ID: 934578490

View in Genome Browser
Species Human (GRCh38)
Location 2:95418600-95418622
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 3, 1: 0, 2: 2, 3: 37, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934578482_934578490 12 Left 934578482 2:95418565-95418587 CCACAGGTGTGCACAGTAACCGG 0: 2
1: 1
2: 0
3: 5
4: 60
Right 934578490 2:95418600-95418622 GTAGAGAGCTTCAGGAAGGAGGG 0: 3
1: 0
2: 2
3: 37
4: 388
934578486_934578490 -7 Left 934578486 2:95418584-95418606 CCGGGATGTGAGGTTAGTAGAGA 0: 2
1: 0
2: 1
3: 6
4: 92
Right 934578490 2:95418600-95418622 GTAGAGAGCTTCAGGAAGGAGGG 0: 3
1: 0
2: 2
3: 37
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
901372095 1:8807553-8807575 TTAGAGAGATTCAAGAAGAAAGG - Intronic
901564985 1:10106558-10106580 GGAGAGATCCTCAGGGAGGAGGG - Exonic
901761597 1:11475292-11475314 GAACAGAGCTTCAGGGAGGAAGG + Intergenic
902113816 1:14104870-14104892 ATAAATAGCTTCAGGAATGAAGG - Intergenic
902114139 1:14107058-14107080 GGAGAGAGATGAAGGAAGGAAGG - Intergenic
902745276 1:18469743-18469765 GGAGAGAGCTGGAGGAGGGAGGG - Intergenic
903446406 1:23424963-23424985 GAAGAGAGATTTGGGAAGGAGGG + Intergenic
905032703 1:34898359-34898381 GTAAAGTCTTTCAGGAAGGAAGG + Intronic
907835558 1:58105338-58105360 ATAAAGAGCTCCAGCAAGGAAGG - Intronic
908644909 1:66266698-66266720 GTTGAGAGCTGCAGAGAGGAAGG + Intronic
909093144 1:71252637-71252659 GGAGAGAGATTTAGGAAGGAGGG + Intergenic
909742136 1:79042914-79042936 GTACAAAGCCTCAGTAAGGAGGG + Intergenic
909848469 1:80429322-80429344 GTAGATTGCTTCAGGTAGTATGG + Intergenic
909949924 1:81706744-81706766 GTGGAGAGTTTCTGGAAGCAAGG + Intronic
909956045 1:81780325-81780347 GTAGAAAGCTTTGGGATGGAAGG + Intronic
910095701 1:83519377-83519399 GTAGAAGGGTTCAGGAAAGAGGG + Intergenic
910098466 1:83551161-83551183 GGAGAGAGCATTGGGAAGGAGGG + Intergenic
911284723 1:95975371-95975393 GAAAAGTGGTTCAGGAAGGAGGG - Intergenic
912099907 1:106192100-106192122 GGACAGAGCTTCCAGAAGGAGGG + Intergenic
912451383 1:109769765-109769787 AGAGAGTGTTTCAGGAAGGAGGG + Intronic
912728354 1:112078978-112079000 GCAGAGAACTGAAGGAAGGAAGG + Intergenic
914391270 1:147225286-147225308 GTTGAGCGCTTCAGGAAAGGCGG - Exonic
916584321 1:166137091-166137113 GTAGAGAGCATGAGGTTGGAAGG + Intronic
919141902 1:193582845-193582867 GGAGAGAGTTTCAAGAAGAATGG + Intergenic
919879993 1:201894995-201895017 CTAGAGGGCTGGAGGAAGGAGGG + Intergenic
920580720 1:207105023-207105045 GAAGAGAATTTCAAGAAGGAAGG - Intronic
920819259 1:209365094-209365116 GAAGAAAGGTTAAGGAAGGAGGG - Intergenic
923416056 1:233761443-233761465 GAAGAGAGATCAAGGAAGGAAGG + Intergenic
923469284 1:234276533-234276555 GTAGAAAGCTTCATGAAGATGGG + Intronic
924073450 1:240307813-240307835 GTAGATTGCTTCAGGCAGTATGG + Intronic
1063674987 10:8132955-8132977 GTAGATAGCTTGAGGAAAAAAGG + Intergenic
1064178503 10:13096122-13096144 GTAGAGAGAGAAAGGAAGGAGGG - Intronic
1064443290 10:15371689-15371711 GTGGACAGCTTCAGGAGGAATGG + Intergenic
1065465204 10:26012656-26012678 GTAGATTGCTTCAGGCAGTATGG - Intronic
1065665903 10:28060438-28060460 GTTGGGATCTGCAGGAAGGATGG - Intronic
1071207926 10:83304557-83304579 TTAGAGAGATTCAGTAAAGAAGG - Intergenic
1071373708 10:84980753-84980775 GTAGAGTGCTTTAGGCAGTATGG - Intergenic
1072009709 10:91292300-91292322 GTGGGGAGCTTGAGAAAGGAAGG - Intergenic
1072024191 10:91437752-91437774 ATAGAGAAATTCAGGAAGTATGG - Intronic
1073366012 10:102941652-102941674 GTACAGATCTGAAGGAAGGAGGG - Intronic
1073705862 10:105983462-105983484 GGACAGAGCTTGATGAAGGAAGG - Intergenic
1074692479 10:116018811-116018833 GTAGAGACCTGAAGGAAGCAAGG - Intergenic
1075321283 10:121493490-121493512 CATGGGAGCTTCAGGAAGGAGGG - Intronic
1077118417 11:895879-895901 GTGGGGAGCTGCAGGAAGGTCGG - Intronic
1077173844 11:1180007-1180029 GAACAGAGCTGCAGGGAGGAAGG - Intronic
1079728521 11:23908645-23908667 GTAGATTGCTTCGGGAAGTATGG + Intergenic
1080213075 11:29809378-29809400 GTAGAGAGCTTCCTGATTGAAGG - Intergenic
1080943314 11:36943691-36943713 GCAGATAACTTCAGGAAGGTTGG + Intergenic
1080950718 11:37029538-37029560 TTAGAGAGCTTCTGGTAGAAAGG - Intergenic
1081433227 11:42999262-42999284 GCAGAGAGTTTCAGGAAGAATGG + Intergenic
1081660743 11:44886694-44886716 TTACAGATCTTTAGGAAGGAAGG - Intronic
1081858513 11:46318806-46318828 GGAGTGAGTTTCAAGAAGGAGGG + Intronic
1083015361 11:59447651-59447673 GTAGAGAACAGCAGGAAGCAGGG + Intergenic
1083884914 11:65568318-65568340 GAAGAGGGATGCAGGAAGGATGG + Intergenic
1084661007 11:70546374-70546396 CTAGATAGCTTCAGGATGGCAGG - Intronic
1085381058 11:76119204-76119226 GAAGAGTGTTTCAGGAAGGCAGG - Intronic
1086427462 11:86700053-86700075 GTAGAGAGCTTGATCCAGGAAGG - Intergenic
1086956909 11:92942791-92942813 GAAGAGAGAATGAGGAAGGAAGG + Intergenic
1087895384 11:103580337-103580359 GTAGAGAGCTAAAGGAATGAGGG - Intergenic
1088053747 11:105551105-105551127 GAACAGAGGTTCAGGAAGTAGGG + Intergenic
1088593827 11:111425065-111425087 ATAGAGGGCTACATGAAGGAAGG + Intronic
1089105097 11:115996258-115996280 GTAAAGAGTTTCACAAAGGAGGG + Intergenic
1089111663 11:116062320-116062342 GGAGGCAGCTCCAGGAAGGAGGG + Intergenic
1089179223 11:116569461-116569483 CTGGAGAGCTTCAGGGAGCAGGG + Intergenic
1089927434 11:122273195-122273217 GTTGAGAGTTTCAGGAAAGGAGG + Intergenic
1090820952 11:130341178-130341200 GTAGAGAGCTATAGGAGGTAAGG - Intergenic
1091690294 12:2591647-2591669 AGAGAGAGCATGAGGAAGGACGG + Intronic
1091999031 12:5017986-5018008 GTAGAGCGCTTCTGGGAGGGTGG + Intergenic
1094046541 12:26173615-26173637 CTATAGGGTTTCAGGAAGGAAGG + Intronic
1095909692 12:47413765-47413787 GCAGAGAGATGAAGGAAGGAAGG + Intergenic
1095988668 12:48018150-48018172 GTAGAGAGCTCCAGCAGGCAGGG + Intergenic
1096072848 12:48785126-48785148 ATAGAGAGCTCCAGGAAAGGGGG - Intronic
1096484977 12:51973893-51973915 ATAGAAAGCCTAAGGAAGGAGGG + Intronic
1096534009 12:52259293-52259315 GGAGAGGGGTACAGGAAGGAGGG - Intronic
1096638943 12:52978959-52978981 GGAGAGTGTTTCAAGAAGGAGGG - Intergenic
1097181220 12:57173132-57173154 GTGGAGGGCCTCAGGAGGGAGGG - Intronic
1098627305 12:72688219-72688241 TTAGAGATCTTAAGGAAGGAAGG + Intergenic
1099252971 12:80280769-80280791 GTAGATAGCTTTGGGAAGTATGG + Intronic
1099336545 12:81366490-81366512 GAAGAAGACTTCAGGAAGGAGGG - Intronic
1099464233 12:82962954-82962976 ATACAGAGTTTCAGGAAGGAAGG + Intronic
1099533844 12:83821597-83821619 GCAGAGAGCTTAGGTAAGGAAGG + Intergenic
1100356531 12:93836280-93836302 TGATAGAGCTTCAGGAAGGTAGG + Intronic
1101523726 12:105508172-105508194 GTGGTGAGCTTCAGGAAAAACGG - Intergenic
1101859594 12:108472165-108472187 GCAGAGAGATTAAGGGAGGAGGG + Intergenic
1103057563 12:117833746-117833768 GTAGATTTCTTCATGAAGGAAGG - Intronic
1104364711 12:128166425-128166447 GCTGAGGGCTGCAGGAAGGAAGG - Intergenic
1104386431 12:128355261-128355283 GGAGGGATCTTCAGGAGGGAAGG + Intronic
1104519400 12:129459091-129459113 ACAGAGACCTTCAGGGAGGAGGG - Intronic
1106947805 13:34848177-34848199 GAAGAGCTCTTCAGGAAGGTGGG - Intergenic
1108854959 13:54781442-54781464 GGAGAGAGGTTCAGAAAAGAAGG - Intergenic
1110620172 13:77586010-77586032 ATGGAGAGTTTCAGGGAGGAGGG - Intronic
1110937123 13:81305108-81305130 CTAGATAGCTTCAGGATGGGGGG + Intergenic
1111790621 13:92850649-92850671 GTAGAGAGGTTAAAGAAGAAAGG + Intronic
1111947801 13:94683589-94683611 GGGAAGAGTTTCAGGAAGGAGGG + Intergenic
1113481620 13:110625916-110625938 GTAGAGAGCGGCAGCAGGGAGGG + Intronic
1114290647 14:21285676-21285698 GTTGTGAGCTAGAGGAAGGAAGG + Intergenic
1114482425 14:23044097-23044119 AGAGGGAGCATCAGGAAGGAGGG - Exonic
1114673037 14:24422965-24422987 GCAGAGTGCTTCTAGAAGGAGGG + Intergenic
1114738747 14:25071368-25071390 GAAAAGAGTTTCAAGAAGGAAGG + Intergenic
1116171423 14:41407469-41407491 TTACAGATCCTCAGGAAGGAGGG + Intergenic
1116662104 14:47723573-47723595 GGAGAGAGCTTCTTGAAAGAAGG + Intergenic
1116937786 14:50759856-50759878 AAAGGGAGCTTCAGGAGGGAAGG - Exonic
1118128812 14:62939191-62939213 TGAGAGAGCTTTAAGAAGGAAGG - Intronic
1119335404 14:73829310-73829332 GGAGAGTGATACAGGAAGGACGG + Intergenic
1119569368 14:75656730-75656752 GTAGAGAGGCTCAGGAAGCCAGG + Intronic
1120364174 14:83544048-83544070 GTAGAAAAGTTCAGGAAAGAAGG - Intergenic
1121169519 14:91841746-91841768 GTACAGGGCTTCAGGATGGCTGG + Intronic
1121312868 14:92944581-92944603 GAAGAGAAGTTCTGGAAGGAGGG - Intronic
1121380674 14:93463172-93463194 GGAGAGAGTTTCAAGAAGGAGGG + Intronic
1121715627 14:96071783-96071805 GTAGACAGCTGCAGGGAGGTGGG + Intronic
1122109551 14:99487707-99487729 GAAGAGAGCTTCTGGAATGTTGG + Intronic
1125161810 15:36653087-36653109 GTTGAAAGCTTCATGAAGGTTGG - Intronic
1125177021 15:36835420-36835442 GTATAGAGCTTCAGGAATCAAGG + Intergenic
1125208733 15:37185876-37185898 GTAGATTGCTTTAGGAAGTATGG - Intergenic
1125404264 15:39336444-39336466 GAAGAGGGCTTCATGGAGGAGGG - Intergenic
1128365319 15:66995897-66995919 GGAGGGAGCTTGAGAAAGGATGG - Intergenic
1128542229 15:68544084-68544106 CTACAGAGCTTGGGGAAGGAAGG - Intergenic
1128577095 15:68783731-68783753 GTCGAGGCCTACAGGAAGGAAGG - Intronic
1129193503 15:73951315-73951337 GTAAAGAGCTCTTGGAAGGAAGG - Intronic
1129941327 15:79499551-79499573 ATAGAGAGCTCCAGGAGGCATGG - Intergenic
1129958156 15:79658172-79658194 GTGGAGAGCTAAAGGAAGGATGG + Intergenic
1130681492 15:86000860-86000882 CTAGATAGCTTCAGGATGGCTGG - Intergenic
1131521272 15:93117972-93117994 ATGGTGAGCATCAGGAAGGAAGG - Intergenic
1131691813 15:94835467-94835489 TGAGAGAGCTTTAAGAAGGAGGG - Intergenic
1132382829 15:101378685-101378707 GTAGAGAACATCAGGGAAGAGGG - Intronic
1133049246 16:3107376-3107398 GTAGCCAGCCTTAGGAAGGAAGG - Intergenic
1133324541 16:4935282-4935304 ATGGAGAGCTGCACGAAGGAGGG + Intronic
1133669070 16:7999901-7999923 GTCCAGATCTTTAGGAAGGATGG + Intergenic
1134325363 16:13202366-13202388 GCTGAGATCTACAGGAAGGAGGG - Intronic
1135424124 16:22323943-22323965 GCTGAGAGCTTCTGGAAGGATGG + Intronic
1135786914 16:25358391-25358413 GTAGAGAGGTACAGCTAGGAAGG + Intergenic
1135843992 16:25901744-25901766 GTAGGTAGCTTGAGGAAAGAGGG - Intronic
1136088967 16:27904666-27904688 GAAAGGAGCCTCAGGAAGGAAGG - Intronic
1138105326 16:54284721-54284743 GGAGAGAGCTGCAGGGCGGAAGG + Exonic
1140121016 16:72082956-72082978 GAGGAGATCTTCGGGAAGGAAGG - Intronic
1140702830 16:77598316-77598338 GAAGAGAGGTTCAGGGAGGAAGG + Intergenic
1141115449 16:81304814-81304836 GGAGAGAAGTTCAGGCAGGAGGG + Intergenic
1141773068 16:86102531-86102553 GCAGAGAGATAAAGGAAGGAAGG - Intergenic
1141893821 16:86945643-86945665 GGAGAGACCTTGAGGAAGCACGG + Intergenic
1143621734 17:8084722-8084744 GTAGTCAGCTGCAGGGAGGATGG + Intronic
1145304402 17:21665368-21665390 ATAGAGAGATTCTGGGAGGAGGG + Intergenic
1146636808 17:34512494-34512516 CTAAAGGGCTTCAGGCAGGAGGG + Intergenic
1147434685 17:40402514-40402536 ATAAAGAGTTTCAAGAAGGATGG + Intronic
1147492781 17:40886077-40886099 GTAAGTAGCTTCAGGATGGATGG - Intergenic
1151055093 17:71021653-71021675 ACAAAGAGTTTCAGGAAGGAGGG - Intergenic
1151869244 17:76825434-76825456 GTAGAGAGCCCCTGGAGGGAAGG - Intergenic
1151925950 17:77196950-77196972 AGAGAGAGCTGCCGGAAGGATGG - Intronic
1151966106 17:77432620-77432642 GAAGAGAGCGGGAGGAAGGATGG + Intronic
1152288774 17:79427079-79427101 GTAGAGAGCTTCGGGATTGGCGG - Intronic
1152378215 17:79929469-79929491 GTAGAGAGCTGCAGGGAGCCCGG + Intergenic
1152655260 17:81516492-81516514 GGAAAGAGCTTCAGGAAACAGGG - Intronic
1153414184 18:4826851-4826873 GTAAAGAGCTTGAGCAAGGGTGG - Intergenic
1154023686 18:10687032-10687054 TTTGAGAGCCTCAGGAAGGTAGG - Intronic
1154249624 18:12733252-12733274 GTAGACTGCTTCAGGTAGTATGG - Intergenic
1156445087 18:37230700-37230722 TTAGAGAGCTGCAAGAAGGCTGG - Intronic
1157062520 18:44308272-44308294 GTAGATTGCTTCAGGCAGTATGG + Intergenic
1157155938 18:45266125-45266147 CTTGAGACCTACAGGAAGGATGG + Intronic
1158208782 18:55023520-55023542 GTAGAGAGATTCAGACAGGGAGG - Intergenic
1158410222 18:57198862-57198884 GGGGAGAGGTTCAGAAAGGAGGG - Intergenic
1158671666 18:59479853-59479875 GTAGAGAGGTCAAGGGAGGAGGG + Intronic
1158985619 18:62813417-62813439 GAAGAGAGATGGAGGAAGGAAGG + Intronic
1159385427 18:67718817-67718839 GCAAAGAGATTCAGGGAGGAAGG - Intergenic
1159632518 18:70765298-70765320 ATAGAGACCTCCAGGGAGGAAGG + Intergenic
1159680345 18:71342675-71342697 GTAGAGAGAAACAAGAAGGAGGG - Intergenic
1159881780 18:73865025-73865047 GGCGAGAGCTTCAGGAGGGCAGG - Intergenic
1159979659 18:74762576-74762598 GCAGAGAGTGGCAGGAAGGATGG - Intronic
1160016678 18:75147497-75147519 GTAGATTGCTTTAGGAAGTATGG + Intergenic
1160823602 19:1069214-1069236 GGAGAGAGATTCAGGAGGCATGG + Intronic
1161139571 19:2639656-2639678 GGGGAGGGATTCAGGAAGGAAGG + Intronic
1161459515 19:4388553-4388575 GGAGAGAGCTGCAGGATGGGTGG + Intronic
1164755889 19:30689216-30689238 GCAGACAGGTTCAAGAAGGAAGG - Intronic
1167363242 19:49041398-49041420 TTAGAGTTCTACAGGAAGGATGG + Intergenic
1167957190 19:53075431-53075453 CTAGGTAGCTTCAGGATGGAGGG + Intronic
925047619 2:785993-786015 TGGGAGAGCTACAGGAAGGAAGG + Intergenic
925613794 2:5726010-5726032 GCAGAGCTCTGCAGGAAGGAGGG - Intergenic
925982648 2:9189717-9189739 GCAGAGAGCCTCTAGAAGGATGG + Intergenic
926175009 2:10583041-10583063 GTAGAGAGGCCCAGGAATGAAGG - Intronic
926335026 2:11856693-11856715 AGGGAGAGCTTGAGGAAGGAGGG + Intergenic
927019557 2:19002530-19002552 GGAGAGAGCATTAGGAAGAAGGG - Intergenic
928836121 2:35547407-35547429 GTTGTGAGCTTCTTGAAGGATGG + Intergenic
928915015 2:36461227-36461249 GGAGAGGGCTTCAGAAATGAGGG + Intronic
929801548 2:45108755-45108777 GAAGAGTGTTTCAAGAAGGAAGG + Intergenic
930161380 2:48160593-48160615 GTAGATTGCTTCAGGTAGTATGG - Intergenic
930509927 2:52331594-52331616 AGAGAAAGCTTCAGGTAGGAGGG - Intergenic
931747389 2:65301930-65301952 GCAGACAGCCCCAGGAAGGAAGG + Intergenic
932409299 2:71535677-71535699 GAGCAGAGCTTCAGGGAGGATGG + Intronic
933694650 2:85208680-85208702 GAAGAGGGCCTCTGGAAGGATGG + Intronic
933815530 2:86065293-86065315 GGAAAGGGCTTCAGGATGGAAGG + Exonic
934578490 2:95418600-95418622 GTAGAGAGCTTCAGGAAGGAGGG + Intergenic
934600954 2:95658113-95658135 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
935618945 2:105112250-105112272 GTAGGAAGCACCAGGAAGGAGGG + Intergenic
936534326 2:113300262-113300284 GTAGAGAGCTTCAGGAAGGAGGG - Intergenic
936974786 2:118208003-118208025 CTAGTGAGCCTCGGGAAGGATGG - Intergenic
937249687 2:120515539-120515561 GGAGAGAGAGTCAGGGAGGAGGG - Intergenic
937996504 2:127698480-127698502 GTAGAGACCTGAAGGAATGAGGG + Intergenic
938992532 2:136644030-136644052 GGAGATAGCTCCAGGAAGGAAGG + Intergenic
940475369 2:154154691-154154713 TAAGATAGCTTCAGGAGGGATGG + Intronic
940720082 2:157272522-157272544 CTAGAGAGGGTAAGGAAGGAGGG - Intronic
940885300 2:158984709-158984731 GGGGAAAGCTTCAGGGAGGAGGG + Intronic
941273692 2:163463261-163463283 TTAGAAAGCTTCAGGCTGGATGG + Intergenic
941763024 2:169265319-169265341 CTGGTGAGCTTCAGGCAGGAAGG - Intronic
942607695 2:177709760-177709782 AGAGAGAGTTTCAGGAAGGAGGG + Intronic
942755032 2:179330365-179330387 GTAGATTGCTTCAGGCAGTATGG - Intergenic
943863697 2:192899760-192899782 CTAGATAGCTTCAGGATGGTGGG - Intergenic
943937694 2:193943305-193943327 GTAGAAAGATTAAGGAAAGAAGG + Intergenic
944554287 2:200872559-200872581 CTAGATAGCTTCAGTATGGAGGG - Intronic
944651018 2:201830337-201830359 AGAGAGTGCCTCAGGAAGGAAGG + Intronic
945509755 2:210686623-210686645 GTAGAGAGAAGCGGGAAGGAGGG + Intergenic
945632784 2:212303250-212303272 TTAGGGAGCTTCAGACAGGAGGG + Intronic
947388255 2:229614427-229614449 GTAGAGGACTTCAGAAAGGCTGG - Intronic
947677487 2:231996045-231996067 CTAGAGAGGTTCAAGAAGGAAGG + Intronic
1168812649 20:715808-715830 GTAGTGTGTTTGAGGAAGGAAGG + Intergenic
1169783539 20:9334199-9334221 GGAGAGTGTTTCAAGAAGGAAGG + Intronic
1169881447 20:10351410-10351432 CTAGAGAGCTTCAGGATGGGGGG - Intergenic
1169954962 20:11091554-11091576 GGAGAGAGTTTCAAAAAGGAAGG + Intergenic
1170045353 20:12079700-12079722 GTAGAGAGGTTCAAGAGGGATGG + Intergenic
1170361799 20:15554292-15554314 GTATAGTGCTTAAAGAAGGAAGG + Intronic
1170442337 20:16391567-16391589 GGACAGAGCTGCATGAAGGAAGG + Intronic
1170446336 20:16431747-16431769 GCAGAGACCTGAAGGAAGGAAGG - Intronic
1170764622 20:19279501-19279523 AAAGAGAATTTCAGGAAGGAAGG - Intronic
1171521921 20:25782800-25782822 ATAGAGAGATTCTGGGAGGAGGG + Intronic
1171554904 20:26073083-26073105 ATAGAGAGATTCTGGGAGGAGGG - Intergenic
1172149608 20:32780584-32780606 GAAGAGAGCTCTAGCAAGGAGGG + Intronic
1172546517 20:35765994-35766016 GTGGAGAGCCAGAGGAAGGAAGG - Intergenic
1172936390 20:38623450-38623472 GTGGAGAGCTCCAGCATGGATGG + Exonic
1173504211 20:43574338-43574360 GACGAGAGGGTCAGGAAGGAGGG - Intronic
1173653699 20:44684345-44684367 GTAGAGAAATGAAGGAAGGAAGG + Intergenic
1173820730 20:46018619-46018641 GCCGAGAGTTTCAGGAAGAAGGG - Intergenic
1173840820 20:46155805-46155827 ATGGAGAGCTTCAGGAAGGCAGG + Intergenic
1174008901 20:47433055-47433077 GGAGAGAGAGTGAGGAAGGAAGG + Intergenic
1175079260 20:56404959-56404981 CTAAAAAGCTTCAGGAAGGCTGG - Exonic
1175480032 20:59304131-59304153 CTACAGAGTTTCAGGAAGGAAGG - Intronic
1175495690 20:59412633-59412655 GAAAGGGGCTTCAGGAAGGAGGG - Intergenic
1175647869 20:60691113-60691135 AATCAGAGCTTCAGGAAGGAAGG + Intergenic
1176057035 20:63154452-63154474 GAAGAGAGAAGCAGGAAGGAGGG + Intergenic
1176655729 21:9587796-9587818 ATAGAGAGATTCTGGGAGGAGGG + Intergenic
1177008820 21:15706907-15706929 GGAGAGTGCTTCAGCAATGAGGG - Intergenic
1178072443 21:28983655-28983677 ATGGAGAGCCACAGGAAGGATGG + Intronic
1178750141 21:35294962-35294984 GAAAACAGCTTCAGAAAGGAGGG + Intronic
1179440899 21:41393474-41393496 GGAGGGAGGTTCAGGAAGGAGGG - Intronic
1179440904 21:41393491-41393513 GGAGGGAGTTTCAGGAAGGAGGG - Intronic
1179627198 21:42655390-42655412 GAGGAGAGCTTCAGGAGGGGTGG + Intronic
1179936185 21:44605369-44605391 GTAGATAGCTTTAGGTAGTATGG - Intronic
1180703735 22:17796166-17796188 GCAGAGTGCTCCAGGGAGGAGGG - Intronic
1181473016 22:23152372-23152394 GCAGAGAGCTCAGGGAAGGAAGG + Intronic
1181695296 22:24589908-24589930 GTAGAGGATATCAGGAAGGAGGG + Exonic
1181726255 22:24813076-24813098 GCAGAGACCTGAAGGAAGGAAGG + Intronic
1182266446 22:29119501-29119523 CTGGATAGCTTCAGGATGGAGGG - Intronic
1182579844 22:31300270-31300292 GGAGAGTGTTTCAGGGAGGAGGG + Intergenic
1183035956 22:35141279-35141301 GTAGAGTGTTTGAGGAAGGCAGG - Intergenic
1183372571 22:37442365-37442387 GGAGAGCGCTTCAAGGAGGAGGG - Intergenic
1183513301 22:38248506-38248528 GTAGAGACCTAAAGGAAGGGTGG - Intronic
1183829555 22:40410527-40410549 GTGGAGAGCTCCTGGCAGGAAGG + Exonic
1184110359 22:42390508-42390530 GTAGAGAGCTGAAAGAATGAGGG + Intronic
1184739579 22:46419608-46419630 GGAGAAAACTTCAGGAAGGATGG + Intronic
1184822338 22:46918585-46918607 GGGGACAACTTCAGGAAGGAGGG + Intronic
1185152437 22:49172020-49172042 GAAGAGAGCTTGTGCAAGGAGGG + Intergenic
951169750 3:19527354-19527376 GTAGAGAACTTCTGCAAGGCAGG - Intronic
951519912 3:23601871-23601893 GAAAAGAAGTTCAGGAAGGAGGG - Intergenic
951677746 3:25261302-25261324 ATAGAGAGTTTCAAGAAGAAGGG - Intronic
953334256 3:42080441-42080463 CTAGAGAGCTGCAGGAAGGCAGG - Intronic
953371586 3:42393104-42393126 CTAGAGCACTTCAGGGAGGAAGG + Intergenic
954551268 3:51483475-51483497 TTAAACAGCTTCAGGAAGTAGGG + Intronic
955000911 3:54927201-54927223 GTAGAGAATTTAAGGAAGAAAGG - Intronic
955094613 3:55784998-55785020 ATAGAAAGCCTCACGAAGGAAGG + Intronic
956981974 3:74649591-74649613 CTACAGAGCTTCAGGCAGCATGG + Intergenic
957729758 3:84118639-84118661 GTAAAGTCCTTGAGGAAGGAGGG + Intergenic
959153328 3:102634165-102634187 CTAGAGGGCTTAGGGAAGGAGGG - Intergenic
959458988 3:106601018-106601040 GGGGAGTGCTTTAGGAAGGATGG + Intergenic
960909422 3:122634126-122634148 GAAGAGAGGTTCAAGAAGAATGG - Intronic
960926893 3:122803310-122803332 GAGAAGAGCTTCAGGAAGGTAGG + Intronic
961420482 3:126798979-126799001 ATAGACAGCTTCTTGAAGGAGGG - Intronic
961861896 3:129923338-129923360 GGAGAAATCTTCATGAAGGAAGG - Intergenic
963486632 3:145942374-145942396 GTAGAGAGATTCAGGAATACTGG + Intergenic
963524463 3:146399697-146399719 GGAGAGAGCAGAAGGAAGGAAGG - Intronic
964305651 3:155336580-155336602 CTAGATAGCCTCAGGATGGAGGG - Intergenic
964428139 3:156574725-156574747 GCAGAATGCTTCAAGAAGGAAGG - Intergenic
965776743 3:172239685-172239707 GGAAAGAGCTTCAGGAAGTGAGG + Intronic
967634197 3:191781436-191781458 GTAAAGAGATGCAGGAATGAAGG + Intergenic
967852583 3:194093408-194093430 GCAGAAAGCCTGAGGAAGGATGG - Intergenic
968088746 3:195886573-195886595 TTAGAGAGGGTCAGGGAGGAGGG + Intronic
968744110 4:2350600-2350622 CTAGACAGCTTCAGGATGGGGGG + Intronic
969234766 4:5858112-5858134 GAAGCGAGTTTAAGGAAGGAGGG - Intronic
969475418 4:7419976-7419998 GTGCAGAGCTACAGGATGGAAGG - Intronic
969880175 4:10166915-10166937 GTATAGAACATCAGGAAGAAGGG - Intergenic
970069954 4:12146653-12146675 GTTCAGAGCTTGAGGAAGAAAGG + Intergenic
970127408 4:12830636-12830658 GGAGACAATTTCAGGAAGGATGG - Intergenic
971766405 4:30837584-30837606 GTAGAGTGTTTGAGGGAGGATGG + Intronic
973225628 4:47780612-47780634 CTAGAGAGCATCTGGAAAGATGG + Intronic
974820394 4:67060360-67060382 GTAGAGAGTTTAAATAAGGAGGG + Intergenic
975717688 4:77220867-77220889 CTAGAGAACTACAGGAAGGATGG + Intronic
976482751 4:85563690-85563712 GTAGTGAGGATTAGGAAGGATGG + Intronic
977011111 4:91634390-91634412 ATATGGAGCTGCAGGAAGGAAGG + Intergenic
977566832 4:98589105-98589127 GTAGAGAGCATCAAAGAGGAAGG - Intronic
979047720 4:115890628-115890650 GTACAGAGCTTGAAGAAAGATGG + Intergenic
979280502 4:118861916-118861938 GTAGATTGCTTCAGGTAGTATGG + Intronic
980092899 4:128460741-128460763 GTAGAGAGTTTCAAGAATAAAGG - Intergenic
980608597 4:135126316-135126338 GAAGAAAGTTTCAAGAAGGAAGG - Intergenic
980829083 4:138107995-138108017 GTGGAAAGCTCCAGGAAGGAGGG - Intergenic
980972081 4:139576339-139576361 CTGGAGAGCTCCAGCAAGGATGG + Intronic
981006775 4:139883179-139883201 GCAGAGAACTTCAGGAGAGAAGG + Intronic
982606794 4:157525986-157526008 GTGGAGCCCTTCAAGAAGGAAGG + Intergenic
982635743 4:157894764-157894786 ATAGTGACCTTCAGGAAGCAAGG - Intergenic
982661788 4:158216179-158216201 ATAAAGAGCTGCAGGATGGATGG - Intronic
983537156 4:168869982-168870004 GAAGAGTGCTTCAAGAAAGATGG + Intronic
986020386 5:3796115-3796137 ATAGAGAGGTTGAGGAAGGCGGG - Intergenic
986757025 5:10846995-10847017 GTAGATTGCTTCAGGCAGTATGG - Intergenic
986843597 5:11726976-11726998 TAAGAGAGCATCAGGAAGCAGGG + Intronic
989131650 5:38112957-38112979 GTAGAAAGGTTCAGCAAGGTTGG - Intergenic
989770505 5:45139356-45139378 GTAAAGACCTTCAAGATGGAAGG + Intergenic
990253673 5:53942899-53942921 TGAAAGTGCTTCAGGAAGGAGGG + Intronic
990868319 5:60403750-60403772 AGAGACAGCATCAGGAAGGAGGG - Intronic
991497098 5:67237274-67237296 GCAAAGACCTTCAGGATGGAAGG + Intergenic
991509456 5:67360687-67360709 GGGGAGAGCTTCAAGAAGGAAGG + Intergenic
992190220 5:74284682-74284704 GAACAGAGCATCAGGAAGCAGGG - Intergenic
992242270 5:74784569-74784591 CTAGAGAACTTCAGGAAGAGAGG + Intronic
992789876 5:80203817-80203839 CTAGATAGCTTCAGGATGGAAGG + Intronic
994062398 5:95494024-95494046 GTAGTTAGCTTCTTGAAGGATGG - Intronic
994734237 5:103532942-103532964 TTAGTGAGATTCAGGAAGCACGG - Intergenic
995310573 5:110705821-110705843 GTAAAGACATTCAGGAAGAATGG + Intronic
995826480 5:116305303-116305325 GGAGAGTGCTCAAGGAAGGATGG - Intronic
996614148 5:125419524-125419546 GTAGAGAATTTCAGGTAGAATGG - Intergenic
997215928 5:132110679-132110701 GCAGAGAGCCTCAGGAAGTTGGG - Intergenic
997217805 5:132129027-132129049 GTACAGAGCATCTGGAGGGAAGG - Intergenic
997273449 5:132561968-132561990 AGAGAGAGCTTCAAGAATGAGGG - Intronic
997739367 5:136240141-136240163 TTGGAGAGCTTCACGTAGGAAGG - Intronic
998072152 5:139206236-139206258 GCAGAGAGCTGCAGAAGGGATGG + Intronic
998916487 5:147017641-147017663 GTAGAAAATTTCAGGAAAGAGGG + Intronic
999644676 5:153705944-153705966 GTGAAGAGTTTGAGGAAGGACGG + Exonic
999957832 5:156721408-156721430 GTTGATAGTTTCAAGAAGGAAGG + Intronic
1000054577 5:157593617-157593639 GTAGGAGGCTTCATGAAGGAGGG + Intergenic
1000208316 5:159084077-159084099 GTAGTGAGCTTTTGGAAGGAAGG - Intronic
1000335021 5:160235687-160235709 CTGGAGAGCTTCAGGGAGGAGGG - Intronic
1001308165 5:170590852-170590874 ATGGGGAGCTTCAGGATGGAAGG - Intronic
1001323555 5:170702490-170702512 GCAGAGAGCTTGAGGGAGGAAGG + Intronic
1002660952 5:180790954-180790976 GGAGAGAGGTGCAGGGAGGAAGG - Exonic
1004008998 6:11663430-11663452 GTAGATTGCTTCAGGCAGTATGG + Intergenic
1004444191 6:15683070-15683092 GTAGAAAGGGACAGGAAGGAGGG - Intergenic
1007900211 6:45404360-45404382 GGAGAGAGTTTCAAGAAGGTGGG - Intronic
1008481821 6:51994028-51994050 GGAGAGTCCTGCAGGAAGGAAGG - Intronic
1009800633 6:68532929-68532951 ATAGATAGCTTCAGGAATGATGG - Intergenic
1011329347 6:86186584-86186606 GAAGGGATCTTCAAGAAGGAGGG - Intergenic
1011739550 6:90346167-90346189 CTAGGGAACTTGAGGAAGGAAGG - Intergenic
1013327790 6:109064701-109064723 GGAGAGAGATGAAGGAAGGAAGG + Intronic
1013787135 6:113794529-113794551 GAAGAAAGTTTCAGGAAAGAAGG + Intergenic
1015707965 6:136108915-136108937 GAAGAGAGATTCAGGAAGGAAGG - Intronic
1017209414 6:151838329-151838351 GTAGAGAGCAGCAGGAAGAGAGG + Intronic
1017665852 6:156719764-156719786 GTAAAGATCATCAGAAAGGAGGG + Intergenic
1017956584 6:159183328-159183350 GGAGAGATTTTCAGGAAGAAGGG - Intronic
1018130032 6:160721081-160721103 GTAGAGAATTTCAGCAAAGATGG - Intronic
1018427811 6:163699273-163699295 GAAGAGAATTTCAGAAAGGATGG + Intergenic
1019847809 7:3524096-3524118 GCAAAGACCTGCAGGAAGGAAGG + Intronic
1022451583 7:30520815-30520837 GTGGAGAGAGGCAGGAAGGAAGG + Intronic
1022797295 7:33742365-33742387 GTAGAGTGGTGCAGGAAGGCAGG + Intergenic
1022942087 7:35250678-35250700 AGAGAGGGCTCCAGGAAGGAAGG - Intronic
1022999408 7:35792532-35792554 GTTGGGAGCCTCATGAAGGAGGG + Intergenic
1023006120 7:35869211-35869233 GTAGAGAGGTTCAGAATAGAAGG + Intronic
1023739530 7:43266202-43266224 CTAGACAGCTTCAGGATGGGGGG - Intronic
1024051172 7:45624323-45624345 GGAGAGAGGTTAAGGTAGGAGGG + Intronic
1024185442 7:46944004-46944026 GTACAGAGCTCCAGGTAGGCTGG - Intergenic
1028342123 7:89734636-89734658 GTAGAGAGTTGGAGGAAGGTAGG + Intergenic
1028898162 7:96065213-96065235 AGAGAGAGCTGCAGGAATGAGGG - Intronic
1029248316 7:99218470-99218492 GGGGAGTACTTCAGGAAGGAGGG + Intergenic
1029505690 7:100962611-100962633 GAAGAGAGCGAGAGGAAGGAAGG - Intronic
1029546252 7:101212053-101212075 GCAGAGAGCCTGGGGAAGGAAGG - Intronic
1029974050 7:104815966-104815988 GTGGTCAGCTACAGGAAGGAGGG - Intronic
1029983696 7:104902458-104902480 GAAGAGAGCTTTAGGAATGAAGG + Intronic
1031591712 7:123600905-123600927 GTAGAGAGTTTCAGGAAAAAGGG + Intronic
1031886752 7:127252351-127252373 GTAAAGAGGTTCAGAAAAGAGGG - Intronic
1033003199 7:137530242-137530264 GTAAAGAGCTTCAGGCAGCAGGG - Intronic
1033588000 7:142788428-142788450 GTAAGCAGCTTCTGGAAGGAAGG + Intergenic
1033609985 7:142955938-142955960 AAAAGGAGCTTCAGGAAGGAGGG - Intronic
1034060461 7:148082580-148082602 AGAGAGAGCTTCAGGGAGGTGGG + Intronic
1034930125 7:155154863-155154885 CAAGCGAACTTCAGGAAGGAAGG - Intergenic
1035319937 7:158022300-158022322 GTGGAGGCCGTCAGGAAGGATGG - Intronic
1035827386 8:2659572-2659594 CCAGAGAGCTGCAGGATGGATGG - Intergenic
1036049956 8:5185437-5185459 GTAGAGAGATAGAGGAAGTAGGG - Intergenic
1036763963 8:11534558-11534580 GAGCAGACCTTCAGGAAGGAAGG - Intronic
1037943741 8:22973815-22973837 GAAGAGGCCTCCAGGAAGGAGGG - Intronic
1038414344 8:27383132-27383154 GTAGAGCGCTTTAGGTAGTATGG + Intronic
1038606853 8:29015333-29015355 AGAAAGAGCTTCAGGATGGAGGG - Intronic
1039026131 8:33260377-33260399 GGAGAGAGCTTCAGAATGAATGG - Intergenic
1041196923 8:55410133-55410155 GGAGAGGGCTTCAGGAAAGAGGG - Intronic
1041253765 8:55961028-55961050 GAAGAGACCCTGAGGAAGGAAGG + Intronic
1041819054 8:62008861-62008883 GTACAGGACTTAAGGAAGGAAGG + Intergenic
1042672841 8:71283274-71283296 GCAGAGGCCTTCAGGAAGGGAGG - Intronic
1043984910 8:86682633-86682655 GTGGAGAGCTCCTGGAAGGGAGG + Intronic
1044288074 8:90433306-90433328 ATAGAGAGCTTTAGGAAAAAAGG + Intergenic
1045182551 8:99801173-99801195 GGAGAGAGATATAGGAAGGAAGG - Intronic
1045412708 8:101934569-101934591 GTCGGGAGCTTCAGGAAGGAGGG + Intronic
1045563870 8:103294073-103294095 GGAGAGAACTTCATGAGGGAAGG + Intergenic
1045760728 8:105603823-105603845 TGACAGTGCTTCAGGAAGGAGGG - Intronic
1046018672 8:108636950-108636972 GTAGAGAGCTACTGGAAGCTGGG - Intronic
1046883132 8:119332166-119332188 CTAGATAGCTTCAGGATGGGGGG - Intergenic
1048244967 8:132784907-132784929 TTAGAGAGCTTGAGCAAGGTAGG + Intronic
1051453431 9:17224010-17224032 GGAGAGATCTAAAGGAAGGAAGG - Intronic
1052186149 9:25596849-25596871 GTAGAGTGCTTAAGAAAGTATGG + Intergenic
1052273992 9:26657660-26657682 GGAGAGCAGTTCAGGAAGGAAGG + Intergenic
1052672973 9:31581692-31581714 GTAAAGAGCTTCTTGAAAGAAGG - Intergenic
1053192965 9:36089289-36089311 CAAAAGAGCTTCAGTAAGGAAGG + Intronic
1055192422 9:73541550-73541572 GGACAAAGCTTCAGGCAGGAAGG - Intergenic
1056984379 9:91347537-91347559 CTAGATAGCTTCAGGATGGGGGG - Intronic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1058063184 9:100521270-100521292 GCAGTGAGTTTCAGGAAGGAAGG - Intronic
1061062784 9:128258959-128258981 GGAGAGAGCCCCAGGAAGAAGGG - Intronic
1061391624 9:130320224-130320246 TTACAGAGGTTCAGGAGGGAAGG - Intronic
1061679705 9:132236910-132236932 GAAGAGTGTTTCAGAAAGGAAGG + Intronic
1203633446 Un_KI270750v1:91257-91279 ATAGAGAGATTCTGGGAGGAGGG + Intergenic
1186303675 X:8229951-8229973 GTAGAAAGCACCAGGAATGATGG - Intergenic
1187713818 X:22081429-22081451 GAAGAGAGTTTCAGGTAAGAGGG - Intronic
1188748511 X:33876585-33876607 GAAGAGAGCTTCAGGAAATTTGG - Intergenic
1189665114 X:43346207-43346229 GTAGATTGCTTTAGGAAGTATGG + Intergenic
1189701840 X:43720425-43720447 GTAGGGAGAGACAGGAAGGATGG + Intronic
1189935570 X:46064955-46064977 CTAAATATCTTCAGGAAGGAGGG - Intergenic
1191891942 X:65952926-65952948 GTAGATTGCTTCTGGAAGTATGG + Intergenic
1192045451 X:67667636-67667658 GTAGATAGCTTCAGGTAGTGTGG + Intronic
1192096198 X:68213591-68213613 GTAGAGAAATTCCGGAAGGGGGG + Intronic
1192598417 X:72436615-72436637 AAAAAGAGCATCAGGAAGGAAGG + Intronic
1194264574 X:91738806-91738828 CAAGAAAGCATCAGGAAGGAAGG + Intergenic
1194572331 X:95568109-95568131 GTAGATTGCTTCAGGGAGCATGG - Intergenic
1195005343 X:100680215-100680237 GGAGAGAGCTTCAAGAAGAAGGG - Intronic
1195076626 X:101333288-101333310 GTAGATTGCTTTTGGAAGGATGG - Intergenic
1196576892 X:117328888-117328910 GTAGATTGCTTCAGGCAGTATGG - Intergenic
1197957783 X:131971533-131971555 GGAGAGAGCTTCAGAGAGGTTGG - Intergenic
1197976862 X:132175109-132175131 GAAGAGAGTTTCAAGTAGGAGGG + Intergenic
1198639793 X:138744061-138744083 CTAAAGAGTTCCAGGAAGGAGGG + Intronic
1198956822 X:142141701-142141723 GTAGATTGCTTCAGGTAGTATGG - Intergenic
1199257573 X:145734081-145734103 GTGAAGAGCAACAGGAAGGATGG + Intergenic
1200066022 X:153504444-153504466 GCAGAGGGCTCCAGGCAGGAAGG - Intronic
1200100487 X:153687500-153687522 GGAGAGAGCTCAAGGAAGGAGGG + Intronic