ID: 934591720

View in Genome Browser
Species Human (GRCh38)
Location 2:95557933-95557955
Sequence CTCTGTATCCTACACAAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934591720_934591725 23 Left 934591720 2:95557933-95557955 CCCTCCTTGTGTAGGATACAGAG No data
Right 934591725 2:95557979-95558001 CATGACACTCAAGTTAAAGGTGG No data
934591720_934591724 20 Left 934591720 2:95557933-95557955 CCCTCCTTGTGTAGGATACAGAG No data
Right 934591724 2:95557976-95557998 CTTCATGACACTCAAGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934591720 Original CRISPR CTCTGTATCCTACACAAGGA GGG (reversed) Intergenic
No off target data available for this crispr