ID: 934618150

View in Genome Browser
Species Human (GRCh38)
Location 2:95787959-95787981
Sequence CCTGCCCCCAGCCACAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934618144_934618150 0 Left 934618144 2:95787936-95787958 CCTGTCAGTGCCTTCAGGGAACA No data
Right 934618150 2:95787959-95787981 CCTGCCCCCAGCCACAGGGAGGG No data
934618145_934618150 -10 Left 934618145 2:95787946-95787968 CCTTCAGGGAACACCTGCCCCCA No data
Right 934618150 2:95787959-95787981 CCTGCCCCCAGCCACAGGGAGGG No data
934618140_934618150 23 Left 934618140 2:95787913-95787935 CCAGGTGATATACAGGAGAAAGG No data
Right 934618150 2:95787959-95787981 CCTGCCCCCAGCCACAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934618150 Original CRISPR CCTGCCCCCAGCCACAGGGA GGG Intergenic
No off target data available for this crispr