ID: 934608430

View in Genome Browser
Species Human (GRCh38)
Location 2:95716070-95716092
Sequence ACTTATGAATGAGCATGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934608426_934608430 24 Left 934608426 2:95716023-95716045 CCAAATGCTCAACTCTGCCATTT No data
Right 934608430 2:95716070-95716092 ACTTATGAATGAGCATGACTGGG No data
934608427_934608430 7 Left 934608427 2:95716040-95716062 CCATTTAGTGCAAAAGTAGCCAT No data
Right 934608430 2:95716070-95716092 ACTTATGAATGAGCATGACTGGG No data
934608425_934608430 25 Left 934608425 2:95716022-95716044 CCCAAATGCTCAACTCTGCCATT No data
Right 934608430 2:95716070-95716092 ACTTATGAATGAGCATGACTGGG No data
934608424_934608430 26 Left 934608424 2:95716021-95716043 CCCCAAATGCTCAACTCTGCCAT No data
Right 934608430 2:95716070-95716092 ACTTATGAATGAGCATGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934608430 Original CRISPR ACTTATGAATGAGCATGACT GGG Intergenic
No off target data available for this crispr