ID: 934590431

View in Genome Browser
Species Human (GRCh38)
Location 2:95544885-95544907
Sequence GTGTACACCCACTATGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934590428_934590431 5 Left 934590428 2:95544857-95544879 CCTAGTATATAACAAGTAATATC No data
Right 934590431 2:95544885-95544907 GTGTACACCCACTATGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934590431 Original CRISPR GTGTACACCCACTATGATAT TGG Intergenic
No off target data available for this crispr