ID: 934615346

View in Genome Browser
Species Human (GRCh38)
Location 2:95767276-95767298
Sequence CACTGAGGCTCAGAGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934615337_934615346 30 Left 934615337 2:95767223-95767245 CCTAATCCAGAGTAAAAGGGGAC No data
Right 934615346 2:95767276-95767298 CACTGAGGCTCAGAGTGGCCAGG No data
934615343_934615346 -6 Left 934615343 2:95767259-95767281 CCTTCTTACAGATGAGGCACTGA No data
Right 934615346 2:95767276-95767298 CACTGAGGCTCAGAGTGGCCAGG No data
934615340_934615346 24 Left 934615340 2:95767229-95767251 CCAGAGTAAAAGGGGACATGGGA No data
Right 934615346 2:95767276-95767298 CACTGAGGCTCAGAGTGGCCAGG No data
934615342_934615346 -3 Left 934615342 2:95767256-95767278 CCTCCTTCTTACAGATGAGGCAC No data
Right 934615346 2:95767276-95767298 CACTGAGGCTCAGAGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934615346 Original CRISPR CACTGAGGCTCAGAGTGGCC AGG Intergenic
No off target data available for this crispr