ID: 934615351

View in Genome Browser
Species Human (GRCh38)
Location 2:95767307-95767329
Sequence TCAAGATCATAGGGCCTTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934615343_934615351 25 Left 934615343 2:95767259-95767281 CCTTCTTACAGATGAGGCACTGA No data
Right 934615351 2:95767307-95767329 TCAAGATCATAGGGCCTTTGAGG No data
934615342_934615351 28 Left 934615342 2:95767256-95767278 CCTCCTTCTTACAGATGAGGCAC No data
Right 934615351 2:95767307-95767329 TCAAGATCATAGGGCCTTTGAGG No data
934615347_934615351 -10 Left 934615347 2:95767294-95767316 CCAGGCGCCTTGTTCAAGATCAT No data
Right 934615351 2:95767307-95767329 TCAAGATCATAGGGCCTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934615351 Original CRISPR TCAAGATCATAGGGCCTTTG AGG Intergenic
No off target data available for this crispr