ID: 934607302

View in Genome Browser
Species Human (GRCh38)
Location 2:95706356-95706378
Sequence ATTAAATTCAGTGGGATTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934607299_934607302 8 Left 934607299 2:95706325-95706347 CCTACTGTTTCTCTGATGCACTG No data
Right 934607302 2:95706356-95706378 ATTAAATTCAGTGGGATTAATGG No data
934607298_934607302 22 Left 934607298 2:95706311-95706333 CCTGCTCTGAATCACCTACTGTT No data
Right 934607302 2:95706356-95706378 ATTAAATTCAGTGGGATTAATGG No data
934607297_934607302 28 Left 934607297 2:95706305-95706327 CCTGCTCCTGCTCTGAATCACCT No data
Right 934607302 2:95706356-95706378 ATTAAATTCAGTGGGATTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934607302 Original CRISPR ATTAAATTCAGTGGGATTAA TGG Intergenic
No off target data available for this crispr