ID: 934619150

View in Genome Browser
Species Human (GRCh38)
Location 2:95793556-95793578
Sequence CAGGGTGAGGGGTGGGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934619135_934619150 16 Left 934619135 2:95793517-95793539 CCCACCGTGTTTCAGGCTGTGAA No data
Right 934619150 2:95793556-95793578 CAGGGTGAGGGGTGGGAATGGGG No data
934619140_934619150 -7 Left 934619140 2:95793540-95793562 CCTGTACCCGACTCAACAGGGTG No data
Right 934619150 2:95793556-95793578 CAGGGTGAGGGGTGGGAATGGGG No data
934619136_934619150 15 Left 934619136 2:95793518-95793540 CCACCGTGTTTCAGGCTGTGAAC No data
Right 934619150 2:95793556-95793578 CAGGGTGAGGGGTGGGAATGGGG No data
934619137_934619150 12 Left 934619137 2:95793521-95793543 CCGTGTTTCAGGCTGTGAACCTG No data
Right 934619150 2:95793556-95793578 CAGGGTGAGGGGTGGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934619150 Original CRISPR CAGGGTGAGGGGTGGGAATG GGG Intergenic
No off target data available for this crispr