ID: 934613774

View in Genome Browser
Species Human (GRCh38)
Location 2:95758898-95758920
Sequence CTCCCAGGGACTGCCGGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934613767_934613774 16 Left 934613767 2:95758859-95758881 CCACTGGCTCCGCTCCTGGGCTC No data
Right 934613774 2:95758898-95758920 CTCCCAGGGACTGCCGGCACAGG No data
934613770_934613774 2 Left 934613770 2:95758873-95758895 CCTGGGCTCTAGGCTTCTGCTGC No data
Right 934613774 2:95758898-95758920 CTCCCAGGGACTGCCGGCACAGG No data
934613769_934613774 7 Left 934613769 2:95758868-95758890 CCGCTCCTGGGCTCTAGGCTTCT No data
Right 934613774 2:95758898-95758920 CTCCCAGGGACTGCCGGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934613774 Original CRISPR CTCCCAGGGACTGCCGGCAC AGG Intergenic
No off target data available for this crispr