ID: 934615348

View in Genome Browser
Species Human (GRCh38)
Location 2:95767297-95767319
Sequence GGCGCCTTGTTCAAGATCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934615343_934615348 15 Left 934615343 2:95767259-95767281 CCTTCTTACAGATGAGGCACTGA No data
Right 934615348 2:95767297-95767319 GGCGCCTTGTTCAAGATCATAGG No data
934615342_934615348 18 Left 934615342 2:95767256-95767278 CCTCCTTCTTACAGATGAGGCAC No data
Right 934615348 2:95767297-95767319 GGCGCCTTGTTCAAGATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934615348 Original CRISPR GGCGCCTTGTTCAAGATCAT AGG Intergenic
No off target data available for this crispr