ID: 934593190

View in Genome Browser
Species Human (GRCh38)
Location 2:95577459-95577481
Sequence CTCCAGGTACAGACTGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934593188_934593190 -1 Left 934593188 2:95577437-95577459 CCATAAAGCAGATGTGGAGCTAC No data
Right 934593190 2:95577459-95577481 CTCCAGGTACAGACTGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934593190 Original CRISPR CTCCAGGTACAGACTGACCA TGG Intergenic
No off target data available for this crispr