ID: 934603806

View in Genome Browser
Species Human (GRCh38)
Location 2:95679318-95679340
Sequence TGGTGCCCTTTGGGAGGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934603799_934603806 5 Left 934603799 2:95679290-95679312 CCTCATGCATATAGCTTCCAAAG No data
Right 934603806 2:95679318-95679340 TGGTGCCCTTTGGGAGGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934603806 Original CRISPR TGGTGCCCTTTGGGAGGATC TGG Intergenic
No off target data available for this crispr