ID: 934616206

View in Genome Browser
Species Human (GRCh38)
Location 2:95772800-95772822
Sequence CACTTTCTGCCAGGCAGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934616199_934616206 2 Left 934616199 2:95772775-95772797 CCTCATGGAGGCAGTTCTCTTCC No data
Right 934616206 2:95772800-95772822 CACTTTCTGCCAGGCAGGAGAGG No data
934616193_934616206 18 Left 934616193 2:95772759-95772781 CCCAGCCTTCAGGAACCCTCATG No data
Right 934616206 2:95772800-95772822 CACTTTCTGCCAGGCAGGAGAGG No data
934616194_934616206 17 Left 934616194 2:95772760-95772782 CCAGCCTTCAGGAACCCTCATGG No data
Right 934616206 2:95772800-95772822 CACTTTCTGCCAGGCAGGAGAGG No data
934616198_934616206 3 Left 934616198 2:95772774-95772796 CCCTCATGGAGGCAGTTCTCTTC No data
Right 934616206 2:95772800-95772822 CACTTTCTGCCAGGCAGGAGAGG No data
934616197_934616206 13 Left 934616197 2:95772764-95772786 CCTTCAGGAACCCTCATGGAGGC No data
Right 934616206 2:95772800-95772822 CACTTTCTGCCAGGCAGGAGAGG No data
934616191_934616206 29 Left 934616191 2:95772748-95772770 CCAAGTGAACACCCAGCCTTCAG No data
Right 934616206 2:95772800-95772822 CACTTTCTGCCAGGCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934616206 Original CRISPR CACTTTCTGCCAGGCAGGAG AGG Intergenic