ID: 934575980

View in Genome Browser
Species Human (GRCh38)
Location 2:95401912-95401934
Sequence CTCAAATAGAAGTCGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 2, 2: 0, 3: 2, 4: 93}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934575968_934575980 22 Left 934575968 2:95401867-95401889 CCCACCCAGACACCTTTCCTCAG 0: 1
1: 0
2: 2
3: 30
4: 330
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575975_934575980 10 Left 934575975 2:95401879-95401901 CCTTTCCTCAGACGGGTGGCCAG 0: 1
1: 1
2: 1
3: 7
4: 93
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575969_934575980 21 Left 934575969 2:95401868-95401890 CCACCCAGACACCTTTCCTCAGA 0: 1
1: 0
2: 4
3: 22
4: 272
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575966_934575980 30 Left 934575966 2:95401859-95401881 CCGCACCACCCACCCAGACACCT 0: 1
1: 4
2: 5
3: 103
4: 1025
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575970_934575980 18 Left 934575970 2:95401871-95401893 CCCAGACACCTTTCCTCAGACGG 0: 1
1: 0
2: 1
3: 9
4: 133
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575967_934575980 25 Left 934575967 2:95401864-95401886 CCACCCACCCAGACACCTTTCCT 0: 1
1: 3
2: 3
3: 82
4: 785
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575976_934575980 5 Left 934575976 2:95401884-95401906 CCTCAGACGGGTGGCCAGAGAAA 0: 1
1: 1
2: 2
3: 12
4: 134
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575972_934575980 17 Left 934575972 2:95401872-95401894 CCAGACACCTTTCCTCAGACGGG 0: 1
1: 0
2: 1
3: 4
4: 98
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93
934575977_934575980 -9 Left 934575977 2:95401898-95401920 CCAGAGAAAAACTTCTCAAATAG 0: 3
1: 1
2: 1
3: 31
4: 271
Right 934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG 0: 1
1: 2
2: 0
3: 2
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934575980 Original CRISPR CTCAAATAGAAGTCGGGACA TGG Intergenic
908133671 1:61103956-61103978 CTCAAATAAAAGTCAAGACCAGG - Intronic
908818668 1:68059385-68059407 CACAAATAGAATTCAGAACATGG + Intergenic
912048969 1:105499132-105499154 CTCTTATTGAAGTCAGGACAAGG - Intergenic
912415978 1:109508844-109508866 CTCAAAAAGCAGCAGGGACAAGG + Exonic
917294640 1:173505895-173505917 CTCAAGTACAAGTAGGCACAGGG + Intronic
923445477 1:234066658-234066680 CTCAAATAGAAGTTGGACGAGGG + Intronic
924422940 1:243926094-243926116 CTGAGATAGACGTCGGGATAGGG + Intergenic
1066054576 10:31668500-31668522 CTCACATGGAAGAAGGGACAGGG + Intergenic
1068990297 10:63143232-63143254 CAAAAATAGAAGTGGGGAAAAGG + Intronic
1071213068 10:83366735-83366757 CTCTAATAGAAGTCTGGGGATGG - Intergenic
1074549780 10:114431850-114431872 CTCAAAAAGAAGGGGGGAAATGG - Intronic
1079229241 11:18635096-18635118 CTCCAAAAGAAGTCAGGACTAGG - Intergenic
1088223357 11:107591753-107591775 CCAAAATGGAAGGCGGGACAAGG + Intronic
1090848743 11:130552194-130552216 CTCACATAGTGGACGGGACAAGG - Intergenic
1106224745 13:27776351-27776373 CCCAAATAGAAGTCTAGACTAGG + Intergenic
1108554699 13:51581692-51581714 CTCAAAGAGTATTCGGGAGAGGG - Intergenic
1109358367 13:61263845-61263867 CTCAAATAGATGAGGTGACAAGG - Intergenic
1110833386 13:80057138-80057160 CTCATGTAGAAGTCTGGAGATGG + Intergenic
1111381167 13:87454703-87454725 CTCATATGGAAGAAGGGACAAGG - Intergenic
1115479017 14:33843781-33843803 CTCAAATAGATTACGGGAAAAGG - Intergenic
1118749075 14:68793649-68793671 GTCGAAGAGAAGTCGGGAAAAGG - Intronic
1122023029 14:98854831-98854853 CCCAAAAAGAAGTCGGGGCTGGG + Intergenic
1122379622 14:101293163-101293185 CTCCAAGAGAAGAGGGGACAGGG + Intergenic
1128744442 15:70103634-70103656 CTGAAATGGGAGTCGGGATAGGG - Intergenic
1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG + Intergenic
1134179791 16:12038264-12038286 CTGAACTAGAATTTGGGACAAGG + Intronic
1135306536 16:21372022-21372044 CTGAACTAGAATTTGGGACAAGG + Intergenic
1136303280 16:29351164-29351186 CTGAACTAGAATTTGGGACAAGG + Intergenic
1140250177 16:73288267-73288289 CTCAAATAAAAATCCGGCCAGGG + Intergenic
1143190287 17:5035365-5035387 CTCAAATGGACCCCGGGACAAGG + Exonic
1145070459 17:19801276-19801298 CTCAAAAAGAAGTTGGGGCCGGG + Intronic
1145188336 17:20815763-20815785 ATCAATTAGAAGTCAGGATATGG + Intergenic
1150078569 17:62215908-62215930 ATCAATTAGAAGTCAGGATATGG - Intergenic
1152307342 17:79529025-79529047 CTCAGGTAGAGGTGGGGACATGG + Intergenic
1157894637 18:51453987-51454009 CCCAGATACAAGTGGGGACATGG + Intergenic
1164705851 19:30319115-30319137 TTAAAATAGAAGTCCGGGCATGG + Intronic
1165602982 19:37073831-37073853 CTCAAAGACAAATGGGGACACGG + Intronic
1166439002 19:42794175-42794197 CTGAGAAAGAATTCGGGACATGG + Intronic
1166487962 19:43230026-43230048 CTGAAAAAGAATTCAGGACATGG + Intronic
925864772 2:8217827-8217849 TTAAAATAGAAGTGGGGGCAGGG - Intergenic
926409469 2:12587864-12587886 CTCCATTAGAAGTTGGAACAAGG + Intergenic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
937944243 2:127317243-127317265 CTTAAAAAGAAGTAGAGACAAGG - Intronic
939236075 2:139495231-139495253 GTCAAATAGAACTAGGGAAATGG + Intergenic
939588934 2:144039686-144039708 CTCAAACAGAAGTCAGGAAAAGG - Intronic
942291672 2:174478508-174478530 CTAAAAAAGAAGGCTGGACATGG - Intronic
945405154 2:209437839-209437861 CTCAAATACAAGTCCTGATAAGG - Intronic
1178494241 21:33073230-33073252 CTTAAGGAGAAGTCAGGACAGGG + Intergenic
1182011305 22:27002946-27002968 CTGAAATGGAAGTAGGGGCAAGG - Intergenic
1184053522 22:42027228-42027250 CTAAAATTGAAGTCAGGATAAGG + Exonic
949774714 3:7619753-7619775 CTGATAAAGAAGTTGGGACAAGG + Intronic
950422766 3:12908447-12908469 CTCAAAAAGGAGTCGGGCAACGG - Exonic
956486522 3:69728701-69728723 CTCAAATAGAAATCAGAAGAGGG - Intergenic
956529676 3:70203884-70203906 CAGAAACAGAAGTGGGGACATGG + Intergenic
957637418 3:82804732-82804754 ATTAAATAGAAGTCAGCACAAGG + Intergenic
960636484 3:119789729-119789751 CTCAGAGAGAAGGCAGGACAGGG - Intronic
967685930 3:192416250-192416272 ATCAAATGGAAGTTTGGACAAGG + Intronic
967757531 3:193186900-193186922 CTCAAAAGAAAGTCGGGAAAGGG - Intergenic
970472057 4:16388817-16388839 CTCAAAGAGAAATGGGGAAAGGG - Intergenic
970732068 4:19117463-19117485 CTCACATAGCAGAAGGGACAAGG + Intergenic
974060043 4:57024602-57024624 TTCAAATAGAAGTCGATCCATGG - Intronic
975752411 4:77537681-77537703 CTCAAATGGATGCTGGGACATGG - Intronic
978841084 4:113213474-113213496 CTCAAATATAAGTCTTGAGAAGG + Intronic
983050055 4:163035490-163035512 CTCACACAGAAGTCTGAACAAGG + Intergenic
983162951 4:164439885-164439907 CTCACAGAGAAGTCTGGAGAGGG + Intergenic
987292762 5:16524027-16524049 CTCAGATGGAAGGCGGGGCAGGG - Intronic
990559256 5:56967153-56967175 CTCAAATGGTAGAAGGGACAAGG - Intronic
999130476 5:149279146-149279168 CTAAAGTTGAAGTGGGGACATGG + Intronic
1007459455 6:42007379-42007401 GTCCAATTGAAGTCAGGACAAGG + Intronic
1009808488 6:68633130-68633152 TTCAAGTAGAAGTCAGGGCAGGG - Intergenic
1009915534 6:69990888-69990910 CTAAAATAGAAGTCAGAAAAAGG - Intronic
1010666615 6:78638238-78638260 CTCAAATAGTAATCTGGAAAGGG - Intergenic
1011229039 6:85139277-85139299 CTCTAACAGAAATAGGGACATGG - Intergenic
1015408304 6:132862574-132862596 CTAAATTAGAAGTAGGAACAAGG - Intergenic
1031907251 7:127474428-127474450 CTCAAAGAGAAGTAGGGGGAAGG - Intergenic
1032299770 7:130675937-130675959 CTCAACTAGGAGTGGGGACACGG + Intronic
1033129700 7:138735293-138735315 CTCAAGTACAGGTGGGGACAGGG - Intronic
1034733451 7:153408443-153408465 ATCAAATAGAAGGCAGGAAAAGG - Intergenic
1038348043 8:26750158-26750180 CTCAGATAGCAGAAGGGACAAGG + Intronic
1038985453 8:32804167-32804189 CTGAATTAGGAGTCAGGACAGGG - Intergenic
1039805870 8:40997534-40997556 ATTAAATAGAAGTCTGGGCATGG - Intergenic
1042837199 8:73089872-73089894 CTCAAAAAAAAGTAGGGGCAGGG - Intronic
1044337721 8:91007208-91007230 ATCCAATAGAAGTCTGTACATGG - Intronic
1044501242 8:92960776-92960798 CTGAAATCAAGGTCGGGACAGGG - Intronic
1046086890 8:109448332-109448354 CTCAAATACAACTGTGGACATGG - Exonic
1047953276 8:129953362-129953384 CTCAAGTACAAGTTGGGACCAGG - Intronic
1052028207 9:23598476-23598498 TTCAAAAAGATGTCAGGACATGG + Intergenic
1057724026 9:97555694-97555716 CTCACATAGAACCTGGGACATGG - Intronic
1188637422 X:32451736-32451758 CACAGGTAGAAGTCTGGACAAGG + Intronic
1190374789 X:49778317-49778339 CTTAAATAGAGGGCTGGACATGG + Intergenic
1191880879 X:65842881-65842903 TTGAAATAGGAGTCGGAACAAGG - Intergenic
1195633196 X:107082053-107082075 GTCAAAAAGAAGTGGGGAAAGGG + Intronic
1195742036 X:108074631-108074653 CTATAATAGAAGTCTGAACAGGG + Intronic
1199525104 X:148783464-148783486 CTAAAATACAAGTCAGGAAAAGG - Intronic
1200017055 X:153173920-153173942 CTCACATGGAAGACGGGGCAAGG - Intergenic
1200737265 Y:6813226-6813248 CTCTAATAAGAGTCTGGACAGGG + Intergenic