ID: 934603215

View in Genome Browser
Species Human (GRCh38)
Location 2:95674388-95674410
Sequence CTACATGGTGGGAGGTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934603209_934603215 6 Left 934603209 2:95674359-95674381 CCAGGCAGAATGAGCAACAGGCT No data
Right 934603215 2:95674388-95674410 CTACATGGTGGGAGGTAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934603215 Original CRISPR CTACATGGTGGGAGGTAGCC TGG Intergenic
No off target data available for this crispr