ID: 934618737

View in Genome Browser
Species Human (GRCh38)
Location 2:95791378-95791400
Sequence GTGCTGACAAATAGGGAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934618732_934618737 -7 Left 934618732 2:95791362-95791384 CCCACTCATCAGGGTCGTGCTGA No data
Right 934618737 2:95791378-95791400 GTGCTGACAAATAGGGAAGAGGG No data
934618731_934618737 -3 Left 934618731 2:95791358-95791380 CCAGCCCACTCATCAGGGTCGTG No data
Right 934618737 2:95791378-95791400 GTGCTGACAAATAGGGAAGAGGG No data
934618733_934618737 -8 Left 934618733 2:95791363-95791385 CCACTCATCAGGGTCGTGCTGAC No data
Right 934618737 2:95791378-95791400 GTGCTGACAAATAGGGAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934618737 Original CRISPR GTGCTGACAAATAGGGAAGA GGG Intergenic
No off target data available for this crispr