ID: 934623218

View in Genome Browser
Species Human (GRCh38)
Location 2:95829068-95829090
Sequence TCCCTGGACAGAGCCTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 21, 1: 37, 2: 41, 3: 97, 4: 483}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934623218_934623228 17 Left 934623218 2:95829068-95829090 CCCCTGGAGGCTCTGTCCAGGGA 0: 21
1: 37
2: 41
3: 97
4: 483
Right 934623228 2:95829108-95829130 GGCTCGACAGCTCTGGCAGGGGG No data
934623218_934623230 23 Left 934623218 2:95829068-95829090 CCCCTGGAGGCTCTGTCCAGGGA 0: 21
1: 37
2: 41
3: 97
4: 483
Right 934623230 2:95829114-95829136 ACAGCTCTGGCAGGGGGGTTAGG No data
934623218_934623231 29 Left 934623218 2:95829068-95829090 CCCCTGGAGGCTCTGTCCAGGGA 0: 21
1: 37
2: 41
3: 97
4: 483
Right 934623231 2:95829120-95829142 CTGGCAGGGGGGTTAGGTAGAGG No data
934623218_934623225 14 Left 934623218 2:95829068-95829090 CCCCTGGAGGCTCTGTCCAGGGA 0: 21
1: 37
2: 41
3: 97
4: 483
Right 934623225 2:95829105-95829127 ACTGGCTCGACAGCTCTGGCAGG No data
934623218_934623229 18 Left 934623218 2:95829068-95829090 CCCCTGGAGGCTCTGTCCAGGGA 0: 21
1: 37
2: 41
3: 97
4: 483
Right 934623229 2:95829109-95829131 GCTCGACAGCTCTGGCAGGGGGG No data
934623218_934623224 10 Left 934623218 2:95829068-95829090 CCCCTGGAGGCTCTGTCCAGGGA 0: 21
1: 37
2: 41
3: 97
4: 483
Right 934623224 2:95829101-95829123 TGCTACTGGCTCGACAGCTCTGG No data
934623218_934623223 -4 Left 934623218 2:95829068-95829090 CCCCTGGAGGCTCTGTCCAGGGA 0: 21
1: 37
2: 41
3: 97
4: 483
Right 934623223 2:95829087-95829109 GGGAGTGGCTGAGTTGCTACTGG No data
934623218_934623226 15 Left 934623218 2:95829068-95829090 CCCCTGGAGGCTCTGTCCAGGGA 0: 21
1: 37
2: 41
3: 97
4: 483
Right 934623226 2:95829106-95829128 CTGGCTCGACAGCTCTGGCAGGG No data
934623218_934623227 16 Left 934623218 2:95829068-95829090 CCCCTGGAGGCTCTGTCCAGGGA 0: 21
1: 37
2: 41
3: 97
4: 483
Right 934623227 2:95829107-95829129 TGGCTCGACAGCTCTGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934623218 Original CRISPR TCCCTGGACAGAGCCTCCAG GGG (reversed) Intergenic
900161506 1:1226305-1226327 TTTCTGGAAAGAGCATCCAGAGG - Intronic
900161523 1:1226368-1226390 TTTCTGGAAAGAGCCCCCAGAGG - Intronic
900172144 1:1274243-1274265 ACCCTCCACTGAGCCTCCAGGGG - Intergenic
900601034 1:3502690-3502712 CCCCTGGAGAGGGCCTGCAGGGG + Intronic
900628547 1:3621337-3621359 TGCCCGGACAGGGCCACCAGAGG - Intergenic
900664041 1:3801642-3801664 TGCCCGGACAGGGCCACCAGAGG - Intergenic
900987007 1:6078959-6078981 ACCCTGCTCTGAGCCTCCAGCGG - Intronic
901040950 1:6363211-6363233 TGCCCGGACAGGGCCACCAGAGG + Intronic
901154425 1:7125812-7125834 TCACGGGACAGAGGTTCCAGGGG + Intronic
901637483 1:10677053-10677075 TTCCTGGGCAGAGCCCCCTGGGG + Intronic
902853695 1:19183375-19183397 TCCCTGGAAAGAGCGTTGAGAGG - Intronic
903064299 1:20690151-20690173 TCCCTGGAGACAGCCTCGGGGGG + Intronic
903090856 1:20915213-20915235 TTCTTCCACAGAGCCTCCAGAGG - Intronic
903328356 1:22584213-22584235 CCCCAGGACTGAGCCTCCCGGGG + Intronic
903455020 1:23481666-23481688 GCCCTGAACAGAGCCTGCTGTGG + Intronic
904083280 1:27885520-27885542 TCCCTGGACAGGGCCACCAGAGG - Intronic
904713392 1:32448477-32448499 TGCCTGGACAGGGCCACTAGAGG + Intergenic
905835546 1:41117353-41117375 TGCCCGGACAGGGCCACCAGAGG + Intronic
905848720 1:41257417-41257439 TCCCTGCACAGAGCCTCCAGGGG - Intergenic
906025030 1:42666106-42666128 ACCCTGGATGGAACCTCCAGAGG + Intronic
906108071 1:43306545-43306567 GCCCTGGTCCTAGCCTCCAGGGG - Intronic
906681046 1:47725562-47725584 TCCCTGGGCAGCGCCTGCAGTGG + Intergenic
906833729 1:49060823-49060845 TCACTGAACTGAGCCCCCAGTGG + Intronic
907714886 1:56917296-56917318 TCCCTGGACAGAGCCCCCAGGGG + Intronic
909047399 1:70727500-70727522 CCCCGGGACAGAGCTTTCAGAGG - Intergenic
909051516 1:70773871-70773893 TCCCTGGACAGAGCCTCCAGGGG - Intergenic
909455237 1:75842670-75842692 TGCCCGGACAGGGCCACCAGAGG + Intronic
909893519 1:81037083-81037105 TCTCTGATCAAAGCCTCCAGTGG + Intergenic
911958124 1:104263344-104263366 TGCCTGGACAGGGCCACCAGAGG - Intergenic
912100084 1:106193153-106193175 TCCCAGTACAGAGCCACCAGGGG + Intergenic
912893261 1:113557829-113557851 ACCTGGGACAGAGCTTCCAGAGG + Intronic
912916948 1:113825024-113825046 TTCCTAAACAGAGCCTCCATAGG - Intronic
913220221 1:116654235-116654257 GCCCTGCACAGAGGCTCCTGAGG + Intronic
913281125 1:117185967-117185989 GCCCATGACACAGCCTCCAGAGG - Intronic
913410189 1:118542564-118542586 TCCTTGGATGGAGCCTCCAGGGG + Intergenic
913430927 1:118789573-118789595 TCCTGGGACAGAGCTCCCAGAGG + Intergenic
914195933 1:145448180-145448202 TCCCTGGACCCGGCCTCCTGTGG - Intergenic
914240411 1:145849342-145849364 CCCTTGGCCAGAGCCCCCAGAGG + Exonic
914378894 1:147098560-147098582 TGCCCGGACAGGGCCACCAGAGG - Intergenic
914414602 1:147468523-147468545 TCCCTGGACAGAGCCTCCAGGGG - Intergenic
915219434 1:154362505-154362527 ACCCATGACACAGCCTCCAGAGG - Intergenic
915330081 1:155105947-155105969 CCCCTGGCCAAACCCTCCAGTGG - Intergenic
915636764 1:157193002-157193024 TCCCTGGGCAGAAGGTCCAGGGG + Intergenic
916183094 1:162105274-162105296 TCCTAGGACAGAGCTTCCAGAGG - Intronic
916568911 1:166008250-166008272 TCTCTGGACAGAGCTGCCAAGGG - Intergenic
917259076 1:173148038-173148060 TCCCTGGACAGAGCTTCCAGGGG - Intergenic
917585867 1:176425907-176425929 TGCCTGGACACAGCTCCCAGTGG - Intergenic
918210735 1:182348937-182348959 TGCATGGAAAGAGCCCCCAGCGG - Intergenic
919260756 1:195190763-195190785 TCCCCGGACAGAGCCACCAGGGG + Intergenic
919549557 1:198966924-198966946 ACCCTGGACAGAGCAGCAAGCGG - Intergenic
919577986 1:199336413-199336435 TCCCTGGACAGAGCCTCCAGGGG - Intergenic
920675086 1:208032989-208033011 TCCCTGGGCAGGGCTTCCAAAGG - Intronic
921012963 1:211161300-211161322 TCCCTGAACAGAGTCTCCAGGGG - Intergenic
922705944 1:227790021-227790043 ACCCTGGCCAGAGCCTCCTGTGG - Intergenic
923617273 1:235548395-235548417 TCCCTGGACATTGCTACCAGTGG + Exonic
1063372812 10:5532792-5532814 CCTCTGGACAGAGCCTGGAGAGG - Intergenic
1063580086 10:7298192-7298214 TCCCTGGACATACCCTGCAGAGG - Intronic
1063787492 10:9402240-9402262 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1063985284 10:11495126-11495148 TGCCCGGACAGGGCCACCAGAGG - Intronic
1064018760 10:11792925-11792947 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1064825551 10:19395249-19395271 GCCCATGACACAGCCTCCAGAGG + Intronic
1067578769 10:47425978-47426000 TCCCTGGATGGAGCTCCCAGTGG + Intergenic
1067673300 10:48346406-48346428 TGCCCGGACAGGGCCACCAGAGG + Intronic
1068218211 10:54010373-54010395 TCCTGGGACAGAGCTCCCAGAGG + Intronic
1068414478 10:56700868-56700890 CCCCTTGATAGAACCTCCAGAGG - Intergenic
1069641755 10:69960856-69960878 GCCCTGGCCAGAGCCTGAAGGGG - Intronic
1069879904 10:71585534-71585556 TCTAGGGACAGAGCCTCTAGAGG + Intronic
1070628803 10:78069784-78069806 TCCCGGCTCAGAGCCTTCAGAGG - Intergenic
1070903442 10:80050830-80050852 TCTCATGACAGAGCCTCCTGTGG + Intergenic
1070913441 10:80137461-80137483 CCTCTGGACAGAGCCAGCAGGGG + Intronic
1072607287 10:96995284-96995306 CCCAAGGACAGGGCCTCCAGAGG + Intergenic
1072611199 10:97018643-97018665 TCCCTGGACAGCTGTTCCAGTGG - Exonic
1073783630 10:106865280-106865302 TCCTGGGACAGAGCTCCCAGAGG + Intronic
1073783771 10:106866136-106866158 TTCCTGGACAGAGCCCCCAGGGG + Intronic
1073875902 10:107920873-107920895 TCCCTGAACAGAACCTCCAGGGG + Intergenic
1074609024 10:115003753-115003775 TCCCTGGACTTAGACTCCAAAGG + Intergenic
1075030502 10:119021493-119021515 TCCCCGCCAAGAGCCTCCAGAGG + Intergenic
1075657859 10:124173854-124173876 TCCCTGGAGGGAGGCTCCAGGGG - Intergenic
1075893833 10:125977945-125977967 TCCCCGAACAGAGCCTCCAGGGG - Intronic
1076628827 10:131840325-131840347 TGCCAGGACAGGGCCACCAGAGG - Intergenic
1076785276 10:132746535-132746557 TGCCTGGACAGGGCGTCCACAGG - Intronic
1076851433 10:133095328-133095350 ACCCTGGACAGAGGCCCCTGAGG - Intronic
1076862280 10:133144039-133144061 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1076894745 10:133304875-133304897 TGCCCGGACAGGGCCACCAGAGG + Intronic
1076896265 10:133313979-133314001 TGCCCGGACAGGGCCACCAGAGG + Intronic
1077755649 11:5025095-5025117 CCCTGGGACAGAGCTTCCAGTGG + Intergenic
1078079427 11:8193158-8193180 ACCCTGGACACAGACTGCAGTGG - Intergenic
1078993109 11:16669593-16669615 TCCCTGGACAGAACTCCCAGTGG + Intronic
1079281488 11:19090836-19090858 TACCTGCTCAAAGCCTCCAGTGG + Intergenic
1079373381 11:19871030-19871052 TCCATGCTCAGAGCCTCCAAGGG - Intronic
1079668353 11:23135339-23135361 TCCCTGAACAGAGCCTCTAGAGG - Intergenic
1082689005 11:56277392-56277414 TGCCTGGACAGGGTCACCAGAGG + Intergenic
1083366148 11:62142486-62142508 TCCCTGCACAAAGCATCTAGTGG + Intronic
1083502934 11:63128264-63128286 TGCCTGGACAGGGCCACCAGAGG + Intronic
1083716575 11:64580901-64580923 GCCCTGGGCACAGGCTCCAGAGG + Intergenic
1083910506 11:65706397-65706419 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1084262924 11:67990752-67990774 TCCCGAGACACACCCTCCAGAGG - Intergenic
1084696849 11:70760949-70760971 TCCCTGAGCACATCCTCCAGGGG - Intronic
1084795488 11:71502097-71502119 GCACAGGCCAGAGCCTCCAGGGG + Intronic
1084836098 11:71802930-71802952 TGTCTGGACACATCCTCCAGTGG - Intergenic
1085024779 11:73230057-73230079 TCCCAGGACAGAGCCTCCCCTGG - Intronic
1085203715 11:74717740-74717762 TCCCTGCACAGAGCCAAGAGAGG - Intronic
1085452217 11:76641315-76641337 TCCCTCCCCAGAGCCTTCAGAGG + Intergenic
1086569137 11:88262945-88262967 TCCCTGGTCAGATCCCCCAGGGG - Intergenic
1086821917 11:91445738-91445760 CCCTTGGACAGAGCTCCCAGAGG + Intergenic
1087374712 11:97326559-97326581 TCCCTGGACAGAGCCTCCAGGGG - Intergenic
1087531355 11:99386334-99386356 TCCATGGACAGAGCAGCCCGAGG + Intronic
1088095510 11:106095924-106095946 TCCCTGGACAGAGCCTGTTTAGG + Intronic
1088595788 11:111439279-111439301 GCGCTGGGCAAAGCCTCCAGAGG - Intronic
1088729823 11:112670972-112670994 AACCTGGACAGAGCTCCCAGTGG + Intergenic
1088796194 11:113268635-113268657 TGCCTGGACAGAGACCCCTGGGG + Intronic
1088893886 11:114063812-114063834 TGGCTGGACAGAGCCTCCCTGGG + Exonic
1089613143 11:119680844-119680866 TCCCTGGGCAGAGGCCCCATGGG + Intronic
1089617789 11:119704753-119704775 TGCCCGGAGAGAGCCTCCCGGGG - Intronic
1089645837 11:119878100-119878122 TCTCTGGACAGTGCCCCCATTGG - Intergenic
1089730198 11:120514438-120514460 GCACTGGACTGAGCGTCCAGGGG - Intronic
1090033505 11:123228395-123228417 GCCCTGGACAGAGTTTCCTGGGG - Intergenic
1090462650 11:126905802-126905824 ACACTGGGGAGAGCCTCCAGTGG + Intronic
1091213442 11:133884624-133884646 TCTCTGGACGAAGCTTCCAGAGG - Intergenic
1092407218 12:8229469-8229491 TCTCTGGACACATCCTCCAGTGG + Intergenic
1092444123 12:8537970-8537992 TGCCCGGACAGGGCCACCAGAGG + Intronic
1092579172 12:9820453-9820475 TTCCTGGACAGAGTTCCCAGTGG + Intergenic
1093932056 12:24963866-24963888 TGCCAGGACACAGCCTCCTGAGG + Intergenic
1095835904 12:46638318-46638340 TCCCTGGGCAGAGCTTCCAGGGG + Intergenic
1096556630 12:52407949-52407971 TCCCTGGACTGAGTCCACAGAGG + Intergenic
1097089900 12:56496854-56496876 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1097090610 12:56501422-56501444 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1097521085 12:60672146-60672168 CCCTGGGACACAGCCTCCAGAGG - Intergenic
1097910533 12:64965218-64965240 CCCTGGGACAGAGCTTCCAGAGG - Intergenic
1098935406 12:76473066-76473088 TGCCCGGACAGGGCCACCAGAGG - Intronic
1099667846 12:85654099-85654121 CCCTGGGACAGAGCTTCCAGAGG - Intergenic
1099719503 12:86342393-86342415 TCCCTGGAAAGAGCCTCCAGGGG + Intronic
1100135131 12:91544846-91544868 CCCCTGGACAGAGCCTGCAGGGG + Intergenic
1100248041 12:92784070-92784092 TCCCTGAAAAAAGCCTCAAGGGG - Intronic
1100540543 12:95553108-95553130 GCCCTGGACACAGCATCCTGAGG - Intergenic
1100941122 12:99723492-99723514 TCCCTGGCCGGAGCCACTAGGGG + Intronic
1103003627 12:117404974-117404996 CTCCAGGACTGAGCCTCCAGGGG - Intronic
1103357923 12:120335596-120335618 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1103699723 12:122842825-122842847 TCCCTGGACTGAGACTCATGGGG - Intronic
1103887796 12:124215902-124215924 ACCCTCCTCAGAGCCTCCAGAGG - Intronic
1104871530 12:132001715-132001737 TGCCCGGACAGGGCCACCAGAGG - Intronic
1104878293 12:132051947-132051969 TGCCCGGACAGGGCCACCAGAGG - Intronic
1105043051 12:132977054-132977076 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1105225247 13:18425899-18425921 CCCCTAAACAGAGCTTCCAGTGG + Intergenic
1106378320 13:29211457-29211479 TTCCTGGACAGAGTCTGGAGAGG - Intronic
1106392314 13:29346672-29346694 TTCCTGGACAGAGTCTGGAGAGG - Intronic
1106958735 13:34973437-34973459 TCCTGGGACAGAGCTCCCAGAGG - Intronic
1107119321 13:36779454-36779476 TCCCGGGATAGAGCTTTCAGAGG + Intergenic
1107618788 13:42202351-42202373 TCTCTGGAAAGAGCCTCCCAAGG - Intronic
1108304692 13:49119131-49119153 TTCTGGGACAGAGCTTCCAGAGG + Intronic
1110867022 13:80407574-80407596 TCCCTGGGCAGATCTCCCAGGGG - Intergenic
1112299111 13:98214027-98214049 GCCCTGGACAGAGCAGCCTGGGG + Intronic
1113226926 13:108169227-108169249 TCCCTGGACAGAGTTCCCAAGGG + Intergenic
1113487835 13:110668018-110668040 TCCAGGGACAGAGCTTCGAGTGG - Intronic
1113880288 13:113621649-113621671 TGCCCGGACAGGGCCACCAGAGG + Intronic
1114009715 14:18354243-18354265 CCCCTAAACAGAGCTTCCAGTGG + Intergenic
1114542828 14:23475250-23475272 TCCCTGAAGAGATCCTCCTGAGG - Exonic
1114658067 14:24328083-24328105 TGCCTGGACAGGGCCACCAGAGG + Intronic
1115175987 14:30562453-30562475 TGCCCGGACAGGGCCACCAGAGG + Intronic
1116301490 14:43188807-43188829 CCCTGGGACAGAGCCTCCAGAGG + Intergenic
1117014417 14:51504299-51504321 CCCCAGTACAGAGCTTCCAGAGG - Intronic
1117632626 14:57709304-57709326 TGCCTGGACAGTGCCACCAGAGG - Intronic
1119107016 14:71933831-71933853 TCCCTGGAAAGAAAGTCCAGTGG - Intronic
1119188847 14:72664651-72664673 TCTCTGGACACAGCATCCAGTGG - Intronic
1121292070 14:92784139-92784161 TCCCTGGAGGAAGCCTGCAGGGG + Intergenic
1121506700 14:94483225-94483247 TCCCAGGCTAAAGCCTCCAGAGG + Intergenic
1121631866 14:95427167-95427189 TGCCCGGACAGGGCCACCAGAGG + Intronic
1121964515 14:98291814-98291836 TCTCTGGGCAGAGCCTGCAAAGG - Intergenic
1122089699 14:99330209-99330231 GCCCAGGACTGAGCCTGCAGAGG + Intergenic
1122549295 14:102541127-102541149 TCTGTGGACAGAGCCTCCGTCGG + Intergenic
1122756046 14:103980823-103980845 TGCCCGGACAGGGCCACCAGAGG - Intronic
1122977956 14:105178673-105178695 GCCCTGGGCAGAGCCCCCGGTGG - Intronic
1123193288 14:106591931-106591953 TGCCTGGACAGGGCGACCAGAGG - Intergenic
1202893462 14_KI270722v1_random:181948-181970 CACCTGGACAGGGCCACCAGAGG + Intergenic
1124339982 15:28884768-28884790 TCCAGGGCCAGAGCCGCCAGTGG - Intronic
1124374123 15:29119996-29120018 TCCATGGACATGGCCTCCAAGGG - Intergenic
1124624584 15:31300594-31300616 TCCCCAGACACAGCCTCCAGGGG - Intergenic
1125728891 15:41882072-41882094 TCGCTGGAGAGAGCGTCCTGCGG - Exonic
1126225218 15:46262149-46262171 TCCCTGGACAGAGCCTCCAGGGG - Intergenic
1127188550 15:56506062-56506084 TCCCTGGACAGAGCCTCCAGGGG + Intergenic
1127317789 15:57814457-57814479 CCCCGGGACAAAGCTTCCAGAGG - Intergenic
1128799169 15:70486731-70486753 ACCCAGGAGAGGGCCTCCAGGGG - Intergenic
1128921581 15:71615275-71615297 CCCCTGGTCAGAGACTCCAAAGG + Intronic
1129176910 15:73846925-73846947 TTCCTTGGCAAAGCCTCCAGTGG - Intergenic
1129359094 15:75013130-75013152 TCCCTGGAAAGTTACTCCAGTGG - Intronic
1129921166 15:79320188-79320210 TGCCTGGACAGGGCCGCCAGAGG - Intronic
1130185490 15:81677450-81677472 TCCTGGGACAGAGCTCCCAGAGG + Intergenic
1130620054 15:85453228-85453250 TCCCTGGACAGAGCCTCTAGTGG - Intronic
1131408364 15:92185082-92185104 TCTCTGGACACAGCCTGCTGCGG + Intergenic
1131552522 15:93369769-93369791 GGCCTGGACAGAGCCGGCAGTGG + Intergenic
1132966872 16:2660981-2661003 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1133010378 16:2907251-2907273 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1133197525 16:4182009-4182031 TCCCAGCACAGAGGCTGCAGCGG + Intergenic
1134382393 16:13740129-13740151 TGCCTGGACAGGGCCACCAGAGG + Intergenic
1135295953 16:21279282-21279304 TCCCTTCTCAGAGCCTCCAATGG - Intronic
1136120060 16:28127075-28127097 TAGCAGGAGAGAGCCTCCAGAGG - Intronic
1136191247 16:28616084-28616106 TGCCTGGACAGGGCCACCAGAGG - Intronic
1136319142 16:29471276-29471298 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1136352763 16:29721787-29721809 TGCCCGGACAGAGCCACCAGAGG - Intergenic
1136433713 16:30210620-30210642 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1137229874 16:46554517-46554539 TGCCTGGACAGGGCCACCAGAGG + Intergenic
1137518557 16:49172038-49172060 CCCCTGGCCAGAGCCTGCTGTGG - Intergenic
1137590148 16:49688431-49688453 TCCCTGGCCCAAACCTCCAGCGG - Intronic
1138496294 16:57411300-57411322 GCCCTGGGCACAGCCCCCAGAGG + Intronic
1138505512 16:57476442-57476464 GCCCTGGCCAGATCCTGCAGTGG - Intronic
1138567585 16:57844823-57844845 TTCCTAGACAGACCCTGCAGCGG + Intronic
1138592020 16:58005436-58005458 TGCCCGGACAGGGCCACCAGAGG - Intronic
1138923064 16:61556197-61556219 TCCCTGGACAGAGCTCCAAGAGG + Intergenic
1138947568 16:61870696-61870718 ACCCATGACACAGCCTCCAGAGG + Intronic
1140927119 16:79593970-79593992 TCCACGGGCAGAGGCTCCAGCGG - Exonic
1141546954 16:84776639-84776661 TCCCCCGCAAGAGCCTCCAGGGG - Intronic
1142115363 16:88353467-88353489 ACGCTGTACAGAGCCACCAGCGG + Intergenic
1142384253 16:89752738-89752760 TGCCCGGACAGGGCCACCAGAGG + Intronic
1142390038 16:89793295-89793317 TGCCCGGACAGGGCCACCAGAGG - Intronic
1142763559 17:2054373-2054395 TGGCTGGACAGCGCCTCCGGGGG - Intronic
1142984990 17:3690242-3690264 GTCCTGGGCAGAGGCTCCAGGGG - Intronic
1143392444 17:6567733-6567755 TGCCTGGGCAGGGCCTCCCGAGG + Intergenic
1143598150 17:7928042-7928064 ACTCTGGACAGTGGCTCCAGAGG - Intronic
1144482366 17:15638659-15638681 TCCTTGGGCAGAGGCTTCAGGGG + Intronic
1144916317 17:18726373-18726395 TCCTTGGGCAGAGGCTTCAGGGG - Intronic
1145207246 17:20991138-20991160 CCCCTGGCCAGAGCCACCAAGGG - Intergenic
1145243859 17:21254977-21254999 GCCCTGGACACAGCCTCAGGAGG + Intergenic
1146227122 17:31076851-31076873 TCTCTGGAAAGAGAGTCCAGTGG + Intergenic
1147624927 17:41893888-41893910 CTCTTGGACAGACCCTCCAGTGG + Intronic
1148401088 17:47362352-47362374 TGCCTGGACAGGGCCACCAGAGG + Intronic
1148593061 17:48831073-48831095 TCCCTGGTGAGTGCCTCAAGTGG + Exonic
1149591519 17:57833239-57833261 GCTCTGGGCAGAGTCTCCAGGGG + Intergenic
1150206034 17:63408502-63408524 TTCCTGGACAAAGTATCCAGTGG - Intronic
1151206377 17:72510861-72510883 TCCGTGGACTGATCCTCCTGTGG - Intergenic
1151464562 17:74276155-74276177 TTCCTGGAGAGAACCTCCGGTGG - Intronic
1151560965 17:74869329-74869351 TCCCTGATCAGAGTCTCCCGGGG - Intronic
1151654828 17:75490977-75490999 TCCCTGGAGACGGCCTCTAGGGG - Intronic
1151849717 17:76683164-76683186 TCCCTGGACAGAGGCTAGAGGGG - Intronic
1151868600 17:76821340-76821362 TCTCTGGCCTCAGCCTCCAGAGG + Intergenic
1151875846 17:76868037-76868059 TCCCTGGTCAGAAACTCCCGTGG - Intergenic
1152431206 17:80249068-80249090 CCCCTGGCCAGAGCCTCCTTTGG + Intronic
1152533533 17:80937002-80937024 TCCGTGGACAGAGGCAGCAGAGG - Intronic
1152747311 17:82047264-82047286 TCCCAGCCCAGAGCCTGCAGTGG + Intergenic
1153163141 18:2230899-2230921 TGTCTGGACAGGGCCACCAGAGG - Intergenic
1153785375 18:8529327-8529349 TCCCTGGAAAGAGCCTCCAGGGG + Intergenic
1154181367 18:12142520-12142542 TCCATTGACACAGCCTCCAGGGG - Intergenic
1154182537 18:12149064-12149086 TCCATTGACACAGCCTCCAGGGG + Intergenic
1154350598 18:13580187-13580209 TCCCTGCTCAAAGCCTTCAGTGG + Intronic
1154528124 18:15313623-15313645 CCCCTAAACAGAGCTTCCAGTGG - Intergenic
1155083035 18:22429450-22429472 TTCCTGGACAGGGTCTCCAGAGG + Intergenic
1155169815 18:23259203-23259225 TTCCTGGTCAGTGCCTACAGGGG + Exonic
1156465324 18:37345095-37345117 TCCAGAGACAGAGCCTCCCGAGG - Intronic
1160120078 18:76122255-76122277 TCCCAGGGCAGAGGCTGCAGAGG + Intergenic
1160632712 18:80257997-80258019 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1160846699 19:1169196-1169218 GCCCGGGACAGTGCCTGCAGGGG + Intronic
1162236270 19:9312222-9312244 TGCCTGGACAGAGCCACCAGAGG + Intergenic
1162613096 19:11771684-11771706 TGCCTGGACAGGGCCACCAGGGG + Intronic
1162729907 19:12712188-12712210 TGCCCGGACAGGGCCACCAGAGG + Intronic
1162926146 19:13931430-13931452 TCCGTGGACAGAGCCCCCAAAGG + Intronic
1163471394 19:17499232-17499254 TGCCCGGACAGGGCCACCAGAGG - Intronic
1163688255 19:18724564-18724586 TTCCTCCCCAGAGCCTCCAGAGG - Intronic
1164083547 19:21880966-21880988 TGCCTGGACAGGGCCACCAGAGG - Intergenic
1164084707 19:21890236-21890258 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1164261506 19:23571978-23572000 TGCCCGGACAGGGCCACCAGAGG + Intronic
1164740939 19:30575294-30575316 TCCATGGACAGCCCCTCCATGGG + Intronic
1164955229 19:32377307-32377329 TGCCTGGACAGGGCCACCAGAGG - Intronic
1165275543 19:34747995-34748017 TCCCTAGAAATAGCATCCAGAGG + Intergenic
1165541236 19:36493303-36493325 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1165794449 19:38510840-38510862 ACCCAGGACAGAGCCTCCATGGG - Intronic
1166256239 19:41606784-41606806 TCCCTGGAGAGAGAGTCCACAGG + Intronic
1167180735 19:47901527-47901549 TCCTTCCCCAGAGCCTCCAGAGG + Intergenic
1167369998 19:49075020-49075042 TGCCTGGACAGGGCCACCAGAGG + Intergenic
1167392931 19:49208468-49208490 TTCCTGGACAGGGCCACCAGAGG - Intronic
1167566828 19:50261976-50261998 TCCCTGGCCAGTCCCTCGAGGGG + Intronic
1167991032 19:53360713-53360735 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1168069835 19:53943211-53943233 TCCCTCGACGGGGCCTCGAGGGG - Exonic
1168131547 19:54323081-54323103 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1168215177 19:54919857-54919879 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1168683747 19:58335622-58335644 TCCCTGGTCTGAGCCCCCACTGG + Intronic
925279032 2:2670010-2670032 TCCCAGGTCAGGGGCTCCAGGGG - Intergenic
925279047 2:2670046-2670068 TCCCAGGTCAGGGGCTCCAGGGG - Intergenic
925279062 2:2670082-2670104 TCCCAGGTCAGGGGCTCCAGGGG - Intergenic
925279089 2:2670154-2670176 TCCCAGGTCAGGGGCTCCAGGGG - Intergenic
927844733 2:26465514-26465536 TCCCTGGGCACAGTCTTCAGGGG - Intronic
928104294 2:28457797-28457819 TGCCTGGAGAGAGCCTCATGGGG + Intronic
928462161 2:31485193-31485215 TCCCTGGACACAGCCCCCAGGGG - Intergenic
930229442 2:48828015-48828037 TCACTAGACAGAGTCCCCAGGGG + Intergenic
930516508 2:52414144-52414166 TCCACTGACAGAGCATCCAGGGG + Intergenic
931179514 2:59885515-59885537 ACCCCCGACCGAGCCTCCAGTGG + Intergenic
931247424 2:60503233-60503255 CACCTGGTCAGAGCCTCCTGAGG - Intronic
931543386 2:63354002-63354024 TCCCTGAACAGAGCCTTCAGGGG + Intronic
932672940 2:73754040-73754062 TGCCCGGACAGGGCCACCAGAGG + Intergenic
933085752 2:78052712-78052734 GCCCCAGACAGAGCATCCAGGGG - Intergenic
934543136 2:95193067-95193089 TGCCCGGACAGGGCCACCAGAGG + Intergenic
934623218 2:95829068-95829090 TCCCTGGACAGAGCCTCCAGGGG - Intergenic
934633314 2:95955269-95955291 CCACTGGAAAGAGTCTCCAGAGG - Intronic
934800184 2:97148010-97148032 CCACTGGAAAGAGTCTCCAGAGG + Intronic
934810548 2:97273025-97273047 TCCCTGGAGAGAGCCTCCAGGGG + Intergenic
934827144 2:97434914-97434936 TCCCTGGAGAGAGCCTCCAGGGG - Intergenic
935259767 2:101344127-101344149 TCCCTGGAGAATTCCTCCAGTGG - Intergenic
935929885 2:108113072-108113094 CCCTGGGACAGAGCTTCCAGAGG - Intergenic
936171601 2:110181408-110181430 TCCTGGGACAGAGCTTCCAGAGG + Intronic
936522668 2:113220790-113220812 TCCCAGGACACAGCTTCCTGAGG - Intronic
936959426 2:118057731-118057753 TCCCTGGACAGCGTCTTCGGAGG - Intergenic
937024179 2:118683620-118683642 TGCCTTCACAGAGCCTGCAGAGG + Intergenic
937363038 2:121242322-121242344 TGCGGGGACAGAGCCTCCAAGGG - Intronic
937397132 2:121546964-121546986 TCCTGGGACAGAGCTCCCAGAGG + Intronic
938266126 2:129929572-129929594 CCTCTGGACAGAGCCAGCAGGGG - Intergenic
938742763 2:134248446-134248468 TTCCTGCATAAAGCCTCCAGGGG - Intronic
938871812 2:135485545-135485567 ACCCTGCACAGTGCCTCTAGGGG - Intronic
939345774 2:140964540-140964562 TGCCTGGACAGGGCCACCAGAGG - Intronic
939674846 2:145059943-145059965 TCCCTGGAAATGGCCCCCAGAGG - Intergenic
940357068 2:152755158-152755180 TGCCTGGCCAGGGCCACCAGAGG + Intronic
940615023 2:156038847-156038869 TCCTGGGACAGAGCTTCTAGAGG + Intergenic
940674726 2:156714363-156714385 TTTCTGGACAGAGCCTCCAGGGG - Intergenic
941344323 2:164348561-164348583 TCCCCGGACAGAGCCTCCAGGGG - Intergenic
943084397 2:183295205-183295227 TGCCTGGACAGGGCCACTAGAGG + Intergenic
943233717 2:185291212-185291234 TGCCTGGACAGGGCCACTAGAGG + Intergenic
943611897 2:190044549-190044571 TCCCTGGACAGAGCCTCTCAGGG - Intronic
943701884 2:190995966-190995988 TCTCTTGACAGAACCTGCAGTGG - Intronic
945779641 2:214153227-214153249 TGCCTGGACAGGGCCACCAGAGG - Intronic
946153889 2:217794389-217794411 ACCCAGGACAGAGCCTCGAAAGG + Intergenic
946843821 2:223841537-223841559 TCCCTGGTCAGATCCTAAAGAGG + Intergenic
947606646 2:231490229-231490251 TGCCCGGACAGGGCCACCAGAGG - Intergenic
948107540 2:235427576-235427598 TCTCTGGACAGAGCCACCCCTGG + Intergenic
948807932 2:240460947-240460969 TCCCTGAACACAGCAACCAGAGG - Intronic
948813076 2:240495106-240495128 TGCCCGGACAGGGCCACCAGAGG + Intronic
949044783 2:241867387-241867409 TGCCTGGAGAGAGGCTCCAGTGG + Intergenic
949046779 2:241875989-241876011 TGCCCGGACAGGGCCACCAGAGG - Intergenic
949062074 2:241967097-241967119 CCCCTGGCCAGAGCCACCAGAGG - Intergenic
1168962510 20:1878974-1878996 TCCCAGGACAGAGCTTCCCAAGG + Intergenic
1170508557 20:17054207-17054229 TCCCTGGACAGAGCTCCCAGAGG - Intergenic
1171142078 20:22752025-22752047 TGCCTGGACAGAGGCTCCCTTGG - Intergenic
1171279481 20:23883767-23883789 TCCCTGGTCCCAGCCTGCAGGGG + Intergenic
1171282064 20:23909625-23909647 TCCATGTACAGAGCCTCCAGGGG - Intergenic
1172358850 20:34298454-34298476 TGCCCGGACAGGGCCACCAGAGG + Intronic
1172537682 20:35687008-35687030 TGCGTGGACAGGGCCACCAGAGG + Intronic
1173055122 20:39604520-39604542 TCCCTGGGCAAAGCCTACATGGG + Intergenic
1175815548 20:61881519-61881541 TCCCGCCTCAGAGCCTCCAGTGG + Intronic
1175943870 20:62549990-62550012 TCGCTGCTCTGAGCCTCCAGTGG - Intergenic
1176127955 20:63484319-63484341 TCCCTGAACAGGGGCTGCAGTGG - Intergenic
1176139771 20:63539855-63539877 CCCCTGGAAATAGCCTCCAAGGG + Intergenic
1176154911 20:63614376-63614398 TGCCTGGACAGGGCCACCAGAGG + Intronic
1176420362 21:6509069-6509091 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1176769304 21:13054918-13054940 CCCCTAAACAGAGCTTCCAGTGG + Intergenic
1176977061 21:15334562-15334584 TCCCTGGACAGAGCCTTCAGGGG - Intergenic
1179695853 21:43117389-43117411 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1179916210 21:44479812-44479834 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1180052176 21:45336207-45336229 TCCCTGCACTAAGGCTCCAGGGG - Intergenic
1180434215 22:15285052-15285074 CCCCTAAACAGAGCTTCCAGTGG + Intergenic
1180750314 22:18119869-18119891 GCCAGGGGCAGAGCCTCCAGAGG - Intronic
1180787423 22:18554657-18554679 CCCTAGGACAGAGCCTTCAGGGG + Intergenic
1180821521 22:18832254-18832276 GCCCTGCACAGAGGCTCCTGAGG + Intergenic
1181053590 22:20248987-20249009 CCACTGGGCAGAGCCTCCAGGGG - Intronic
1181082990 22:20426271-20426293 TCCCTTGCCAGAGGCACCAGCGG - Exonic
1181084909 22:20435447-20435469 TCTCTGTACAAAGCCCCCAGGGG + Intronic
1181106610 22:20579461-20579483 ACCCTGGGGAGTGCCTCCAGGGG + Intronic
1181191457 22:21143791-21143813 GCCCTGCACAGAGGCTCCTGAGG - Intergenic
1181207741 22:21266719-21266741 GCCCTGCACAGAGGCTCCTGAGG + Intergenic
1181234317 22:21440648-21440670 CCCTAGGACAGAGCCTTCAGGGG - Intronic
1181244331 22:21494183-21494205 CCCTAGGACAGAGCCTTCAGGGG + Intergenic
1181406423 22:22688035-22688057 TCCTTGGTCAGAACCTCCTGTGG + Intergenic
1181414377 22:22748675-22748697 TCCTTGGTCAGAACCTCCTGTGG + Intronic
1181598004 22:23930192-23930214 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1181729948 22:24837711-24837733 TGCCCGGACAGGGCCACCAGAGG - Intronic
1181969034 22:26676233-26676255 TCCCTGGATAGACTCTCAAGAGG - Intergenic
1183041713 22:35184868-35184890 TTCCTGGACAGAGCCTCCAGGGG + Intergenic
1183314285 22:37128511-37128533 TCCCCTGACAGAGGCTGCAGGGG + Exonic
1183688298 22:39374576-39374598 CCCCTGCACAGAGTCTACAGAGG + Intronic
1183732193 22:39624720-39624742 CCCCTGCCCAGAGCCACCAGGGG + Intronic
1183859695 22:40660891-40660913 TCCCTGGTGAGAGCTGCCAGCGG + Intergenic
1184111459 22:42398006-42398028 TCCCCGCACAGACCCCCCAGGGG + Intronic
1184344477 22:43904621-43904643 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1184351674 22:43948196-43948218 TGCCTGGACAGGGCCATCAGAGG - Intronic
1184673916 22:46029964-46029986 TCCCTGTTTAGAGCCTGCAGTGG - Intergenic
1184784041 22:46663219-46663241 TCCCTGGGCTGAGGCTGCAGCGG + Intronic
1184798899 22:46748303-46748325 TCACTGGACACAGCCCCCAGAGG + Intergenic
1184895252 22:47402931-47402953 GCCCTGGCCACAGCCTTCAGTGG + Intergenic
1184988501 22:48152507-48152529 TCGCTGGACAGAGCCTAGTGTGG - Intergenic
1185046332 22:48530453-48530475 TCCCTGGCCAGAGTATCCAGTGG - Intronic
1185285000 22:49996180-49996202 TCCCTGGAAAGGGTCTCCAGAGG + Exonic
1185336592 22:50273495-50273517 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1203219179 22_KI270731v1_random:28697-28719 GCCCTGCACAGAGGCTCCTGAGG - Intergenic
1203271646 22_KI270734v1_random:58130-58152 GCCCTGCACAGAGGCTCCTGAGG + Intergenic
949844780 3:8358253-8358275 TTGGTGGATAGAGCCTCCAGAGG - Intergenic
949984866 3:9532789-9532811 TCCTTGAACAGACTCTCCAGAGG + Intronic
950045472 3:9946444-9946466 TCCCTCGACAGCTTCTCCAGGGG - Exonic
951197060 3:19836163-19836185 TTTCTGGACAGAGCCTCCAGGGG + Intergenic
951283408 3:20779977-20779999 TTTCTGGACAGAGCCTCCAGGGG + Intergenic
952202294 3:31143037-31143059 GCCCAGGACACAGCCTCAAGAGG - Intergenic
952548602 3:34450218-34450240 TCCCTATACAGAGTTTCCAGAGG - Intergenic
952607943 3:35172572-35172594 TACCTGGATAGAGCATCCTGTGG - Intergenic
953053011 3:39362621-39362643 CCCGGGGACAGAGCTTCCAGAGG + Intergenic
953294109 3:41695961-41695983 TACCCGGACAGGGCCACCAGAGG + Intronic
953817414 3:46170666-46170688 TCCCTGGACACAGTCTCCCCAGG + Intronic
954486772 3:50860321-50860343 TCCCTAAGCAGAGCCTCCAGGGG - Intronic
954498657 3:50988900-50988922 TCCCTGGACAGAGCCTCCAGGGG + Intronic
954974074 3:54676411-54676433 TACCTAGTCAGAGCCTACAGAGG - Intronic
956967031 3:74473955-74473977 TCCCTGGACAAAACCTCCAATGG - Intronic
957090316 3:75723673-75723695 TGCCCGGACACAGCCACCAGAGG + Intronic
959452159 3:106517440-106517462 TCCCTGGACAGAGCCCCCATGGG + Intergenic
960157191 3:114307983-114308005 TGCCTGGACACAGCTTCCTGGGG - Exonic
960342925 3:116497265-116497287 TCCCTGGACAGAGACTCCAGGGG + Intronic
960685269 3:120288328-120288350 TTCCAGGACAGTGCCTCCAGGGG + Intergenic
961310671 3:125997350-125997372 TCCCTGGACGAAGCTGCCAGAGG + Intergenic
961928505 3:130508962-130508984 TGCCTGCACACAGCCTCAAGAGG + Intergenic
962600903 3:136990216-136990238 TGCTTGGACAGAGGCTCCACAGG - Intronic
962987500 3:140548815-140548837 TCCCTTGCCTGAGCCTTCAGTGG - Intronic
962987657 3:140550228-140550250 TCCCTTGCCTGAGCCTTCAGTGG - Intronic
963509597 3:146230472-146230494 TCCCTGGAAAGTGGCTCAAGGGG + Intronic
963538916 3:146562252-146562274 CCCCTGCACAGAGCCCCCACTGG - Intergenic
963880383 3:150521806-150521828 TCCCTGGACTGGGCATACAGAGG + Intergenic
964183417 3:153914057-153914079 CCCTGGGACAGAGCTTCCAGAGG - Intergenic
964486538 3:157190971-157190993 GCCCCTGACACAGCCTCCAGAGG - Intergenic
966000533 3:174943900-174943922 TCCCTGGGCAGAGCCTCCAGGGG - Intronic
966361768 3:179137499-179137521 CCCTGGGACAGAGCCCCCAGAGG + Intergenic
968350870 3:198050956-198050978 TGCCCGGACAGGGCCACCAGAGG + Intergenic
968437089 4:599279-599301 CCCGAGGACAGAGCTTCCAGAGG - Intergenic
968635470 4:1676218-1676240 TCCCTCCCCAGAGCCTTCAGAGG - Intronic
968713371 4:2137030-2137052 CCTCTGGACACAGCCTCCCGGGG + Intronic
968720280 4:2197481-2197503 TCCCTGGACCCTGCCTCCTGTGG - Intronic
969303558 4:6311635-6311657 TCCATGGACAGAGCAGCCCGAGG - Intergenic
971106009 4:23524774-23524796 TCCGTGGACAGAGCCTCCAGGGG + Intergenic
971605314 4:28651257-28651279 TCCTTGGATCGAGCATCCAGGGG - Intergenic
971727186 4:30328502-30328524 TCCTGTGACAGAGCTTCCAGGGG - Intergenic
973227803 4:47805619-47805641 TTCTTGGAAAGATCCTCCAGTGG + Intronic
974249187 4:59362692-59362714 TCCTTGGACAGAGCTCCTAGAGG - Intergenic
975022117 4:69502694-69502716 TCCCTGGACAGAGCCTCCAGGGG + Intronic
976954667 4:90880589-90880611 TCCCTGGACAGAGCCTCCAAGGG - Intronic
977006272 4:91572030-91572052 TCCCTGAACAGAGCCTTAACGGG - Intronic
977394112 4:96450549-96450571 TCCCTGGACAGAGCCCCCAGAGG - Intergenic
977610127 4:99022309-99022331 TCCCTGGTCAGGGACTCCTGAGG - Intronic
977649533 4:99454067-99454089 TCCCTGAACAGAGTCTCCAGGGG - Intergenic
977819848 4:101458701-101458723 ACCCTGGACAGAGCCTCCAGGGG + Intronic
978043042 4:104092967-104092989 TCCCTGGACAGAGCCTCTAGGGG + Intergenic
978208237 4:106105030-106105052 TCCCTGCCCAGAGCCTACAGGGG + Intronic
978238342 4:106487415-106487437 TCCCTAGACAGAGCCCCCAGGGG - Intergenic
978416988 4:108487083-108487105 GCCCTAGATAGAGCCTACAGTGG - Intergenic
978683733 4:111414835-111414857 TGCCTGGACAGAACCTCTAGGGG - Intergenic
979013105 4:115396232-115396254 TCCCTAGACAGAGCCCCCAGGGG - Intergenic
979045037 4:115852095-115852117 TCCCAGGACAGAGCCCCTAGAGG + Intergenic
979179580 4:117708145-117708167 CCCTGGGACAGAGCTTCCAGAGG + Intergenic
980331325 4:131415003-131415025 TCCTGGGACAGAGCTGCCAGAGG + Intergenic
980331371 4:131415268-131415290 TCCCTGGACAGACCCTCCAGGGG + Intergenic
982646206 4:158027389-158027411 TCCCTGGACAGAGCCTCCAGGGG + Intergenic
983047435 4:163004331-163004353 CCCTTGGACAGAGCACCCAGGGG - Intergenic
985091061 4:186363188-186363210 TGCCTGGACAGGGCCACCAGAGG + Intergenic
985578227 5:683552-683574 TTCCTGGGCAGTGTCTCCAGGGG - Intronic
985613351 5:903274-903296 TGCCTGGACAGGGCCACCAGAGG - Intronic
986197298 5:5549744-5549766 TCCCTGAACAGGGCCTGCAGGGG + Intergenic
986276519 5:6279837-6279859 TCCACAGACAGAGCCTGCAGAGG + Intergenic
986719777 5:10552816-10552838 ACCCTGGATAGTGCCTCCTGGGG - Intergenic
987030488 5:13972431-13972453 TCCTTGGAGAGAGCTGCCAGTGG - Intergenic
987431932 5:17845227-17845249 TCCCTGGACAGAGCCTCCAGAGG - Intergenic
987674828 5:21061935-21061957 TCCTTGGGCAGAGCCTCCAAGGG - Intergenic
987887586 5:23831462-23831484 TCACCGGACATAGCCTCCAGGGG + Intergenic
988128490 5:27073623-27073645 AACCTGGACAGAGCCTTCAGGGG + Intronic
988936011 5:36083457-36083479 TCTCTGGACAGAGCCTCCAGGGG + Intergenic
989370320 5:40700335-40700357 TCCCTGGACAGAGCCTCCAGCGG + Intergenic
990378469 5:55197031-55197053 TCCCTGGTCTCAGCCTCCTGAGG - Intergenic
990491827 5:56310296-56310318 TCCCAGGACACAGCAACCAGTGG - Intergenic
990500312 5:56389980-56390002 TCCCTGGATAGCACCTCCAGGGG + Intergenic
991143451 5:63273746-63273768 TCCCTGGACAGAGTTCCCAGAGG - Intergenic
993351269 5:86853271-86853293 TCCCTGGACAGAGCCCCCAGGGG - Intergenic
993450840 5:88070484-88070506 TCCCTGAACAGAGCCCCCAGGGG + Intergenic
993494064 5:88587294-88587316 CCCTGGGACAGAGCTTCCAGAGG + Intergenic
993704414 5:91153315-91153337 CCCCTGGCCATATCCTCCAGAGG - Exonic
994242760 5:97444147-97444169 TCCCTGAACAGAGCCTTCAGGGG - Intergenic
994346767 5:98696721-98696743 TCCCAGGACAGAGTTCCCAGAGG - Intergenic
994446389 5:99879631-99879653 CCCTTGGACAGAGCTCCCAGAGG + Intergenic
994516115 5:100774929-100774951 TGCCCGGACAGGGCCACCAGAGG + Intergenic
994804355 5:104424648-104424670 TCCCTGAGCAGAGCATCCTGGGG + Intergenic
994897300 5:105722118-105722140 TCCCTGGGCAGAGCCTCCAGCGG + Intergenic
995187824 5:109290225-109290247 TCCCTGGACAGAGCCTCCAGGGG + Intergenic
995428666 5:112050549-112050571 TCCCTGTACAGAGCCTCCAGGGG + Intergenic
995578962 5:113574331-113574353 CCCCAGGACAGAACTTCCAGAGG - Intronic
996325284 5:122266741-122266763 GCTCTGGACAGAGCAGCCAGTGG + Intergenic
996327080 5:122286957-122286979 TCCCTGGAAAGGGCAGCCAGTGG - Intergenic
997205037 5:132043242-132043264 TCCTGGGACAGAGCCCCCAGAGG - Intergenic
997824352 5:137092913-137092935 ACCCTAGACAGAGCCCCCACCGG - Intronic
997972018 5:138411207-138411229 TGCCCGGACAGGGCCACCAGAGG - Intronic
998107217 5:139476228-139476250 CACCAGGCCAGAGCCTCCAGTGG - Exonic
998325727 5:141278314-141278336 AAGCTGGACAGAGCTTCCAGTGG + Intergenic
998539372 5:142965470-142965492 TGCCCGGACAGGGCCACCAGAGG - Intronic
999052168 5:148534511-148534533 TCCCGGGACAGAGACTCCAGGGG + Intronic
999074515 5:148781505-148781527 TCCCTGGAAAGAGCCTCCATAGG + Intergenic
999847388 5:155499413-155499435 TCCCACAACAGAGCCTCCAGGGG - Intergenic
1001679760 5:173547488-173547510 TCCCTGGTCAGACCCTGCACTGG - Intergenic
1002108412 5:176891707-176891729 TTCCAGGACAGAGCCTTCTGAGG - Intronic
1002158054 5:177298329-177298351 TCCCTGGAAAAGGCCTCCTGGGG - Exonic
1002205737 5:177561423-177561445 TGCCTGGACAGGGCCACCAGAGG + Intergenic
1002313283 5:178327694-178327716 CCCCTGGACAGAGGGTGCAGAGG - Intronic
1002414815 5:179114490-179114512 TCCCTGGACACTGCCTGCACTGG - Intronic
1004321307 6:14633685-14633707 TCCCTGGGCTCAGCCTCCTGTGG + Intergenic
1005319231 6:24635753-24635775 TTCCTCCCCAGAGCCTCCAGAGG + Intronic
1005922119 6:30411594-30411616 TGCCTGGACAGGGCCACTAGAGG + Intergenic
1005922606 6:30415569-30415591 TCCCAGGACAGAGCTGGCAGGGG - Intergenic
1007688268 6:43680416-43680438 TCACTGCACAGAGCTCCCAGAGG - Intronic
1007701729 6:43769950-43769972 TCTCTGGACAGAGTTTCCGGGGG + Intergenic
1007858178 6:44879455-44879477 TCCTGGGACAGAGCATCTAGGGG + Intronic
1008211349 6:48729034-48729056 TCCCTGGGCAAAGCTCCCAGAGG + Intergenic
1008211443 6:48729571-48729593 TCCCCGGACGGAACCCCCAGGGG + Intergenic
1008864028 6:56188515-56188537 TCCCTGGACAGAGCACCTGGGGG + Intronic
1008973901 6:57401976-57401998 TCCCTGGACAGAGCAACCAGGGG - Intronic
1009162791 6:60303481-60303503 TCCCTTGACTGAGCAACCAGGGG - Intergenic
1009325733 6:62345925-62345947 TCCCCAGACAGAGCTCCCAGAGG + Intergenic
1009596644 6:65745261-65745283 TCCCTGGGCAGAGCTCCCAGAGG + Intergenic
1009596689 6:65745526-65745548 TCCCTGGGCAGAGCCTCCCAGGG + Intergenic
1009888868 6:69656408-69656430 TCCATGGACAGAGCCTCCAGGGG + Intergenic
1010141491 6:72620127-72620149 TCCCTGCACAGAAACTCCATAGG + Intergenic
1011627299 6:89293859-89293881 GCCCTGGTTAGAACCTCCAGGGG - Intronic
1011638331 6:89396533-89396555 CTCCTGGACTCAGCCTCCAGAGG + Intronic
1012052503 6:94362188-94362210 TCTCTGCACAGGGCCTCCCGGGG - Intergenic
1012342368 6:98142988-98143010 CCCCTGCACAGAGTCCCCAGTGG - Intergenic
1012616417 6:101284071-101284093 TACCTGGACAGAACTTCTAGGGG - Intergenic
1012869494 6:104656821-104656843 CCCTGGGACAGAGCTTCCAGAGG + Intergenic
1012878101 6:104753513-104753535 CCCTGGGACAGAGCTTCCAGAGG + Intronic
1014089510 6:117387798-117387820 CCCCTGGTCAGAGCCCTCAGTGG - Exonic
1015197284 6:130537325-130537347 TCCCTGGACAGGGCCTCCAGGGG + Intergenic
1015494371 6:133865306-133865328 TATCTGGACAGAGCCTCCAGGGG - Intergenic
1015685107 6:135850675-135850697 TCCCACGACAGAGCCACAAGGGG - Intergenic
1017344926 6:153369638-153369660 CCCTGGGACAGAGCTTCCAGAGG + Intergenic
1018933215 6:168255867-168255889 TGCCTGGACAGCAGCTCCAGGGG - Intergenic
1019482149 7:1271887-1271909 TCCCGGGCCAGAGCCACCTGGGG - Intergenic
1020258487 7:6516488-6516510 TGCCTGGACAGGGCCACTAGAGG + Intronic
1020702332 7:11499013-11499035 TCCTTTGACAGAGCCTCCAGGGG + Intronic
1021916951 7:25443709-25443731 TCCTGGGACAGAGCTTCCAGAGG - Intergenic
1022482328 7:30752325-30752347 TCCTTGGAGAGAGGCTCAAGGGG - Intronic
1022705725 7:32800620-32800642 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1023074266 7:36467613-36467635 TGCCTGGACAGGGCCACCAAAGG + Intergenic
1023827667 7:44020350-44020372 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1023863907 7:44229813-44229835 CCCCTGGCCAGAGCCAGCAGAGG + Intronic
1025153126 7:56576073-56576095 TCCCTTGCCACAGACTCCAGTGG - Intergenic
1025756822 7:64352024-64352046 TCCCTGGACAGAGCCTCCAGGGG - Exonic
1025872418 7:65447303-65447325 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1027140053 7:75650411-75650433 TCCCTGGACTTGTCCTCCAGCGG - Intronic
1027627621 7:80564669-80564691 TCCCCAGACAGAGCCTTTAGAGG - Intronic
1028082877 7:86599811-86599833 CCCTGGGACAGAGCTTCCAGAGG + Intergenic
1028082920 7:86600065-86600087 TCCCTGGACAGAGCCTCAAGGGG + Intergenic
1028176956 7:87671333-87671355 TCCCTGGACAGGGCCTCTAGGGG - Intronic
1028177050 7:87671861-87671883 TCCCAGGACAGTGCTCCCAGGGG - Intronic
1029104727 7:98165892-98165914 TCCCTGACCAGAGCCAGCAGAGG + Intronic
1029277496 7:99415717-99415739 TGCCCGGACAGGGCCACCAGAGG - Intronic
1029345034 7:99972137-99972159 TCACTTGAGTGAGCCTCCAGTGG - Intronic
1029738843 7:102480118-102480140 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1029755969 7:102573774-102573796 TGCCCGGACAGGGCCACCAGAGG + Intronic
1029773910 7:102672846-102672868 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1030079965 7:105768965-105768987 TCCATGGATAGAGACCCCAGGGG - Intronic
1030234351 7:107242526-107242548 TCCAAGAGCAGAGCCTCCAGTGG + Intronic
1030375110 7:108745348-108745370 TCCCTGGACAGAGCTCCCAGTGG - Intergenic
1030809401 7:113956247-113956269 TCCCTGGAAAGAGCCTCCAGAGG - Intronic
1031498995 7:122488300-122488322 TCCCTGGACTGTGCCTGCATTGG - Intronic
1031627130 7:124004518-124004540 TCCCTGGACAGAGCATCCAAGGG - Intergenic
1032192515 7:129772921-129772943 ACCCTGGCCAGACACTCCAGAGG + Intergenic
1033532075 7:142274455-142274477 TCCCTGGACTGAGCCTCCAGGGG - Intergenic
1033785629 7:144727004-144727026 TGCCCGGACAGGGCCACCAGAGG + Intronic
1034364356 7:150533725-150533747 TCCCTGGACAGAGCCTTCCAGGG - Intergenic
1034680845 7:152926044-152926066 TACCCGGCCAGAGCGTCCAGCGG + Intergenic
1035293400 7:157854197-157854219 TCCCTGGACAGGGCCTACATTGG + Intronic
1035844915 8:2852812-2852834 CAACTGGACAGAGCCCCCAGAGG + Intergenic
1036553825 8:9839204-9839226 TCCCTGGACAGAGCACCTGGGGG + Intergenic
1036766114 8:11550303-11550325 TCCCGGGAAGGCGCCTCCAGAGG + Intronic
1036847588 8:12180386-12180408 TCTCTGGACACATCCTCCAGTGG + Intergenic
1036868957 8:12422701-12422723 TCTCTGGACACATCCTCCAGTGG + Intergenic
1037198712 8:16223724-16223746 TCCTGGGACAGAGCTTCTAGAGG - Intronic
1037388228 8:18365442-18365464 TCCTGGGACAGAGCTCCCAGAGG + Intergenic
1037787562 8:21911851-21911873 ACCCTGGGGAGAGCCCCCAGGGG + Intronic
1038233569 8:25729152-25729174 TCCCTGGACAGAGCCTCTACGGG - Intergenic
1039284642 8:36027125-36027147 CCTCTGGACAAAGCTTCCAGAGG + Intergenic
1040372292 8:46788748-46788770 TCCCTGGACAGAGCCTCTAGGGG - Intergenic
1040380565 8:46868099-46868121 TCCCTGGACAGAGCTTCCAGGGG + Intergenic
1040629956 8:49198870-49198892 TGCCTGGACAGAGCCCTGAGAGG - Intergenic
1042525231 8:69757811-69757833 TTCGTGGAGAGAGGCTCCAGAGG - Intronic
1042619927 8:70693914-70693936 TCCATAGACAGAGCCTCTGGGGG - Intronic
1042995440 8:74693320-74693342 TCCTTGGAGAGAGCTGCCAGTGG + Intronic
1043280917 8:78465493-78465515 CCCCTGGACAGAGCCTCCAGGGG + Intergenic
1044085400 8:87936765-87936787 TCCATGGGCACAGACTCCAGAGG + Intergenic
1044562038 8:93621940-93621962 TCCTTTGCCAGAGCCTACAGAGG - Intergenic
1046067449 8:109213684-109213706 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1048050280 8:130809854-130809876 TCCCTGGCCACAGCAGCCAGGGG - Intronic
1048387149 8:133922183-133922205 TCACTGGATAGTGCCTCCAGAGG - Intergenic
1048879087 8:138858549-138858571 TCCATGGTCAGAATCTCCAGGGG - Intronic
1049242164 8:141543593-141543615 CCGCTGGACAGAGGCCCCAGGGG - Intergenic
1049346934 8:142144126-142144148 TCCCTGGCCACAGCCTCCACAGG - Intergenic
1049458788 8:142710473-142710495 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1049516282 8:143058833-143058855 TGCCCGGACAGGGCCACCAGAGG - Intronic
1049655521 8:143795301-143795323 TGCCTGGACAGACCCTGCACTGG - Exonic
1049879994 8:145055412-145055434 TGCCCGGACAGGGCCACCAGAGG + Exonic
1050240131 9:3626184-3626206 TCCCAGGATGGAGCTTCCAGAGG - Intergenic
1050391399 9:5147442-5147464 TCCCTGGACAGAGCCTCCAGGGG - Intronic
1051601433 9:18878385-18878407 TCCTTGGAGAGAGCTGCCAGTGG - Intronic
1052378201 9:27741584-27741606 TCCCTGGACAGAGCCTCCAGAGG - Intergenic
1052718681 9:32148707-32148729 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1052766997 9:32651165-32651187 TCCCTGGGCAGAGCCCACAGGGG + Intergenic
1055132708 9:72793895-72793917 TCCCTGGACAGGATCCCCAGGGG + Intronic
1055208678 9:73763115-73763137 TCCCTGGACAGAGCCTCAGAGGG + Intergenic
1055476205 9:76666124-76666146 TGCCCGGACAGGGCCACCAGAGG + Intronic
1055894850 9:81162931-81162953 TCCCTGGACAGAGCACCTGGGGG + Intergenic
1056127870 9:83554720-83554742 TCCTTGGACACAGCCTCCGGAGG - Intergenic
1057134716 9:92679785-92679807 TCCCTGGACAGAGCCTCTATAGG + Intergenic
1057183027 9:93040039-93040061 TCCCTGGAGGGATCGTCCAGAGG - Intergenic
1057770845 9:97966631-97966653 TGACTTGACAGAGCCTGCAGAGG + Intergenic
1058461671 9:105189465-105189487 TCCCTGGACAGAACCCTCAGGGG - Intergenic
1059509915 9:114835799-114835821 CCCTGGGACAGAGCTTCCAGAGG - Intergenic
1060198896 9:121640456-121640478 TCCCGGGACAGAGGCTGCAGGGG + Intronic
1061048713 9:128181620-128181642 TGCCTGGGCAGGGCCACCAGAGG + Intronic
1061273842 9:129558405-129558427 TCCCTGGGGACTGCCTCCAGTGG - Intergenic
1061552773 9:131347603-131347625 TCCCATGACAGGGACTCCAGAGG - Intergenic
1061835915 9:133329530-133329552 TGCCCGGACAGGGCCACCAGAGG - Intergenic
1061944069 9:133898760-133898782 CCCCTGGTCAGAGCCACCACAGG + Intronic
1061944539 9:133901450-133901472 CCCCTGGTCAGAGCCACCACAGG - Intronic
1062360677 9:136186547-136186569 GCCCTGGACCGAGCCCCCCGAGG + Intergenic
1062531722 9:137004433-137004455 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1062557167 9:137118840-137118862 TGCCAGGACAGGGCCACCAGAGG + Intergenic
1062588519 9:137262384-137262406 TGCCTGGACAGGGCCACCAGAGG - Intronic
1062639317 9:137510049-137510071 TGCCTGGACAGGGCCACCAGAGG + Intronic
1062645451 9:137545786-137545808 TGCCCGGACAGGGCCACCAGAGG + Intronic
1062647929 9:137559266-137559288 TGCCTGGACAGGGCCACCAGAGG + Intronic
1062698798 9:137888642-137888664 TCCCTGGACCCGGCCTCCTGTGG + Intronic
1203488151 Un_GL000224v1:77633-77655 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1203500772 Un_KI270741v1:19529-19551 TGCCCGGACAGGGCCACCAGAGG + Intergenic
1187142466 X:16607047-16607069 TCTCTGGGTAGAGCTTCCAGCGG - Intronic
1187729615 X:22239004-22239026 TCTGTGGACAAAGCTTCCAGAGG + Intronic
1188212570 X:27442592-27442614 TGCCTGGACAGGGCCACCAGAGG - Intergenic
1188715007 X:33449585-33449607 TTCCTGGACACAGCCCCCAGGGG + Intergenic
1188869698 X:35359078-35359100 CCACTGGACAGAGACCCCAGGGG - Intergenic
1189276982 X:39793875-39793897 CCCCAGGACTGACCCTCCAGGGG + Intergenic
1189581629 X:42413462-42413484 TCCCAGGACGGAGCTTCCAGAGG - Intergenic
1189854950 X:45214648-45214670 TCCTGGGACAGAGCTCCCAGAGG + Intergenic
1189855049 X:45215217-45215239 TCCTGGGACAGAGCTCCCAGAGG + Intergenic
1190803281 X:53812801-53812823 TCCTGGGACAGAGCTTTCAGAGG - Intergenic
1191155245 X:57266476-57266498 TCTCTGGACGGAGCCGCCAGGGG + Intergenic
1191223579 X:58016572-58016594 TCTTTGGACAGAGCTTCCATGGG + Intergenic
1191738909 X:64416857-64416879 TTCCTGGACAGAGTCTCCAGGGG - Intergenic
1191740022 X:64426466-64426488 GCCCTTGACAAAGCCTCCAAAGG - Intergenic
1191962573 X:66719386-66719408 TTCTGGGACAAAGCCTCCAGAGG + Intergenic
1191988865 X:67010490-67010512 TCCCTGGACAAAGCCTCCAGGGG + Intergenic
1192055484 X:67769180-67769202 TCCTTGGACAGAGCTCCCAGTGG + Intergenic
1192254344 X:69443050-69443072 TCCCAGGACAGAGCCCCCAGGGG - Intergenic
1192277400 X:69648065-69648087 CCCTGGGACAGAGCTTCCAGAGG - Intronic
1192840289 X:74848490-74848512 TGCCTTTGCAGAGCCTCCAGAGG - Intronic
1192891905 X:75399251-75399273 TCCCTGGACAGAGCCTCCAGGGG + Intronic
1192926412 X:75759281-75759303 TCCCTGGACAGAGTTTCCAGGGG + Intergenic
1193052104 X:77112200-77112222 TCCCTGGACAAAACTCCCAGAGG + Intergenic
1193061712 X:77214455-77214477 TCCCTGGACAGAGCCTCCAGGGG - Intergenic
1193290105 X:79762568-79762590 TTCATGGACAGAGAATCCAGGGG - Intergenic
1193295742 X:79829619-79829641 TCCCTGGACAGAGCCTCTCAAGG - Intergenic
1193478425 X:81996368-81996390 CCCTGGGACAGAGCCACCAGAGG + Intergenic
1193739672 X:85202919-85202941 TCTCTGGACAGAGGCCCCAGGGG - Intergenic
1193789128 X:85797341-85797363 CCCCTGGACAGAGCTTCCAGGGG - Intergenic
1193858937 X:86640229-86640251 TCCCTGGACAGAGCCTCCAAAGG + Intronic
1193985604 X:88237443-88237465 TCCCTGGACAGAGCCTCCAAGGG - Intergenic
1194055600 X:89127857-89127879 TCCCTGGTCAGAGCTTCCAGGGG - Intergenic
1194247922 X:91537981-91538003 TCCCTGGACAGAGCCTCCAGGGG + Intergenic
1194520203 X:94909299-94909321 CCCTGGGACAGAGCTTCCAGCGG + Intergenic
1194539771 X:95156248-95156270 TCCCAGGACAGAGCTTCCACAGG + Intergenic
1194623109 X:96197051-96197073 TCCTGGGACAGAGCTTCCAGAGG + Intergenic
1194854681 X:98914830-98914852 TACCTGGACAGAGCCTCCAGGGG - Intergenic
1194917523 X:99723375-99723397 TCCCTGGACAGAGCCTCCAGGGG + Intergenic
1195148704 X:102043907-102043929 TCCCTGGACACAGCTCCCACTGG + Intergenic
1195310855 X:103630121-103630143 TTCCTGGAAAGACCCTCCTGCGG - Exonic
1195361173 X:104085051-104085073 TTCCTGGACAGAGTCCCCAGGGG - Intergenic
1196152652 X:112392183-112392205 TCCCTGGACAGAGCCCCCAGGGG - Intergenic
1196227938 X:113188651-113188673 TCCCTGGACAGAGCCTCCGGGGG - Intergenic
1196228078 X:113189459-113189481 CCCTGGGACAGAGGCTCCAGAGG - Intergenic
1196528818 X:116759379-116759401 CCCTGGGACAGAGCTTCCAGAGG + Intergenic
1196528854 X:116759619-116759641 TCCCTGAACAAAGACCCCAGGGG + Intergenic
1196558986 X:117123449-117123471 TTCTGGGACAAAGCCTCCAGAGG + Intergenic
1196582359 X:117392741-117392763 TCCCTGGAAAGAGCATCTAGAGG + Intergenic
1196932626 X:120696434-120696456 TCCCTGTGCAGATCCTCCAGGGG + Intergenic
1197402246 X:126006312-126006334 TCCCTGGACAGAGCTCCCAGTGG + Intergenic
1198272299 X:135066362-135066384 TGCCTGGACAGGGCCACTAGAGG + Intergenic
1198687165 X:139238624-139238646 CCCCGGCACAGAGCTTCCAGAGG + Intergenic
1199249031 X:145638182-145638204 TCCCCAGACAGAGCCTCCAGGGG + Intergenic
1199307011 X:146279087-146279109 TCTCTGGATAGAGCCCCTAGGGG - Intergenic
1200566938 Y:4779510-4779532 TCCCTGGACAGAGCCTCCAGGGG + Intergenic
1200847873 Y:7850442-7850464 TCCATGGACAGAGCTTCTGGGGG + Intergenic
1200858958 Y:7969634-7969656 TCCCTGGACACTGCCTACAAGGG - Intergenic
1200897004 Y:8386327-8386349 TGCCTGTACTGTGCCTCCAGAGG - Intergenic
1200899746 Y:8417444-8417466 TTCCTGGACAGAGCCTATAGGGG + Intergenic
1200905719 Y:8480092-8480114 TCCCTGGAGAGAGCCTCCAATGG - Intergenic
1202269190 Y:23053948-23053970 TCCATGGACACAGCTTCCAGGGG - Intergenic
1202422182 Y:24687688-24687710 TCCATGGACACAGCTTCCAGGGG - Intergenic
1202448604 Y:24982390-24982412 TCCATGGACACAGCTTCCAGGGG + Intergenic