ID: 934616194

View in Genome Browser
Species Human (GRCh38)
Location 2:95772760-95772782
Sequence CCATGAGGGTTCCTGAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934616194_934616200 8 Left 934616194 2:95772760-95772782 CCAGCCTTCAGGAACCCTCATGG No data
Right 934616200 2:95772791-95772813 CTCTTCCCCCACTTTCTGCCAGG No data
934616194_934616201 12 Left 934616194 2:95772760-95772782 CCAGCCTTCAGGAACCCTCATGG No data
Right 934616201 2:95772795-95772817 TCCCCCACTTTCTGCCAGGCAGG No data
934616194_934616206 17 Left 934616194 2:95772760-95772782 CCAGCCTTCAGGAACCCTCATGG No data
Right 934616206 2:95772800-95772822 CACTTTCTGCCAGGCAGGAGAGG No data
934616194_934616208 26 Left 934616194 2:95772760-95772782 CCAGCCTTCAGGAACCCTCATGG No data
Right 934616208 2:95772809-95772831 CCAGGCAGGAGAGGCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934616194 Original CRISPR CCATGAGGGTTCCTGAAGGC TGG (reversed) Intergenic