ID: 934575975

View in Genome Browser
Species Human (GRCh38)
Location 2:95401879-95401901
Sequence CTGGCCACCCGTCTGAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 1, 2: 1, 3: 7, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934575975_934575980 10 Left 934575975 2:95401879-95401901 CCTTTCCTCAGACGGGTGGCCAG 0: 1
1: 1
2: 1
3: 7
4: 93
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575975_934575979 4 Left 934575975 2:95401879-95401901 CCTTTCCTCAGACGGGTGGCCAG 0: 1
1: 1
2: 1
3: 7
4: 93
Right 934575979 2:95401906-95401928 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934575975_934575978 3 Left 934575975 2:95401879-95401901 CCTTTCCTCAGACGGGTGGCCAG 0: 1
1: 1
2: 1
3: 7
4: 93
Right 934575978 2:95401905-95401927 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934575975 Original CRISPR CTGGCCACCCGTCTGAGGAA AGG (reversed) Intergenic
900198905 1:1393575-1393597 CTGGCCACACGTCTGGCGGACGG + Intronic
900298388 1:1964371-1964393 CTGGACGCCAGTCTGAGCAATGG - Intronic
900968587 1:5976594-5976616 CTGGCCAGCCGTGTCAGGAAAGG - Intronic
901326937 1:8372401-8372423 CTGGACACTCCCCTGAGGAAGGG + Intronic
901571980 1:10168256-10168278 CTACTCACCGGTCTGAGGAAGGG - Exonic
902247260 1:15129132-15129154 CCTGCCACCCCTCAGAGGAAGGG - Intergenic
903262096 1:22136878-22136900 CTGGGCACCCGACTCAGGAGGGG + Intronic
908518124 1:64914215-64914237 CTGGCCCCTTGTCTGAGGTAGGG - Intronic
908999824 1:70205278-70205300 CTGGCTAGCAGTCTGAGAAAGGG + Intronic
912143224 1:106757348-106757370 CTGGCCACCTGTCAGAAAAATGG + Intergenic
912322310 1:108725792-108725814 CTGGCCACCTGTCTGTGGCTTGG + Exonic
913969371 1:143402881-143402903 CTGGCCCCCAGTCCGAGGCAAGG + Intergenic
914063748 1:144228480-144228502 CTGGCCCCCAGTCCGAGGCAAGG + Intergenic
914115402 1:144737874-144737896 CTGGCCCCCAGTCCGAGGCAAGG - Intergenic
920071734 1:203307187-203307209 CTGGCCACCCTGCTGATGATGGG - Exonic
1065483119 10:26214070-26214092 CTCGCCCCTCATCTGAGGAAGGG + Intergenic
1069826588 10:71258506-71258528 CTGGCCACACAGCTCAGGAAGGG - Intronic
1069994656 10:72335074-72335096 CTCGCCTGCGGTCTGAGGAAGGG - Exonic
1071992786 10:91116203-91116225 CTAGTCACGTGTCTGAGGAAGGG + Intergenic
1077247168 11:1545261-1545283 CTGGCAACCAGTCCTAGGAACGG - Intergenic
1087306949 11:96499779-96499801 CTGGCCACCAGTATGGGGCAAGG + Intronic
1088118564 11:106340536-106340558 CAGCCCACCCACCTGAGGAAAGG - Intergenic
1089847363 11:121468802-121468824 ATGGACACCTGTCTGAGGACTGG - Intronic
1094359367 12:29613385-29613407 CTGGGAACCTGTCTGAGGAGGGG + Intronic
1094498185 12:31002263-31002285 CTGGCCACCCCCTTGAGGACAGG + Intergenic
1096489962 12:52007795-52007817 CTGGCCCCACGTCTGACGTACGG + Intronic
1096652083 12:53066775-53066797 CTTCCCACCCCTCAGAGGAAGGG + Intronic
1102953112 12:117043108-117043130 CTGGTTATCAGTCTGAGGAAAGG - Intronic
1104049340 12:125185758-125185780 ATGGCCACCCGGGTGAGGCAGGG - Intergenic
1104966815 12:132512097-132512119 CTGCCCACCCATCTGAGGCCTGG + Intronic
1118347817 14:64952384-64952406 CTGGCCACCTCTCTGATGGATGG - Intronic
1121440251 14:93944466-93944488 CTGGCCATCCGTCCCAGGCATGG - Intronic
1123758002 15:23412036-23412058 CTGGAGACCCGGCTGAGGGAGGG - Intergenic
1124794741 15:32766700-32766722 CTGTCCAAACGGCTGAGGAACGG + Exonic
1124962055 15:34406095-34406117 CTGCCCACCCACCTGAGGACAGG - Intronic
1124978678 15:34552316-34552338 CTGCCCACCCACCTGAGGACAGG - Intronic
1127608223 15:60611674-60611696 ATGGCCAGCTGTCAGAGGAAAGG - Intronic
1127683693 15:61321366-61321388 CAGGCCACGCCTCTGAGGGAAGG + Intergenic
1127836734 15:62796570-62796592 TTGGCCAGCAGTTTGAGGAACGG - Intronic
1128838826 15:70832908-70832930 CTGGCCACCCCCCAGAAGAATGG - Exonic
1129706940 15:77799709-77799731 CTGGCCACCATTCTGACGGAAGG + Intronic
1138121086 16:54401635-54401657 CTGGCCAAAGGCCTGAGGAATGG + Intergenic
1139748060 16:69090276-69090298 CTGCCCTCCAGTCTGAGGAGTGG + Intergenic
1141397974 16:83721555-83721577 CTGAACACCTGTCTGAGCAAGGG + Intronic
1141980834 16:87549322-87549344 CTGGCCACCCGGGTGATGGAGGG + Intergenic
1142032565 16:87845839-87845861 CTGTCCATGCGTCTGACGAAGGG + Intronic
1142599622 17:1047280-1047302 CCGGCCACACATCTAAGGAAGGG - Intronic
1146518900 17:33511089-33511111 GTGGGCACCCGTCTGTGAAAAGG - Intronic
1147191241 17:38739348-38739370 CTGGGCACCGGTCTCAGGAAGGG - Intronic
1152293563 17:79454178-79454200 CTGGCCACCCTTCTGAGAACAGG - Intronic
1153849548 18:9080312-9080334 CTGGCCATGCTACTGAGGAAAGG + Intergenic
1156533337 18:37839241-37839263 CTGCCCACCTGCCTGATGAATGG + Intergenic
1157246442 18:46058846-46058868 CTGGCCACCTGCCTGTGGCAAGG - Intronic
1165063313 19:33215559-33215581 CTGGACAGCCTTCTGAGGACAGG - Intronic
1165792276 19:38499612-38499634 CTGGCCACCCGCATGGGGAAAGG - Intronic
1168325376 19:55536268-55536290 CCGGCAAACAGTCTGAGGAAGGG - Exonic
926784599 2:16507761-16507783 CTGGGCCCCCTTCAGAGGAAAGG + Intergenic
928125451 2:28612355-28612377 CTGACCTCCAGTGTGAGGAACGG + Intronic
932248289 2:70216959-70216981 CTGGCCACCCATCTGTTGAATGG + Exonic
933886072 2:86720264-86720286 ATGGCCACCCGGGCGAGGAAAGG - Exonic
933924110 2:87076442-87076464 ATGGCCACCCGGGCGAGGAAAGG + Intergenic
934174062 2:89563784-89563806 CTGGCCCCCAGTCCGAGGCAAGG + Intergenic
934284378 2:91638133-91638155 CTGGCCCCCAGTCCGAGGCAAGG + Intergenic
934575975 2:95401879-95401901 CTGGCCACCCGTCTGAGGAAAGG - Intergenic
934638146 2:96009736-96009758 CTGGCCACCTGTCTAAGGAAAGG - Intergenic
934795505 2:97095674-97095696 CTGGCCACCCGTCTAAGGAAAGG + Intergenic
937090894 2:119205524-119205546 CTGGCCACAGGTCTTAGCAAGGG - Intergenic
937347146 2:121133098-121133120 CAGGCCAGCTCTCTGAGGAAGGG - Intergenic
937444994 2:121950075-121950097 GGGGCCACCCAACTGAGGAAGGG - Intergenic
1171413590 20:24962404-24962426 CTGGCCACCACTCAGGGGAAAGG + Intergenic
1175588498 20:60167337-60167359 ATGGCCAGCCACCTGAGGAAAGG + Intergenic
1183487795 22:38098600-38098622 CTGCCCACCTGTCAGAGAAACGG + Intronic
949120886 3:382104-382126 CTGGCAATGTGTCTGAGGAAGGG + Intronic
950439562 3:13001360-13001382 CTGCTCTCCCGTCTGAGAAATGG + Intronic
950687275 3:14627591-14627613 CTGGGAAGCCTTCTGAGGAAGGG - Intergenic
952927805 3:38334573-38334595 CTGACACCCCATCTGAGGAAGGG + Intergenic
961083209 3:124043934-124043956 CTGGGCAGCCTTCTGAGGAGGGG + Intergenic
968337843 3:197928979-197929001 CTGGCCACAGGGCTGGGGAAGGG - Intronic
969230708 4:5828315-5828337 CTGGGCTCCTGTCTGAGGACAGG - Intronic
969827911 4:9772600-9772622 CTGGCCCCCAGTCTGAGGCAAGG + Intronic
972033989 4:34497298-34497320 CTGGCCAGACCTCTGAAGAAGGG + Intergenic
983010234 4:162537767-162537789 CTGGCCACCAGTATGGGGCAAGG - Intergenic
990543295 5:56796339-56796361 CTGGCCACTAGTCTCAGGATTGG - Intergenic
990580849 5:57166272-57166294 CTGGCTACCCATTTTAGGAAAGG - Intergenic
1001546656 5:172574608-172574630 CTGGCCACGAAGCTGAGGAAGGG + Intergenic
1002174742 5:177395441-177395463 CTGGCCACCCTTCTGTGCCACGG - Intronic
1002480183 5:179496064-179496086 CAGGGCACCACTCTGAGGAAAGG - Intergenic
1005117123 6:22351343-22351365 ATGGTCACCCATCTGAGGAGGGG + Intergenic
1006186981 6:32187047-32187069 TTGGCCACCCGTGGGAAGAAAGG + Intronic
1007238240 6:40406364-40406386 CAGGCCAGCCGTCTGAGGTCTGG + Intronic
1007688366 6:43681015-43681037 CTGGCCGCTCCTCTGAGGGAGGG - Intronic
1008497097 6:52144678-52144700 CTGGCCAGCCTGGTGAGGAAAGG + Intergenic
1013103812 6:107009735-107009757 CTGTCCTCCCATCTGGGGAAGGG - Intergenic
1026395868 7:69953616-69953638 CTGGCCACCCTTCCAATGAATGG - Intronic
1029416906 7:100448995-100449017 CTGGCCCCCAGGCTGAGGAAAGG + Intergenic
1042148800 8:65759467-65759489 CAGGCCACAGGGCTGAGGAATGG + Intronic
1042971290 8:74411843-74411865 CTGCCCTCCAGTCTGAGCAATGG + Intronic
1046340982 8:112853929-112853951 GTGGTCACACCTCTGAGGAAAGG - Intronic
1047747505 8:127855811-127855833 CTGGCTTCCCTTCTGAGGAGCGG + Intergenic
1051370821 9:16357702-16357724 CTGGCCACCCCACTAGGGAAGGG + Intergenic
1186568117 X:10686193-10686215 CTGACCATCCTTCTGGGGAAGGG + Intronic
1187231226 X:17425189-17425211 CTTGGCAACCTTCTGAGGAATGG + Intronic
1195004429 X:100671965-100671987 CTGGGGACTCCTCTGAGGAAGGG - Intergenic