ID: 934615343

View in Genome Browser
Species Human (GRCh38)
Location 2:95767259-95767281
Sequence TCAGTGCCTCATCTGTAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934615343_934615349 16 Left 934615343 2:95767259-95767281 CCTTCTTACAGATGAGGCACTGA No data
Right 934615349 2:95767298-95767320 GCGCCTTGTTCAAGATCATAGGG No data
934615343_934615351 25 Left 934615343 2:95767259-95767281 CCTTCTTACAGATGAGGCACTGA No data
Right 934615351 2:95767307-95767329 TCAAGATCATAGGGCCTTTGAGG No data
934615343_934615348 15 Left 934615343 2:95767259-95767281 CCTTCTTACAGATGAGGCACTGA No data
Right 934615348 2:95767297-95767319 GGCGCCTTGTTCAAGATCATAGG No data
934615343_934615346 -6 Left 934615343 2:95767259-95767281 CCTTCTTACAGATGAGGCACTGA No data
Right 934615346 2:95767276-95767298 CACTGAGGCTCAGAGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934615343 Original CRISPR TCAGTGCCTCATCTGTAAGA AGG (reversed) Intergenic
No off target data available for this crispr