ID: 934616208

View in Genome Browser
Species Human (GRCh38)
Location 2:95772809-95772831
Sequence CCAGGCAGGAGAGGCTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934616202_934616208 -10 Left 934616202 2:95772796-95772818 CCCCCACTTTCTGCCAGGCAGGA No data
Right 934616208 2:95772809-95772831 CCAGGCAGGAGAGGCTGCTGAGG No data
934616197_934616208 22 Left 934616197 2:95772764-95772786 CCTTCAGGAACCCTCATGGAGGC No data
Right 934616208 2:95772809-95772831 CCAGGCAGGAGAGGCTGCTGAGG No data
934616194_934616208 26 Left 934616194 2:95772760-95772782 CCAGCCTTCAGGAACCCTCATGG No data
Right 934616208 2:95772809-95772831 CCAGGCAGGAGAGGCTGCTGAGG No data
934616193_934616208 27 Left 934616193 2:95772759-95772781 CCCAGCCTTCAGGAACCCTCATG No data
Right 934616208 2:95772809-95772831 CCAGGCAGGAGAGGCTGCTGAGG No data
934616198_934616208 12 Left 934616198 2:95772774-95772796 CCCTCATGGAGGCAGTTCTCTTC No data
Right 934616208 2:95772809-95772831 CCAGGCAGGAGAGGCTGCTGAGG No data
934616199_934616208 11 Left 934616199 2:95772775-95772797 CCTCATGGAGGCAGTTCTCTTCC No data
Right 934616208 2:95772809-95772831 CCAGGCAGGAGAGGCTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934616208 Original CRISPR CCAGGCAGGAGAGGCTGCTG AGG Intergenic