ID: 934575976

View in Genome Browser
Species Human (GRCh38)
Location 2:95401884-95401906
Sequence TTTCTCTGGCCACCCGTCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 1, 2: 2, 3: 12, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934575976_934575979 -1 Left 934575976 2:95401884-95401906 CCTCAGACGGGTGGCCAGAGAAA 0: 1
1: 1
2: 2
3: 12
4: 134
Right 934575979 2:95401906-95401928 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934575976_934575981 30 Left 934575976 2:95401884-95401906 CCTCAGACGGGTGGCCAGAGAAA 0: 1
1: 1
2: 2
3: 12
4: 134
Right 934575981 2:95401937-95401959 CGCCACTGAGAACCTTCCAGCGG 0: 1
1: 2
2: 2
3: 71
4: 465
934575976_934575978 -2 Left 934575976 2:95401884-95401906 CCTCAGACGGGTGGCCAGAGAAA 0: 1
1: 1
2: 2
3: 12
4: 134
Right 934575978 2:95401905-95401927 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363
934575976_934575980 5 Left 934575976 2:95401884-95401906 CCTCAGACGGGTGGCCAGAGAAA 0: 1
1: 1
2: 2
3: 12
4: 134
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934575976 Original CRISPR TTTCTCTGGCCACCCGTCTG AGG (reversed) Intergenic
900968588 1:5976599-5976621 TCTCTCTGGCCAGCCGTGTCAGG - Intronic
901104356 1:6743726-6743748 TCTCTGTGGCCACACGCCTGAGG + Intergenic
901154801 1:7128354-7128376 CTTCCCTGGCCACCCGTGTTGGG - Intronic
902814496 1:18908429-18908451 TTTCTCTGCCCTCCCTTCTCTGG - Exonic
904036699 1:27562686-27562708 TTCCTCTGGCCAGCCCTTTGGGG + Intronic
904786241 1:32985127-32985149 TTTCCCTGGACACCCATCAGAGG + Intergenic
904984531 1:34534068-34534090 ATTCTCTGGCTTCCCGTCTCTGG + Intergenic
905085768 1:35374839-35374861 TTTCTTTGGCCTCCAGTCTCTGG + Intronic
912322305 1:108725787-108725809 TCCCCCTGGCCACCTGTCTGTGG + Exonic
918150247 1:181792064-181792086 ATTCTCTGCCCTCCCCTCTGAGG + Intronic
922699908 1:227753131-227753153 TTTCTCAATCCATCCGTCTGTGG + Intronic
1063461186 10:6215930-6215952 TTCCTGAGGCCACCCGTGTGGGG + Intronic
1064339530 10:14473924-14473946 TTCCTCTGCCCACCCCCCTGGGG + Intergenic
1072626516 10:97115786-97115808 TTTCTCTGCCCTTCCTTCTGAGG + Intronic
1077527581 11:3076803-3076825 TTCCTCTGTCCCCCAGTCTGCGG + Intergenic
1078288508 11:9982975-9982997 CTCCTCTGGCCACCCTTCTGAGG - Intronic
1080142672 11:28941583-28941605 TTTCTCTTGCCCCCTATCTGAGG - Intergenic
1083183729 11:61005356-61005378 TTCCTCTGGCCCCCCCTGTGAGG - Intronic
1085065434 11:73491163-73491185 CCTCTCTGGCCAGCTGTCTGGGG - Intronic
1085361621 11:75893143-75893165 TTGCTCTGGCCTCCAGGCTGGGG - Intronic
1085458450 11:76678917-76678939 GAACTCTGGCCACCCGCCTGGGG - Intergenic
1089183641 11:116599806-116599828 TCTCTCTGGCTTCCCTTCTGTGG - Intergenic
1089307976 11:117538699-117538721 TCTCTCTGTCCAGCCCTCTGGGG - Intronic
1092785769 12:12025289-12025311 TTACTCTGGCCTCCTGCCTGGGG + Intergenic
1095118574 12:38385472-38385494 CTCCTCTGGCCACCCTCCTGAGG + Intergenic
1095294050 12:40508283-40508305 GTTCTCTAGACACCTGTCTGTGG + Intronic
1095294353 12:40511236-40511258 GTTCTCTGGACACCTGTCTGAGG + Intronic
1096607516 12:52777222-52777244 TTTCTCTGGCCGCTCTGCTGTGG - Exonic
1100075851 12:90781976-90781998 TCTCTCTGGCCATCGATCTGTGG - Intergenic
1100431315 12:94534111-94534133 TTTCTCCTGCCACGCCTCTGAGG - Intergenic
1102191093 12:110988859-110988881 TTTCACTGGCCACCCGTTGATGG - Intergenic
1102620334 12:114189516-114189538 AGTCTCTGGGCACCAGTCTGGGG + Intergenic
1105855950 13:24371946-24371968 TTTCTACTGCCACCTGTCTGGGG - Intergenic
1108682709 13:52793129-52793151 TTGCTCTGGCGACCAGGCTGGGG - Intergenic
1110873276 13:80478013-80478035 TGTCTCTGGCCCAACGTCTGTGG - Intergenic
1111034229 13:82649974-82649996 TTTCCATGGCCATCCTTCTGTGG - Intergenic
1111361330 13:87181830-87181852 TTTCTCTGTCCCCCAGACTGGGG + Intergenic
1114054661 14:18957034-18957056 TTTCTCTAGTCACCCTGCTGAGG + Intergenic
1114107894 14:19444897-19444919 TTTCTCTAGTCACCCTGCTGAGG - Intergenic
1118365743 14:65094229-65094251 TTCCCCTGGACACCCATCTGGGG - Intronic
1119863020 14:77950612-77950634 GTTCTCTGGACTCCCATCTGAGG - Intergenic
1127731566 15:61806974-61806996 TTTCTCTGGCCTCCCCTCCAGGG + Intergenic
1127864804 15:63023605-63023627 TTTTTCTTGCCATCCGTGTGGGG - Intergenic
1129241444 15:74254639-74254661 TGTCTCTGGCCACTCCACTGTGG + Intronic
1131516444 15:93080707-93080729 TTTCCATGGCCACCCTTCCGTGG + Intronic
1131563168 15:93462018-93462040 TTTATCTGGCAACCCTACTGAGG + Intergenic
1132824807 16:1899016-1899038 TTTTTCTGCCCACCCGTCCAGGG + Intergenic
1136319663 16:29475330-29475352 TTTCTCCGGGGACCCTTCTGTGG - Intergenic
1136434234 16:30214674-30214696 TTTCTCCGGGGACCCTTCTGTGG - Intergenic
1138674278 16:58639776-58639798 TCGCTCTGGCCCCCAGTCTGGGG + Intergenic
1139029693 16:62863953-62863975 TTTCTTTGGCCACCTGCCTTTGG - Intergenic
1139902587 16:70339991-70340013 TTTCTCTGGCCACTCTTCTGGGG + Intronic
1141733983 16:85840228-85840250 TGTCTCTGGCCTCCCCTCTCAGG + Intergenic
1142265079 16:89060587-89060609 TTTCTCTGACCACGTGTGTGAGG + Intergenic
1142597972 17:1038802-1038824 ATTCTCTGGCAACCCTTCTGTGG + Intronic
1148057271 17:44807632-44807654 TTTCTCCTGCCACCTGTATGGGG - Intronic
1149000982 17:51757083-51757105 TGTCTCTGGCCACTCTGCTGAGG + Intronic
1151409722 17:73914208-73914230 TTTCTCAGAGCACCCGTCAGAGG - Intergenic
1152388781 17:79990979-79991001 TTTCTCTAGTCACCCGTCGGGGG + Intronic
1153285745 18:3452477-3452499 TTTCCCTGGCGAGTCGTCTGGGG + Intronic
1153531453 18:6050930-6050952 TTTCTCTGGCCTCAGGTCTCTGG + Intronic
1154008938 18:10559383-10559405 TTGCACTGGCCACCTGCCTGTGG + Intergenic
1158404590 18:57149996-57150018 TTTATCTGGCAACCTGTCTCAGG - Exonic
1158459625 18:57634749-57634771 TTTCTCTGTCCCCCAGGCTGGGG + Intergenic
1158925453 18:62253140-62253162 TTTCTCTGACCACCCTTCATAGG - Intronic
1159273438 18:66184229-66184251 TTACTCTGTCAACCCATCTGAGG + Intergenic
1161139522 19:2639400-2639422 GTTCTCTGGGCATCCTTCTGTGG - Intronic
1162754102 19:12847106-12847128 TGTCCCTGTCCACCTGTCTGTGG + Intronic
1162938494 19:13994042-13994064 TATTTCTGGCCACCAGCCTGGGG - Intronic
1163803928 19:19385092-19385114 TTTCCCTGGCCCCCGTTCTGAGG - Intergenic
1164821937 19:31257285-31257307 TTTCCCAGGCCAGCCCTCTGGGG - Intergenic
1167384346 19:49155390-49155412 TGGCTCTGGACACCCCTCTGAGG + Exonic
930725441 2:54677157-54677179 TTTATCTTGCCAACCTTCTGAGG - Intergenic
934575976 2:95401884-95401906 TTTCTCTGGCCACCCGTCTGAGG - Intergenic
934638147 2:96009741-96009763 TTTCTCTGGCCACCTGTCTAAGG - Intergenic
934795504 2:97095669-97095691 TTTCTCTGGCCACCCGTCTAAGG + Intergenic
938472669 2:131579888-131579910 TTTCTCTAGTCACCCTGCTGAGG + Intergenic
940283097 2:152007600-152007622 TTTCTTTAGCCATCCGTCTGTGG + Intronic
942070449 2:172311419-172311441 TTTCCCTGGCCCCCTTTCTGAGG + Intergenic
942442821 2:176053599-176053621 TGTCTCTGGCCATCCACCTGTGG + Intergenic
946216277 2:218186266-218186288 TTTCTCTTGCCTCCAGTCTCTGG + Intergenic
948549655 2:238761817-238761839 TTCCTCTGACTACCCTTCTGCGG + Intergenic
948794138 2:240393544-240393566 TTTCTCTGCCCACCCACGTGAGG - Intergenic
1169882501 20:10362452-10362474 TTTCTGAGTCCACCTGTCTGGGG + Intergenic
1172270662 20:33654010-33654032 TTTCTCTCCCCACCAATCTGTGG + Intergenic
1173981736 20:47229627-47229649 CTTCTCTGGAAACCCCTCTGGGG - Intronic
1175227176 20:57451357-57451379 TATCTTTGGCCTCCTGTCTGGGG + Intergenic
1179336236 21:40457478-40457500 TTTCTCTGTCCCCCAGGCTGGGG - Intronic
1179728359 21:43353564-43353586 GTTGTCTGGACCCCCGTCTGTGG + Intergenic
1180149505 21:45940476-45940498 TAGTTCTGGCCACCTGTCTGAGG - Intronic
1180473130 22:15679426-15679448 TTTCTCTAGTCACCCTGCTGAGG + Intergenic
1180848458 22:18997512-18997534 CTTCTCTGGACACGAGTCTGGGG + Intergenic
1182093126 22:27609484-27609506 TTTCCCTGGCCACTGGCCTGGGG - Intergenic
1182094702 22:27618223-27618245 TTTCTCTGGTGCCCAGTCTGGGG - Intergenic
949694947 3:6683403-6683425 TTTTTCTGTCCTCCCTTCTGTGG - Intergenic
950188257 3:10958681-10958703 TGCCTCTGGCCACCCATCCGTGG - Intergenic
950592468 3:13948227-13948249 CCCCTCTGGCCACCCTTCTGCGG + Intronic
950865166 3:16182973-16182995 TTTCTCTGGCCGCTAGCCTGGGG + Intronic
950899476 3:16484293-16484315 TTTCTTTGACCTCCAGTCTGGGG - Intronic
953025198 3:39141245-39141267 TTTCTCAGGCCCCCAGACTGGGG + Intergenic
954436755 3:50500372-50500394 TTTCTCTGTCCCCTCCTCTGTGG - Intronic
955856665 3:63279344-63279366 TTTCTCTGGCCACTCCTCTAGGG + Intronic
956763645 3:72465440-72465462 CTTCTCTGGCCCCTCCTCTGTGG - Intergenic
958681244 3:97334509-97334531 TTTCTCTGTCCCCCAGGCTGGGG + Intronic
959885649 3:111496996-111497018 TATCTCTGGCCACCTATCTCTGG - Intronic
969888405 4:10237164-10237186 TGACTCTGGCCACAAGTCTGAGG + Intergenic
975879615 4:78888640-78888662 TTTCTCTGGACACCCTTATTTGG + Intronic
984563752 4:181302295-181302317 TTCCTCTGACCACCTGGCTGAGG - Intergenic
985686897 5:1286329-1286351 TGTCTCAGGCCCGCCGTCTGGGG - Intronic
985705631 5:1400013-1400035 TCCCTCTGGCCACCTCTCTGTGG - Intronic
986382907 5:7204733-7204755 TTTATCTGGCCACCCATCCCAGG + Intergenic
987135002 5:14892128-14892150 TGTATCTGGCCACCCTTTTGTGG + Intergenic
987945318 5:24600515-24600537 TTTCTCAGACCACCCGTGTTTGG - Intronic
996707865 5:126515004-126515026 TATCTCTGGCCACCAGCTTGAGG + Intergenic
998393351 5:141802048-141802070 TTTCTCTGGCCAGCCCTCTAGGG + Intergenic
999188781 5:149731410-149731432 TTTCTCTGGGCGCCCGGCTGCGG + Intronic
1003532379 6:6948474-6948496 TTTCTCTGGCCACAGGTCTCAGG + Intergenic
1004018026 6:11750037-11750059 GTTCTCTGGCCTCCAGTCTTTGG - Intronic
1004346766 6:14856287-14856309 TGTGTCCGGCCACCAGTCTGCGG - Intergenic
1005117119 6:22351338-22351360 TTTCCATGGTCACCCATCTGAGG + Intergenic
1006986646 6:38179984-38180006 TCACTCTGGTCACCCCTCTGTGG + Intronic
1008441841 6:51540626-51540648 TCTCTGTGGCCACCTCTCTGGGG + Intergenic
1009903304 6:69836438-69836460 GTTCCCTGTCCACCCTTCTGAGG + Intergenic
1013103814 6:107009740-107009762 TTTGTCTGTCCTCCCATCTGGGG - Intergenic
1016277150 6:142367553-142367575 TTTGTCTGGCCAGCAGTGTGGGG + Exonic
1017266731 6:152454545-152454567 TTGCTTTAGCCACCCGTCTATGG + Intronic
1019207616 6:170375964-170375986 TTTTTAGGGCCACCCATCTGTGG - Intronic
1022508101 7:30919162-30919184 TTTCTCTGCCCACGCCTCTGAGG - Intronic
1022515111 7:30970305-30970327 CTTCTCTGGCCCTCAGTCTGTGG + Intronic
1023004519 7:35848914-35848936 TTTCACTTGCTACACGTCTGAGG - Intronic
1024209600 7:47192150-47192172 GTTCTCCCGCCACCCTTCTGGGG - Intergenic
1026673726 7:72412045-72412067 TTTCTGTGCCCACCTGTGTGCGG + Exonic
1027829641 7:83162203-83162225 TCTCTATGGCCACCCCACTGGGG + Intronic
1030130020 7:106191564-106191586 TTTCTCTGGTCATCCTTCTCTGG + Intergenic
1030386385 7:108872444-108872466 TTCCACTGGCCACCTGCCTGTGG + Intergenic
1034257447 7:149732451-149732473 TTTCTCTGGGCCCCCAGCTGTGG - Intronic
1035601493 8:899571-899593 TATCTCTGGCCTCCCTTCTATGG - Intergenic
1037279859 8:17227475-17227497 TTTCTCTGGACACATGTCTTTGG + Intergenic
1040414945 8:47187696-47187718 CTACTCTGGCCTCCTGTCTGAGG - Intergenic
1042797561 8:72680992-72681014 TTTCTTTGGCTCCCAGTCTGAGG - Intronic
1043011808 8:74890400-74890422 TTCCTCTGGTCACTCCTCTGTGG + Intergenic
1047802467 8:128324268-128324290 CTCCTCTGGCCACTCTTCTGAGG + Intergenic
1049507965 8:143013885-143013907 TTTCTCTGGCCACGATTCAGGGG - Intergenic
1049770412 8:144377889-144377911 TTCCTCTGGCCACTGGTCAGTGG + Intronic
1058741231 9:107944579-107944601 TTTCGCTTACCACCCGTCTGCGG - Intergenic
1060742792 9:126110655-126110677 TTTCTCTAGACCCCCTTCTGGGG - Intergenic
1186103577 X:6182208-6182230 TTTCACTGGCCATCAGTCTTTGG + Intronic
1186525771 X:10247022-10247044 TTTCTCTCTCCTCCCTTCTGAGG + Intergenic
1196940444 X:120770653-120770675 TTTCTCTGGCCACAAGTCTCTGG - Intergenic
1199392472 X:147296873-147296895 TTTCTCTGGCTGCCCACCTGTGG + Intergenic