGAAATGTGTATGG + Intronic
1048211698 8:132459461-132459483 CAAGGCAGAGGAAAGGTGTCAGG + Intronic
1050019802 9:1271083-1271105 CACGTCAGAGTAAATGTGTCTGG - Intergenic
1052839810 9:33283035-33283057 CAGGTCTGAGGAAAGGTGATAGG - Intergenic
1059329061 9:113523767-113523789 CCCGTTTGAGGATGGGTGACAGG + Intronic
1059747328 9:117215736-117215758 CCCATCAGAGGAGAGGTTTCTGG - Intronic
1062099954 9:134722894-134722916 CCCGTTTGAGGGTTGGTGTCGGG + Intronic
1062181900 9:135195362-135195384 CCCATCTGAGCAGGGGTGTCAGG - Intergenic