ID: 934623219

View in Genome Browser
Species Human (GRCh38)
Location 2:95829069-95829091
Sequence CTCCCTGGACAGAGCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 21, 1: 37, 2: 45, 3: 69, 4: 356}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934623219_934623231 28 Left 934623219 2:95829069-95829091 CCCTGGAGGCTCTGTCCAGGGAG 0: 21
1: 37
2: 45
3: 69
4: 356
Right 934623231 2:95829120-95829142 CTGGCAGGGGGGTTAGGTAGAGG No data
934623219_934623227 15 Left 934623219 2:95829069-95829091 CCCTGGAGGCTCTGTCCAGGGAG 0: 21
1: 37
2: 45
3: 69
4: 356
Right 934623227 2:95829107-95829129 TGGCTCGACAGCTCTGGCAGGGG No data
934623219_934623228 16 Left 934623219 2:95829069-95829091 CCCTGGAGGCTCTGTCCAGGGAG 0: 21
1: 37
2: 45
3: 69
4: 356
Right 934623228 2:95829108-95829130 GGCTCGACAGCTCTGGCAGGGGG No data
934623219_934623229 17 Left 934623219 2:95829069-95829091 CCCTGGAGGCTCTGTCCAGGGAG 0: 21
1: 37
2: 45
3: 69
4: 356
Right 934623229 2:95829109-95829131 GCTCGACAGCTCTGGCAGGGGGG No data
934623219_934623224 9 Left 934623219 2:95829069-95829091 CCCTGGAGGCTCTGTCCAGGGAG 0: 21
1: 37
2: 45
3: 69
4: 356
Right 934623224 2:95829101-95829123 TGCTACTGGCTCGACAGCTCTGG No data
934623219_934623225 13 Left 934623219 2:95829069-95829091 CCCTGGAGGCTCTGTCCAGGGAG 0: 21
1: 37
2: 45
3: 69
4: 356
Right 934623225 2:95829105-95829127 ACTGGCTCGACAGCTCTGGCAGG No data
934623219_934623230 22 Left 934623219 2:95829069-95829091 CCCTGGAGGCTCTGTCCAGGGAG 0: 21
1: 37
2: 45
3: 69
4: 356
Right 934623230 2:95829114-95829136 ACAGCTCTGGCAGGGGGGTTAGG No data
934623219_934623223 -5 Left 934623219 2:95829069-95829091 CCCTGGAGGCTCTGTCCAGGGAG 0: 21
1: 37
2: 45
3: 69
4: 356
Right 934623223 2:95829087-95829109 GGGAGTGGCTGAGTTGCTACTGG No data
934623219_934623226 14 Left 934623219 2:95829069-95829091 CCCTGGAGGCTCTGTCCAGGGAG 0: 21
1: 37
2: 45
3: 69
4: 356
Right 934623226 2:95829106-95829128 CTGGCTCGACAGCTCTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934623219 Original CRISPR CTCCCTGGACAGAGCCTCCA GGG (reversed) Intergenic
900393023 1:2441985-2442007 CACCCGGCACAGAGTCTCCAGGG + Intronic
900754873 1:4426390-4426412 GACCCTGGACAGAGCAGCCAGGG - Intergenic
901161411 1:7178937-7178959 CATCCTGGACAGCTCCTCCACGG - Intronic
901688217 1:10956352-10956374 CAGCCTGGTCAGACCCTCCAGGG - Intronic
901712723 1:11128316-11128338 CTGGCTGGACAGACCCTCCTGGG + Intronic
901954553 1:12774947-12774969 CTCCCTGGGCAGCTCCTCCAGGG - Exonic
901956955 1:12793307-12793329 CACCCTGGGCAGCTCCTCCATGG - Exonic
901962895 1:12841256-12841278 CTCCCTGGGCAGCTCATCCAGGG + Intergenic
901964961 1:12859089-12859111 CACCCTGGGCAGCTCCTCCATGG - Exonic
901969465 1:12895746-12895768 CTCCCTGGGCAGCTCATCCAGGG + Exonic
901972280 1:12917772-12917794 CTCCCTGGGCAGCTCCTCCATGG - Exonic
901980350 1:13029443-13029465 CACCCTGGGCAGCTCCTCCATGG - Intronic
901989087 1:13097870-13097892 CTCCCTGGGCAGCTCCTCCAGGG + Intergenic
901992726 1:13128897-13128919 CTCCCTGGGCAGCTCCTCCAGGG - Intergenic
902001737 1:13199488-13199510 CACCCTGGGCAGCTCCTCCATGG + Intergenic
902012899 1:13283990-13284012 CTCCCTGGGCAGCTCCTCCATGG + Exonic
902015707 1:13306034-13306056 CTCCCTGGGCAGCTCATCCAGGG - Intronic
902020965 1:13345213-13345235 CACCCTGGGCAGCTCCTCCATGG + Exonic
902089673 1:13893199-13893221 CTCCCTGGACTGAGACGCCGCGG + Intergenic
902295544 1:15464357-15464379 CTCCTTTGACATAGACTCCAAGG + Intronic
902868475 1:19296962-19296984 CTCCCTGTCCACAGGCTCCATGG - Intergenic
903361078 1:22777668-22777690 CTCCGTGGCTACAGCCTCCATGG - Intronic
903986986 1:27235201-27235223 CTCCCTCCGCAGAGCCTCCCCGG - Intronic
905176255 1:36137353-36137375 CTGCCTGGCCACAGCCTCTAGGG + Intronic
905848721 1:41257418-41257440 CTCCCTGCACAGAGCCTCCAGGG - Intergenic
906248007 1:44290575-44290597 CTATCTAGTCAGAGCCTCCATGG + Intronic
906495844 1:46303236-46303258 CTCCCGGGACGTGGCCTCCATGG + Exonic
906715364 1:47964867-47964889 CTTCCTGGGCAGGGCTTCCAAGG - Intronic
907623968 1:56010527-56010549 CTCCATTGACAGAGCCCCTAGGG + Intergenic
907714885 1:56917295-56917317 CTCCCTGGACAGAGCCCCCAGGG + Intronic
908282833 1:62560303-62560325 CTCCCTGTACATATTCTCCATGG + Intronic
909051517 1:70773872-70773894 CTCCCTGGACAGAGCCTCCAGGG - Intergenic
910257339 1:85260743-85260765 CTCCCTGGAAGTAGGCTCCAGGG + Intergenic
911023144 1:93408667-93408689 CTCCAGGGCCAGAGCCTGCATGG + Intergenic
911794478 1:102058792-102058814 CTCACTGGGCAGGACCTCCAAGG + Intergenic
912100083 1:106193152-106193174 CTCCCAGTACAGAGCCACCAGGG + Intergenic
912430463 1:109625882-109625904 CTCCCTGTGCAGACCCCCCAAGG - Intronic
913410188 1:118542563-118542585 CTCCTTGGATGGAGCCTCCAGGG + Intergenic
914414603 1:147468524-147468546 CTCCCTGGACAGAGCCTCCAGGG - Intergenic
914456391 1:147841041-147841063 CTCCTTGGGCAGCTCCTCCAGGG - Intergenic
916140586 1:161693655-161693677 CTCCCTGGACAGAGCACCTGAGG + Intergenic
916344123 1:163769300-163769322 CTCCCTGGGCAGTGGCACCAAGG + Intergenic
916568912 1:166008251-166008273 CTCTCTGGACAGAGCTGCCAAGG - Intergenic
916818162 1:168373024-168373046 CTCCTGGGGCAGAGCCTCTAGGG + Intergenic
917259077 1:173148039-173148061 CTCCCTGGACAGAGCTTCCAGGG - Intergenic
919260755 1:195190762-195190784 CTCCCCGGACAGAGCCACCAGGG + Intergenic
919577987 1:199336414-199336436 CTCCCTGGACAGAGCCTCCAGGG - Intergenic
921012964 1:211161301-211161323 CTCCCTGAACAGAGTCTCCAGGG - Intergenic
921312261 1:213855967-213855989 CTGCCTGGGCAGAGGCTGCAGGG + Intergenic
921367977 1:214392778-214392800 CTGGCTTGAAAGAGCCTCCACGG + Intronic
922423723 1:225475627-225475649 CTCCCAGGACTGCCCCTCCATGG + Intergenic
922466413 1:225847975-225847997 CTCTCTGCACACAGCCTCCAGGG - Intronic
922473162 1:225888922-225888944 CACCCTGGACAGGGCCGACATGG - Exonic
924874966 1:248092867-248092889 ATCTTTGGTCAGAGCCTCCAAGG + Intronic
1062934564 10:1376417-1376439 CTGCCAGGACAGAGCCTGAAAGG + Intronic
1063656683 10:7997431-7997453 CCAGCTGCACAGAGCCTCCAGGG - Intronic
1064898229 10:20262922-20262944 CTCCCTGGACAGAGCCTCCAGGG + Intronic
1066455170 10:35566145-35566167 CTCCCTGCTCAGGGGCTCCAAGG - Exonic
1067189770 10:44059480-44059502 CTCCCTAGACAGTGCATCCTCGG + Intergenic
1067521873 10:47013879-47013901 TTCCCAGAACAGAGCTTCCAAGG - Intergenic
1067876991 10:50016223-50016245 TTTCCTGGATACAGCCTCCAGGG + Intergenic
1071293239 10:84202068-84202090 CTGCCTGGACATATTCTCCAGGG + Intronic
1073544086 10:104334628-104334650 CTCCTTGGCCAGTGCCTCAAGGG - Intronic
1073783770 10:106866135-106866157 CTTCCTGGACAGAGCCCCCAGGG + Intronic
1073875901 10:107920872-107920894 CTCCCTGAACAGAACCTCCAGGG + Intergenic
1075567065 10:123512526-123512548 CACCCGGGTCAGAGCCACCATGG - Intergenic
1075657860 10:124173855-124173877 TTCCCTGGAGGGAGGCTCCAGGG - Intergenic
1075893834 10:125977946-125977968 CTCCCCGAACAGAGCCTCCAGGG - Intronic
1075995381 10:126872629-126872651 CTACATGGATAGAGCCTCCTAGG + Intergenic
1076621083 10:131788607-131788629 CTCCAAAGACAGGGCCTCCACGG + Intergenic
1077264230 11:1641184-1641206 CTGGCTGGACAGAGACGCCAGGG - Intergenic
1079373382 11:19871031-19871053 TTCCATGCTCAGAGCCTCCAAGG - Intronic
1081008820 11:37781810-37781832 CCCCTTGGACAGAGGCTCCAGGG + Intergenic
1083008191 11:59368387-59368409 CTCCCTAGACAGAGCTTCCGAGG + Intergenic
1084586835 11:70067282-70067304 CTCGCTGGACAGCAGCTCCAAGG + Intergenic
1084659531 11:70538743-70538765 CCCCCGGGGCAGAGCCTCCAGGG + Intronic
1084696850 11:70760950-70760972 CTCCCTGAGCACATCCTCCAGGG - Intronic
1084787710 11:71453153-71453175 CTCCTTGGCCGGAGCCTCAACGG + Exonic
1084870825 11:72097610-72097632 ATCCCTGGCCAGAGCTTCAAAGG + Exonic
1085348175 11:75781431-75781453 CTCCCAGGCCACGGCCTCCATGG + Intronic
1085858991 11:80210357-80210379 CTCCCTGGACTGAAGCTACATGG + Intergenic
1086569138 11:88262946-88262968 CTCCCTGGTCAGATCCCCCAGGG - Intergenic
1087374713 11:97326560-97326582 CTCCCTGGACAGAGCCTCCAGGG - Intergenic
1087606505 11:100384236-100384258 CTCCCTGGACACTCCCTCCCAGG - Intergenic
1088747555 11:112817175-112817197 CTACCTGGACACAGCCCCAAAGG + Intergenic
1088893885 11:114063811-114063833 GTGGCTGGACAGAGCCTCCCTGG + Exonic
1089613142 11:119680843-119680865 CTCCCTGGGCAGAGGCCCCATGG + Intronic
1089617790 11:119704754-119704776 CTGCCCGGAGAGAGCCTCCCGGG - Intronic
1090212995 11:124935967-124935989 AGCCCTGTCCAGAGCCTCCAGGG - Exonic
1090856038 11:130609941-130609963 CTCCCTGGACAGAGTCCTCGGGG - Intergenic
1092058006 12:5523109-5523131 AACCCTGGACACAACCTCCAGGG + Intergenic
1095210773 12:39491990-39492012 CTCACTGGATAAAGCTTCCAGGG + Intergenic
1095835903 12:46638317-46638339 CTCCCTGGGCAGAGCTTCCAGGG + Intergenic
1095853086 12:46831620-46831642 CTCCCTTGAAAGAGACTCCTTGG + Intronic
1095870926 12:47027133-47027155 CTCCATAGACAGAGCAGCCAAGG - Intergenic
1096182680 12:49559277-49559299 CACCCTGGGCAGAGCAACCAAGG - Exonic
1098128470 12:67323526-67323548 TGACCTGAACAGAGCCTCCAGGG + Intergenic
1099015113 12:77335334-77335356 GTCCCTGTACAGAGTCCCCAGGG + Intergenic
1099253674 12:80289508-80289530 CTCCCTGGACAGAGCACCTGCGG - Intronic
1099719502 12:86342392-86342414 CTCCCTGGAAAGAGCCTCCAGGG + Intronic
1100135129 12:91544845-91544867 CCCCCTGGACAGAGCCTGCAGGG + Intergenic
1100941121 12:99723491-99723513 CTCCCTGGCCGGAGCCACTAGGG + Intronic
1101880677 12:108623513-108623535 TTCTGTGGACAGGGCCTCCATGG + Exonic
1102208193 12:111105057-111105079 GTCCCTGGACAGATCAGCCAAGG - Intronic
1103003628 12:117404975-117404997 CCTCCAGGACTGAGCCTCCAGGG - Intronic
1103520654 12:121535666-121535688 CTCCCCGGCCCCAGCCTCCAAGG - Intronic
1104786798 12:131455459-131455481 CTCCCTGTCCAGAGCAGCCATGG - Intergenic
1104820719 12:131675818-131675840 CACCGTGGACTCAGCCTCCATGG - Intergenic
1105330699 13:19412694-19412716 CTCCCAGGGCAGAGCCCACAAGG + Intergenic
1105918773 13:24941468-24941490 CTCCCAGGGCAGAGCCCACAAGG + Intergenic
1106314003 13:28577816-28577838 CTGCCTGGACTGAGACCCCAGGG + Intergenic
1106566180 13:30886607-30886629 CTCCCTGGAGAGGGCTTCGATGG - Intergenic
1106892447 13:34260593-34260615 CTCCCAGAACAGAACTTCCAAGG + Intergenic
1107563393 13:41577565-41577587 CTCCCTGGAGTGTGCTTCCATGG - Intronic
1108624141 13:52211028-52211050 CTCCCAGGACAGAGCTCACAAGG + Intergenic
1108661910 13:52595395-52595417 CTCCCAGGACAGAGCTCACAAGG - Intergenic
1110035033 13:70672626-70672648 CTCCCTGGACAAAACCTCCAGGG - Intergenic
1110867023 13:80407575-80407597 CTCCCTGGGCAGATCTCCCAGGG - Intergenic
1111041113 13:82749309-82749331 CTCCCTTTACAGAGCCTTTATGG - Intergenic
1111182516 13:84687366-84687388 CTGCCTGAACAGGGCCTGCATGG - Intergenic
1113226925 13:108169226-108169248 CTCCCTGGACAGAGTTCCCAAGG + Intergenic
1114418107 14:22557402-22557424 CTCCCTGGGCACTTCCTCCAGGG - Intronic
1115961178 14:38837351-38837373 CTGCCTGGACAGCACCTCCTGGG + Intergenic
1116181977 14:41546299-41546321 CTCCTTGGACATTTCCTCCATGG + Intergenic
1118744066 14:68761525-68761547 CTCCCAGGACAACACCTCCAGGG + Intergenic
1118883017 14:69844389-69844411 CTCCCAGGGCTGAGCCCCCATGG - Intergenic
1119168429 14:72514745-72514767 CATCCTGCACTGAGCCTCCATGG - Intronic
1121485218 14:94309621-94309643 TTCCCTGGACTCACCCTCCAGGG - Intronic
1122134024 14:99622347-99622369 CTCTCTGGACAGAGCACCCCAGG - Intergenic
1122941063 14:104981612-104981634 CTCTCTGGACAGACACCCCAAGG - Intergenic
1122981816 14:105195459-105195481 TTCCTTGGACAGAGCTTCCAGGG - Intergenic
1123982367 15:25615487-25615509 CTACCTGGAAATAGCCTCCCAGG + Intergenic
1124003323 15:25777398-25777420 CTCCCTGGCAATAGCCTCCCCGG + Intronic
1124374124 15:29119997-29120019 CTCCATGGACATGGCCTCCAAGG - Intergenic
1124624585 15:31300595-31300617 TTCCCCAGACACAGCCTCCAGGG - Intergenic
1124641471 15:31398940-31398962 TTCCCTGGGCACAGGCTCCAGGG - Intronic
1125795742 15:42402829-42402851 CTTCCTGTACAACGCCTCCAAGG + Exonic
1126225219 15:46262150-46262172 CTCCCTGGACAGAGCCTCCAGGG - Intergenic
1126358158 15:47818023-47818045 CTCCCTGCTCAGAGCCTCTCTGG + Intergenic
1126473875 15:49046281-49046303 CACCATGGACCGAGCCCCCACGG - Exonic
1127188549 15:56506061-56506083 CTCCCTGGACAGAGCCTCCAGGG + Intergenic
1127888136 15:63222187-63222209 CTCACTGGACAGGACCACCATGG + Intronic
1128934095 15:71730686-71730708 CCTCCTGGACAGAGCCACCCCGG - Intronic
1128986081 15:72222559-72222581 CTGCCTGGACAGTGCCTGCCAGG + Intronic
1129328837 15:74816453-74816475 CCCCAAGGACAGAGCCTACATGG - Exonic
1130149013 15:81297242-81297264 CACCCTGGACAGCACCTCCACGG - Intronic
1130843411 15:87722958-87722980 TTTCCTGCACAGAGCCACCATGG - Intergenic
1132085785 15:98907352-98907374 CCCAATGGACATAGCCTCCAGGG + Intronic
1132693753 16:1193072-1193094 CTCCCTGACCTGAGCCCCCACGG - Intronic
1133324873 16:4936537-4936559 CCCCCTGGACGGAGCTTCCTGGG + Intronic
1134831856 16:17330433-17330455 CTCCCTGGGCTGTGACTCCAGGG + Intronic
1136364349 16:29802503-29802525 CTCAGTAGACAGTGCCTCCAGGG + Intronic
1136518923 16:30784123-30784145 GTCCCTGGAGAGATCCTCCCAGG - Exonic
1137677716 16:50311920-50311942 TCCCCTGGCCAGAGGCTCCAAGG + Intronic
1137819222 16:51427725-51427747 CTTTCTTGACAGAGTCTCCAAGG + Intergenic
1139569014 16:67798900-67798922 CTCCCTGGCCACAGCATACAAGG + Intronic
1139966184 16:70746643-70746665 CACTGAGGACAGAGCCTCCAGGG + Intronic
1140866522 16:79067115-79067137 GGCCCTAGACAGGGCCTCCAAGG - Intronic
1141377503 16:83545511-83545533 CTGCCTGGACAAGGCCTTCATGG + Intronic
1141523134 16:84594705-84594727 ATCCCTGGCCCAAGCCTCCATGG + Intronic
1141722323 16:85763307-85763329 CTCCCTGGGCAGGGCCTCACGGG - Intergenic
1142308849 16:89300403-89300425 CTTCCTGGCCAGAGGCTCCCAGG + Intronic
1142480359 17:215087-215109 CTCCCTGGCCAGAGGATTCATGG - Intronic
1142942918 17:3397961-3397983 CACCCAGGACAGCGCCACCAGGG + Exonic
1142946451 17:3433365-3433387 CACCCAGGACAGCGCCACCACGG + Exonic
1143137499 17:4720034-4720056 CTCCCTGCTCAGAGCCTCCTTGG - Intronic
1143349286 17:6275661-6275683 TTCTCTGGACAGAGGCTCCTAGG + Intergenic
1144352325 17:14408993-14409015 CTCCGTGGACAAAGCTTTCAGGG - Intergenic
1144655227 17:17030922-17030944 CTCTCTAGACACAGGCTCCAGGG - Intergenic
1144726738 17:17506079-17506101 CTCCCAGGTCAGAGCGGCCATGG - Intronic
1145207248 17:20991139-20991161 GCCCCTGGCCAGAGCCACCAAGG - Intergenic
1145237841 17:21221597-21221619 CTCCAGTGACAGAGCCTCTATGG - Intergenic
1146306480 17:31733492-31733514 CTCCATGCACAGTGGCTCCAGGG + Intergenic
1146530506 17:33604112-33604134 TTTCCTTGACACAGCCTCCAGGG - Intronic
1147285756 17:39401684-39401706 CTCATTGGACAGAGCCGCCCGGG + Intronic
1147794026 17:43030016-43030038 GTCCCTGGCCTGAGCCTCTAAGG - Intergenic
1150654450 17:67030844-67030866 CTCCCTGGACAGCGTGTACATGG - Exonic
1151337436 17:73448082-73448104 TTCCCAGGTCACAGCCTCCATGG + Intronic
1151389409 17:73775761-73775783 CTCCCTGGACATTGCTTCGAGGG + Intergenic
1151849718 17:76683165-76683187 GTCCCTGGACAGAGGCTAGAGGG - Intronic
1151929029 17:77219191-77219213 CTCCCTGGACTGACCTGCCAGGG + Intergenic
1153605062 18:6824852-6824874 CTCCGTAGACAGCGCCTCCATGG + Intronic
1153630158 18:7061835-7061857 CCCACAGGACAGAGCTTCCAGGG - Intronic
1153785374 18:8529326-8529348 CTCCCTGGAAAGAGCCTCCAGGG + Intergenic
1154010677 18:10571635-10571657 CTGCCTGCTCAGGGCCTCCATGG - Intergenic
1154181368 18:12142521-12142543 CTCCATTGACACAGCCTCCAGGG - Intergenic
1154182536 18:12149063-12149085 CTCCATTGACACAGCCTCCAGGG + Intergenic
1155169814 18:23259202-23259224 CTTCCTGGTCAGTGCCTACAGGG + Exonic
1155546853 18:26924500-26924522 CTCCCTGGGCAGTGCCTTCAAGG - Intronic
1156369948 18:36464470-36464492 ATCCCTGGCCTGAGCCTCCTGGG - Intronic
1157478080 18:48036096-48036118 CTCCCTAGGCAGGGCCTCAACGG - Intronic
1159659005 18:71070439-71070461 CTCCCTTGGCAAAGCCACCAGGG - Intergenic
1159948304 18:74459831-74459853 CTCCTTGCACAGAGCTTCCTTGG + Intergenic
1161124429 19:2547793-2547815 TTCCCAGGACAGAGGCTCCCAGG + Intronic
1161979824 19:7624581-7624603 ACCCCAGGACAGAGCCTCCGTGG + Intronic
1162106676 19:8373961-8373983 CTGCCTGGGCAGGGGCTCCAAGG + Exonic
1162546716 19:11335333-11335355 CTTCCTGGGCAGATCCTCAAAGG + Intronic
1162613095 19:11771683-11771705 ATGCCTGGACAGGGCCACCAGGG + Intronic
1163226494 19:15964988-15965010 CTCCCTGGACTGAGCCAGGAAGG - Intergenic
1163549163 19:17955831-17955853 CTCGCTGGAGACAGCCCCCAGGG + Intronic
1163675023 19:18651372-18651394 CAGACTGGACAGAGGCTCCAGGG - Intronic
1164399278 19:27891612-27891634 CTGTCTGGCCAGAGCCTCTAGGG - Intergenic
1164740938 19:30575293-30575315 CTCCATGGACAGCCCCTCCATGG + Intronic
1164768658 19:30791219-30791241 CTAACTGGACACAGCCTCCTCGG - Intergenic
1164936581 19:32219595-32219617 CTCCCAGGACAGCGCATCCCAGG + Intergenic
1165156513 19:33792131-33792153 CCCCCTGGAGAGGGCCTCCCTGG + Intergenic
1165706597 19:37980597-37980619 CTCCCTGGCCTCAGCCTCCCAGG - Intronic
1165794450 19:38510841-38510863 CACCCAGGACAGAGCCTCCATGG - Intronic
1165823496 19:38692488-38692510 CTCACAGGCCAGAGGCTCCACGG + Intronic
1165839835 19:38781778-38781800 TTCCCTGGCCAGAGCTTCCTAGG + Intergenic
1166851084 19:45761672-45761694 GCCCCAGGACACAGCCTCCAAGG + Exonic
1167566827 19:50261975-50261997 CTCCCTGGCCAGTCCCTCGAGGG + Intronic
1167708664 19:51097407-51097429 CACCCTGCTCAGATCCTCCAGGG - Intergenic
1168069836 19:53943212-53943234 CTCCCTCGACGGGGCCTCGAGGG - Exonic
1168179353 19:54650349-54650371 CTCTCCTGACAGTGCCTCCATGG - Intronic
1168564071 19:57408527-57408549 CTCACTGTCCAGAGCCTCCTGGG + Intronic
925422168 2:3721481-3721503 CTCCATGAACATACCCTCCATGG - Intronic
925428865 2:3774000-3774022 CCCCCTGCACTGTGCCTCCAAGG + Intronic
925569498 2:5294035-5294057 GACCCTGGACTGAGTCTCCAAGG - Intergenic
926073359 2:9919720-9919742 TTCCATGGACACAGCCTTCAGGG + Exonic
928462162 2:31485194-31485216 CTCCCTGGACACAGCCCCCAGGG - Intergenic
930229441 2:48828014-48828036 CTCACTAGACAGAGTCCCCAGGG + Intergenic
930516507 2:52414143-52414165 CTCCACTGACAGAGCATCCAGGG + Intergenic
930939518 2:56997566-56997588 CTCCCTGGACAGAGCCTCTAGGG - Intergenic
931543385 2:63354001-63354023 CTCCCTGAACAGAGCCTTCAGGG + Intronic
932003091 2:67902415-67902437 CTCCCAGCACTGAGCCTCCTGGG + Intergenic
933728483 2:85439440-85439462 ACCCCTGCTCAGAGCCTCCATGG - Intergenic
934623219 2:95829069-95829091 CTCCCTGGACAGAGCCTCCAGGG - Intergenic
934810547 2:97273024-97273046 CTCCCTGGAGAGAGCCTCCAGGG + Intergenic
934827145 2:97434915-97434937 CTCCCTGGAGAGAGCCTCCAGGG - Intergenic
934955638 2:98615682-98615704 ATGCCTTGACAGAGCCTCCCTGG - Intronic
936500543 2:113062697-113062719 CTCCCTGGGCAGAGCCAGCTCGG + Exonic
937363039 2:121242323-121242345 GTGCGGGGACAGAGCCTCCAAGG - Intronic
937397188 2:121547227-121547249 CTCCCTGGACAGAGACCACATGG + Intronic
937569041 2:123334022-123334044 CTCCCTGTGCAGAGCCTCCATGG + Intergenic
938130764 2:128714280-128714302 CTCTCTGGACAGACTCTTCAAGG - Intergenic
938297240 2:130185857-130185879 CTTCCAGGACAGAGCCCTCAAGG - Intronic
938742764 2:134248447-134248469 CTTCCTGCATAAAGCCTCCAGGG - Intronic
938871813 2:135485546-135485568 CACCCTGCACAGTGCCTCTAGGG - Intronic
939180112 2:138794516-138794538 CTCTCTGGACAGATCTCCCAAGG - Intergenic
940038958 2:149339382-149339404 CTCCATAGACAAAGCTTCCAAGG + Intronic
940124888 2:150311818-150311840 CTCCCTGGACAGAGCACCTGAGG + Intergenic
940674727 2:156714364-156714386 CTTTCTGGACAGAGCCTCCAGGG - Intergenic
941344324 2:164348562-164348584 CTCCCCGGACAGAGCCTCCAGGG - Intergenic
941479767 2:165992012-165992034 CTCCCTTAACTGAGCTTCCAGGG + Exonic
942500355 2:176583194-176583216 CTTCCAAAACAGAGCCTCCAAGG - Intergenic
942890418 2:180980825-180980847 CTCCCCGGCCAGAGCCTCCTCGG + Exonic
943611898 2:190044550-190044572 CTCCCTGGACAGAGCCTCTCAGG - Intronic
944473374 2:200079457-200079479 CTCCCTGTAAGGAGCCTTCATGG - Intergenic
945042287 2:205752353-205752375 CTCACTGGGCAGAACCTCCCAGG + Intronic
946165791 2:217863035-217863057 CTCCCTGGTCACCCCCTCCAAGG + Intronic
946406814 2:219496266-219496288 CTCCCTGGTCAGAACATTCAGGG - Intronic
947588598 2:231371723-231371745 CTCCCAGGGCAGAGCCACCAAGG + Intronic
947798380 2:232909085-232909107 TACCCTGGATAGAGCTTCCAGGG + Intronic
947895951 2:233672179-233672201 CTCCCGGTCCAGATCCTCCAGGG - Exonic
948059530 2:235032817-235032839 CGCCCTGGACCGAGACTCCCTGG - Intronic
948514868 2:238497666-238497688 CTCCCTGGAGAGAGCACGCAGGG + Intergenic
948816092 2:240511061-240511083 CTGTCTGGTCAGAGCCTCCTTGG - Intronic
1171279480 20:23883766-23883788 CTCCCTGGTCCCAGCCTGCAGGG + Intergenic
1171282065 20:23909626-23909648 TTCCATGTACAGAGCCTCCAGGG - Intergenic
1171381543 20:24737703-24737725 CTCCCTGGACACAGGCGGCATGG + Intergenic
1172269261 20:33644470-33644492 CTGCATGGCCAGAGCCCCCACGG + Exonic
1172707268 20:36891400-36891422 CTCCCCGGACTAAGCCTCCCTGG - Exonic
1173055121 20:39604519-39604541 TTCCCTGGGCAAAGCCTACATGG + Intergenic
1173192202 20:40885389-40885411 CTCCCTGTTCAGTGCCTCCAAGG + Intergenic
1173440884 20:43075011-43075033 TTCCCCGGACAGAGCCTCTGGGG + Intronic
1173595441 20:44256060-44256082 CTCCCTGGAAGGAGCCCTCAGGG + Intronic
1175253553 20:57624317-57624339 CTGCCTGGAAAGGGCCTCAAAGG + Intergenic
1175392949 20:58638566-58638588 GTCCCAGGACTGAGCCTCAATGG - Intergenic
1175806113 20:61830195-61830217 CTCACTAGACAGAGGCTCCGAGG + Intronic
1175999508 20:62825674-62825696 TCCCCTTCACAGAGCCTCCAAGG + Intronic
1176139769 20:63539854-63539876 GCCCCTGGAAATAGCCTCCAAGG + Intergenic
1176141171 20:63545738-63545760 CTCCATGGACAGAGCGTCCATGG - Intronic
1176977062 21:15334563-15334585 CTCCCTGGACAGAGCCTTCAGGG - Intergenic
1178397695 21:32257046-32257068 GCCCCTGGACAGAGTTTCCAAGG - Intergenic
1178792640 21:35714271-35714293 CTCCCTGGAAGGATCCTCCAGGG - Intronic
1179044103 21:37829770-37829792 CTGCGTGGGCAAAGCCTCCATGG - Intronic
1179716488 21:43291288-43291310 CCCCCTGGAAAGCACCTCCAAGG + Intergenic
1180048362 21:45320072-45320094 CTCCCACAGCAGAGCCTCCAAGG - Intergenic
1180052177 21:45336208-45336230 CTCCCTGCACTAAGGCTCCAGGG - Intergenic
1180564190 22:16649153-16649175 CTCCCAGGGCAGAGCCCACAAGG - Intergenic
1181053592 22:20248988-20249010 TCCACTGGGCAGAGCCTCCAGGG - Intronic
1181106609 22:20579460-20579482 CACCCTGGGGAGTGCCTCCAGGG + Intronic
1181386691 22:22550958-22550980 CTCCCTGGGCAGCAACTCCAGGG + Exonic
1181623299 22:24105604-24105626 CACCCTGGATGGAACCTCCAGGG - Intronic
1182016156 22:27041567-27041589 CTCTCTGGACTAAGCCTCTAGGG + Intergenic
1182414632 22:30213381-30213403 CTACCTGGCCAAAGCCTCCCTGG - Intergenic
1182702827 22:32254268-32254290 CACCCTGGCCAGAGCCTCTGGGG - Intronic
1183041712 22:35184867-35184889 CTTCCTGGACAGAGCCTCCAGGG + Intergenic
1183314284 22:37128510-37128532 CTCCCCTGACAGAGGCTGCAGGG + Exonic
1184111458 22:42398005-42398027 CTCCCCGCACAGACCCCCCAGGG + Intronic
1184466097 22:44669428-44669450 ACCCCGGGACAGAGACTCCAGGG + Intronic
1184594118 22:45503694-45503716 CTCCCGGGACAGAGGGCCCAAGG + Intronic
1185042879 22:48514576-48514598 CTCCCTGGGCAGGGTCTGCAGGG - Intronic
950007398 3:9700231-9700253 ATCCCTGGACAGTCCCTCCCTGG - Intronic
950045473 3:9946445-9946467 CTCCCTCGACAGCTTCTCCAGGG - Exonic
950445712 3:13036581-13036603 CTCCCTGGACTGAACTTCCCTGG + Intronic
950449037 3:13055254-13055276 CTTCCTGGACAGAGAGCCCAGGG + Intronic
950965443 3:17142758-17142780 CTCCACGGACAGAGCTTCCCAGG + Intergenic
951197059 3:19836162-19836184 CTTTCTGGACAGAGCCTCCAGGG + Intergenic
951283407 3:20779976-20779998 CTTTCTGGACAGAGCCTCCAGGG + Intergenic
951982728 3:28583368-28583390 CTCCCTGAACGGAGGCTGCATGG + Intergenic
952340156 3:32438774-32438796 CTTCCTGCTCTGAGCCTCCAGGG - Intronic
953021060 3:39113537-39113559 ATCCCTGGAGGGAGACTCCATGG + Intronic
953515439 3:43586364-43586386 GTCCCTGAAAAGAACCTCCATGG - Intronic
954316647 3:49805075-49805097 CTCCCTGGGCAGTGCCTCACAGG - Intergenic
954362917 3:50131860-50131882 CTCCAAGGACCTAGCCTCCAGGG - Intergenic
954486773 3:50860322-50860344 CTCCCTAAGCAGAGCCTCCAGGG - Intronic
954498656 3:50988899-50988921 CTCCCTGGACAGAGCCTCCAGGG + Intronic
954810492 3:53244289-53244311 CTCCCTCGGCAGAGCATCCTGGG + Intronic
957198484 3:77101559-77101581 CTCCCTGAACACAGCCTGCCTGG - Intronic
957374321 3:79336586-79336608 CTGCATGGACAGAGCCCTCATGG + Intronic
958253707 3:91300196-91300218 CTTCCTGGGCAAAACCTCCAAGG + Intergenic
959452158 3:106517439-106517461 TTCCCTGGACAGAGCCCCCATGG + Intergenic
960157192 3:114307984-114308006 CTGCCTGGACACAGCTTCCTGGG - Exonic
960342924 3:116497264-116497286 CTCCCTGGACAGAGACTCCAGGG + Intronic
960685268 3:120288327-120288349 CTTCCAGGACAGTGCCTCCAGGG + Intergenic
960841565 3:121963863-121963885 CTCCCTGAACAAAGCCCCCAGGG + Intergenic
961930403 3:130527209-130527231 CTACCTCAACAGAGCCTCAAAGG - Intergenic
962248654 3:133820934-133820956 TCCCCTGGACAGAGCCACCCTGG - Exonic
963053022 3:141158468-141158490 TTCCCTGAGCAGAGCCTCCAGGG + Intergenic
963509596 3:146230471-146230493 CTCCCTGGAAAGTGGCTCAAGGG + Intronic
964423776 3:156531541-156531563 CTGCCTGGAGATAGCCTCAAAGG - Intronic
965297032 3:166960739-166960761 CTTCCTGGAGAAAGCCTCCAAGG + Intergenic
966000534 3:174943901-174943923 CTCCCTGGGCAGAGCCTCCAGGG - Intronic
966715089 3:183006585-183006607 CTCCCTGGCTAGTTCCTCCAAGG + Intergenic
967503055 3:190222494-190222516 TTCCCTGAACAGAGCCTCTAGGG - Intergenic
968359823 3:198139013-198139035 CTCCCATGACAGAGCCTCATGGG - Intergenic
968713369 4:2137029-2137051 CCCTCTGGACACAGCCTCCCGGG + Intronic
968970507 4:3791235-3791257 CTCCCTGGGTACAGCCTCCTGGG - Intergenic
969561166 4:7949290-7949312 CACCCTGGATAGAAGCTCCAGGG + Intergenic
971026608 4:22594914-22594936 CTCCCTGGGCAGTGCCATCAAGG - Intergenic
971106008 4:23524773-23524795 CTCCGTGGACAGAGCCTCCAGGG + Intergenic
971444170 4:26724727-26724749 CTGCTTGCACAGAGCCTCAAAGG + Intronic
971605315 4:28651258-28651280 CTCCTTGGATCGAGCATCCAGGG - Intergenic
972189634 4:36574599-36574621 CTGCCTGGGCAGAGCCTTGAGGG - Intergenic
973936209 4:55849528-55849550 CTCCTTGGGCAGAACCTCCTTGG + Intergenic
975022116 4:69502693-69502715 CTCCCTGGACAGAGCCTCCAGGG + Intronic
975106178 4:70571564-70571586 CTCCCTGAACAGAGCCTCTGGGG - Intergenic
976726687 4:88222289-88222311 CTTCTGGGACAGAGCCTTCATGG + Intronic
976954668 4:90880590-90880612 CTCCCTGGACAGAGCCTCCAAGG - Intronic
977006273 4:91572031-91572053 CTCCCTGAACAGAGCCTTAACGG - Intronic
977649534 4:99454068-99454090 CTCCCTGAACAGAGTCTCCAGGG - Intergenic
977819847 4:101458700-101458722 CACCCTGGACAGAGCCTCCAGGG + Intronic
978043041 4:104092966-104092988 CTCCCTGGACAGAGCCTCTAGGG + Intergenic
978208236 4:106105029-106105051 CTCCCTGCCCAGAGCCTACAGGG + Intronic
978238343 4:106487416-106487438 CTCCCTAGACAGAGCCCCCAGGG - Intergenic
978683734 4:111414836-111414858 CTGCCTGGACAGAACCTCTAGGG - Intergenic
979013106 4:115396233-115396255 CTCCCTAGACAGAGCCCCCAGGG - Intergenic
980174950 4:129333367-129333389 CACCTTGGACACTGCCTCCATGG + Intergenic
980331370 4:131415267-131415289 CTCCCTGGACAGACCCTCCAGGG + Intergenic
982646205 4:158027388-158027410 CTCCCTGGACAGAGCCTCCAGGG + Intergenic
983692089 4:170482625-170482647 CACCCTGGGAACAGCCTCCAAGG - Intergenic
985675307 5:1228277-1228299 CTGCCTGGGCACTGCCTCCAAGG - Intronic
986197297 5:5549743-5549765 CTCCCTGAACAGGGCCTGCAGGG + Intergenic
986719778 5:10552817-10552839 CACCCTGGATAGTGCCTCCTGGG - Intergenic
987674829 5:21061936-21061958 CTCCTTGGGCAGAGCCTCCAAGG - Intergenic
987887585 5:23831461-23831483 CTCACCGGACATAGCCTCCAGGG + Intergenic
988128489 5:27073622-27073644 AAACCTGGACAGAGCCTTCAGGG + Intronic
988936010 5:36083456-36083478 CTCTCTGGACAGAGCCTCCAGGG + Intergenic
990050503 5:51494260-51494282 CTGCCTGGAAGGATCCTCCAGGG + Intergenic
990500311 5:56389979-56390001 CTCCCTGGATAGCACCTCCAGGG + Intergenic
993351270 5:86853272-86853294 CTCCCTGGACAGAGCCCCCAGGG - Intergenic
993450839 5:88070483-88070505 CTCCCTGAACAGAGCCCCCAGGG + Intergenic
993731495 5:91428328-91428350 CTCCCTGCACATAGCCTGCTAGG + Intergenic
994095245 5:95841996-95842018 CTCACAGGTCAGAGCCTTCAGGG - Intergenic
994147394 5:96410449-96410471 CTCCCTGGAAACAGCCTTAAAGG - Intronic
994242761 5:97444148-97444170 CTCCCTGAACAGAGCCTTCAGGG - Intergenic
995187823 5:109290224-109290246 TTCCCTGGACAGAGCCTCCAGGG + Intergenic
995428665 5:112050548-112050570 TTCCCTGTACAGAGCCTCCAGGG + Intergenic
996144914 5:119962671-119962693 CTCCATGGACAGGCTCTCCAAGG - Intergenic
999052167 5:148534510-148534532 CTCCCGGGACAGAGACTCCAGGG + Intronic
999847389 5:155499414-155499436 CTCCCACAACAGAGCCTCCAGGG - Intergenic
1001522233 5:172403013-172403035 CTCCTTGGCCAGGGCCTCCCTGG + Intronic
1001586144 5:172834780-172834802 CTCCCTCTACTGAGCCTCCTTGG + Intronic
1002212369 5:177606659-177606681 TACCCTGCTCAGAGCCTCCATGG + Intronic
1003007896 6:2398412-2398434 CTGCCTGGTAAGGGCCTCCAAGG + Intergenic
1003017594 6:2480592-2480614 CTGCCTGGACAGTGCCTGTATGG - Intergenic
1003394701 6:5743084-5743106 ATACCTGGACATAGCCTACAAGG - Intronic
1003638552 6:7857125-7857147 CTCCCATCACACAGCCTCCAAGG - Intronic
1003642503 6:7887662-7887684 CAATCTGCACAGAGCCTCCATGG + Intronic
1005906833 6:30268882-30268904 CTTCCTGGACAGAGTTTCCAAGG + Intergenic
1006063359 6:31442213-31442235 CTTCCTGGACCGAGGCCCCAAGG - Intergenic
1006305851 6:33218098-33218120 CCTCCTGCACAGAGTCTCCAGGG + Intergenic
1007215754 6:40235871-40235893 CTGAGTTGACAGAGCCTCCAGGG + Intergenic
1007221473 6:40282303-40282325 CTCACTGACCAGAGTCTCCAGGG + Intergenic
1007609316 6:43139067-43139089 CTCCCTGGAGGCTGCCTCCAGGG - Intronic
1007779215 6:44242831-44242853 CAGCCTGGACAGAGTCTCTAGGG - Intergenic
1007815835 6:44525093-44525115 TGGCCTGGCCAGAGCCTCCAGGG + Intergenic
1007831340 6:44640885-44640907 CTCCCTGCACAGACCCTGGAAGG + Intergenic
1007905459 6:45455492-45455514 AGCCCTGGACAGAGCAGCCATGG - Intronic
1008864027 6:56188514-56188536 CTCCCTGGACAGAGCACCTGGGG + Intronic
1008973902 6:57401977-57401999 CTCCCTGGACAGAGCAACCAGGG - Intronic
1009162792 6:60303482-60303504 CTCCCTTGACTGAGCAACCAGGG - Intergenic
1009190765 6:60626840-60626862 CTTCCTGGGCAAAACCTCCAAGG - Intergenic
1009596688 6:65745525-65745547 CTCCCTGGGCAGAGCCTCCCAGG + Intergenic
1009888867 6:69656407-69656429 CTCCATGGACAGAGCCTCCAGGG + Intergenic
1011666975 6:89643736-89643758 CTCCCAGGCCAGGGCTTCCAAGG + Exonic
1012616418 6:101284072-101284094 CTACCTGGACAGAACTTCTAGGG - Intergenic
1014760123 6:125346777-125346799 CACCCTGAACACAGCCTCCCCGG - Intergenic
1015036363 6:128659984-128660006 CTCCCTGGATAGAGGCGTCATGG + Intergenic
1015197283 6:130537324-130537346 CTCCCTGGACAGGGCCTCCAGGG + Intergenic
1015494372 6:133865307-133865329 CTATCTGGACAGAGCCTCCAGGG - Intergenic
1016192507 6:141288498-141288520 CTCAGTGGACAAAGGCTCCAAGG - Intergenic
1016775507 6:147900209-147900231 CTCCTTTGACCGATCCTCCATGG - Intergenic
1016845967 6:148568993-148569015 CTCCCTGGACTGAGCTCCCAGGG - Intergenic
1017344977 6:153369903-153369925 CTCTCTAGACAGAGCCCCCAGGG + Intergenic
1018652485 6:166003702-166003724 CTCCATGGTCAGAGCCTGCCAGG - Intergenic
1019260166 7:77635-77657 CTCCCATGACAGAGCCTCATGGG + Intergenic
1019482150 7:1271888-1271910 CTCCCGGGCCAGAGCCACCTGGG - Intergenic
1020702331 7:11499012-11499034 CTCCTTTGACAGAGCCTCCAGGG + Intronic
1021175831 7:17449178-17449200 CTCCCTGGACAGAGCACCCTGGG - Intergenic
1022323636 7:29309937-29309959 CTGCCTGGCCAGTGCTTCCAGGG - Intronic
1023818285 7:43966309-43966331 CTCCACGCACAGCGCCTCCACGG + Intergenic
1023886378 7:44360176-44360198 CTTCCTGGACAGAGACCCTATGG - Intergenic
1025158906 7:56636039-56636061 CTCCCTGGCCAGAGCCTCCAGGG + Intergenic
1025259925 7:57412126-57412148 CTCCTTGGAAGGAGGCTCCAAGG - Intergenic
1025756823 7:64352025-64352047 CTCCCTGGACAGAGCCTCCAGGG - Exonic
1027556495 7:79670445-79670467 CTACAGGGACAGAGCCTTCATGG + Intergenic
1028082919 7:86600064-86600086 CTCCCTGGACAGAGCCTCAAGGG + Intergenic
1028176957 7:87671334-87671356 CTCCCTGGACAGGGCCTCTAGGG - Intronic
1028177051 7:87671862-87671884 CTCCCAGGACAGTGCTCCCAGGG - Intronic
1029726615 7:102410160-102410182 CTGCTTGCACAGAGCCTCCAGGG + Intronic
1029742915 7:102501141-102501163 CTCCACGCACAGCGCCTCCATGG + Exonic
1029760905 7:102600302-102600324 CTCCACGCACAGCGCCTCCATGG + Exonic
1031627131 7:124004519-124004541 CTCCCTGGACAGAGCATCCAAGG - Intergenic
1033280368 7:140002226-140002248 CTCAATGGACAGAGCCTCCTTGG + Intronic
1033532076 7:142274456-142274478 CTCCCTGGACTGAGCCTCCAGGG - Intergenic
1033735171 7:144214977-144214999 CTCCAGGGGCAGAGCCTTCATGG + Intergenic
1033747885 7:144335992-144336014 CTCCAGGGGCAGAGCCTTCATGG - Intergenic
1034364357 7:150533726-150533748 CTCCCTGGACAGAGCCTTCCAGG - Intergenic
1034518991 7:151604241-151604263 CTGCATGCACACAGCCTCCAGGG + Intronic
1035132569 7:156669463-156669485 CTGCCTGGACAGAGGTTCCAGGG - Intronic
1035628749 8:1092603-1092625 CTCCAGGGACAGAGCCTTCAAGG + Intergenic
1036553824 8:9839203-9839225 CTCCCTGGACAGAGCACCTGGGG + Intergenic
1037373941 8:18208738-18208760 AGCACTGGGCAGAGCCTCCAAGG + Intronic
1037787561 8:21911850-21911872 CACCCTGGGGAGAGCCCCCAGGG + Intronic
1038233570 8:25729153-25729175 CTCCCTGGACAGAGCCTCTACGG - Intergenic
1038412438 8:27368754-27368776 GTTCCTGGACAGAAGCTCCATGG - Intronic
1040372293 8:46788749-46788771 CTCCCTGGACAGAGCCTCTAGGG - Intergenic
1040379804 8:46861431-46861453 CTTCCTGGACACGGCCCCCAAGG + Intergenic
1040380564 8:46868098-46868120 CTCCCTGGACAGAGCTTCCAGGG + Intergenic
1042619928 8:70693915-70693937 CTCCATAGACAGAGCCTCTGGGG - Intronic
1043229875 8:77788362-77788384 GTCCCTGTTCAGAGCCTCCAGGG - Intergenic
1043280915 8:78465492-78465514 ACCCCTGGACAGAGCCTCCAGGG + Intergenic
1045594288 8:103635318-103635340 CTCCCTGGACAGAGCCTCCAGGG - Intronic
1045813613 8:106253889-106253911 CTCCCTTGACACAGCATTCATGG + Intergenic
1048038993 8:130706917-130706939 CTGCATGGGCAGAGCCCCCATGG - Intergenic
1048591243 8:135822587-135822609 CTCCCTGGCCCTATCCTCCATGG - Intergenic
1049242166 8:141543594-141543616 CCCGCTGGACAGAGGCCCCAGGG - Intergenic
1049428775 8:142549682-142549704 CTCCCAGGTCTGGGCCTCCAGGG - Intergenic
1049709585 8:144057571-144057593 CTCAGTGGCCACAGCCTCCAGGG + Exonic
1049758090 8:144319700-144319722 TTCCCAGGACTGAGCCCCCATGG + Intronic
1050391400 9:5147443-5147465 CTCCCTGGACAGAGCCTCCAGGG - Intronic
1051899722 9:22025431-22025453 CTCCCTGGACAGAGCCGCCACGG - Intronic
1052311613 9:27074755-27074777 CTCCATGGACAGAGCCTCCAGGG - Intergenic
1052626471 9:30982138-30982160 CTCCCTGGAGAGAGCCTCCAGGG + Intergenic
1052766996 9:32651164-32651186 CTCCCTGGGCAGAGCCCACAGGG + Intergenic
1055132707 9:72793894-72793916 CTCCCTGGACAGGATCCCCAGGG + Intronic
1055208677 9:73763114-73763136 CTCCCTGGACAGAGCCTCAGAGG + Intergenic
1055894849 9:81162930-81162952 CTCCCTGGACAGAGCACCTGGGG + Intergenic
1058461672 9:105189466-105189488 CTCCCTGGACAGAACCCTCAGGG - Intergenic
1059387962 9:113979894-113979916 CACACTGGACAGAGCAACCAAGG - Intronic
1059612744 9:115916685-115916707 CTCCCTGTAAACAGACTCCAAGG - Intergenic
1060198895 9:121640455-121640477 TTCCCGGGACAGAGGCTGCAGGG + Intronic
1060230161 9:121820072-121820094 CTCCCGGGACAGAGGGGCCATGG + Intergenic
1060261061 9:122073921-122073943 CCCCCAGCACAGAGCATCCAAGG + Intronic
1061766075 9:132882270-132882292 CTCCAGGGATAGAGGCTCCATGG + Intronic
1061879589 9:133562147-133562169 CTCACTGGCCAGAGACTGCAAGG - Intronic
1062630682 9:137461794-137461816 CCCCCTGGCCAAAGACTCCAGGG - Intronic
1062744526 9:138202834-138202856 CTCCCATGACAGAGCCTCATGGG - Intergenic
1185467328 X:362647-362669 CTCCCTGGACCCCTCCTCCATGG - Intronic
1185469967 X:376421-376443 CACACTCGACAGAGCCCCCATGG + Intronic
1185702118 X:2238551-2238573 GACCCTGGACAGATCCTGCAAGG + Intronic
1185834272 X:3330353-3330375 ATCACAGGACAGACCCTCCAGGG - Exonic
1186137977 X:6539666-6539688 CTCCCTCCACAGAGTCTCCATGG - Intergenic
1187087541 X:16056931-16056953 CTCCCTGGACACAGCTTAAATGG + Intergenic
1187363741 X:18650207-18650229 CTGCCTGGACAGGCCCTCCCAGG - Intronic
1188715006 X:33449584-33449606 CTTCCTGGACACAGCCCCCAGGG + Intergenic
1188833393 X:34928351-34928373 CTGCATGGGCAGAGCCTTCATGG - Intergenic
1188869700 X:35359079-35359101 CCCACTGGACAGAGACCCCAGGG - Intergenic
1189276980 X:39793874-39793896 CCCCCAGGACTGACCCTCCAGGG + Intergenic
1189436611 X:40998377-40998399 CTCTCTGGACAGTGCCTTAAAGG + Intergenic
1190337476 X:49270819-49270841 CTGCCTGGCCTCAGCCTCCACGG - Exonic
1191155244 X:57266475-57266497 CTCTCTGGACGGAGCCGCCAGGG + Intergenic
1191223578 X:58016571-58016593 CTCTTTGGACAGAGCTTCCATGG + Intergenic
1191738910 X:64416858-64416880 CTTCCTGGACAGAGTCTCCAGGG - Intergenic
1191988864 X:67010489-67010511 CTCCCTGGACAAAGCCTCCAGGG + Intergenic
1192225330 X:69223537-69223559 CCCCACGGACAGACCCTCCAAGG - Intergenic
1192254345 X:69443051-69443073 CTCCCAGGACAGAGCCCCCAGGG - Intergenic
1192696616 X:73422713-73422735 CTCCATAGACAGAGGCTCCAAGG - Intergenic
1192891904 X:75399250-75399272 CTCCCTGGACAGAGCCTCCAGGG + Intronic
1192926411 X:75759280-75759302 CTCCCTGGACAGAGTTTCCAGGG + Intergenic
1193061713 X:77214456-77214478 CTCCCTGGACAGAGCCTCCAGGG - Intergenic
1193482668 X:82046677-82046699 CTCCCTGGGCAGAACCTTCAGGG + Intergenic
1193739673 X:85202920-85202942 CTCTCTGGACAGAGGCCCCAGGG - Intergenic
1193789130 X:85797342-85797364 CCCCCTGGACAGAGCTTCCAGGG - Intergenic
1193985605 X:88237444-88237466 CTCCCTGGACAGAGCCTCCAAGG - Intergenic
1194055601 X:89127858-89127880 CTCCCTGGTCAGAGCTTCCAGGG - Intergenic
1194067735 X:89283685-89283707 ATTCCTGGACAGAGCCTCCAGGG - Intergenic
1194247921 X:91537980-91538002 CTCCCTGGACAGAGCCTCCAGGG + Intergenic
1194593962 X:95835743-95835765 TTCCCTGGACAGAGCCTCCAGGG - Intergenic
1194781466 X:98029367-98029389 CTCCCTGGACAGAGCCTTTAGGG - Intergenic
1194854682 X:98914831-98914853 CTACCTGGACAGAGCCTCCAGGG - Intergenic
1194917522 X:99723374-99723396 CTCCCTGGACAGAGCCTCCAGGG + Intergenic
1194948061 X:100091894-100091916 CTCCCTGAACAGAGTCTCCAGGG + Intergenic
1195361174 X:104085052-104085074 CTTCCTGGACAGAGTCCCCAGGG - Intergenic
1195473501 X:105259792-105259814 CTTCCTGGACAGAGTCTCCAAGG - Intronic
1196152653 X:112392184-112392206 CTCCCTGGACAGAGCCCCCAGGG - Intergenic
1196173658 X:112617050-112617072 CTGCATAGACAGAGCCTTCATGG + Intergenic
1196227939 X:113188652-113188674 CTCCCTGGACAGAGCCTCCGGGG - Intergenic
1196528853 X:116759618-116759640 CTCCCTGAACAAAGACCCCAGGG + Intergenic
1196932625 X:120696433-120696455 CTCCCTGTGCAGATCCTCCAGGG + Intergenic
1197356744 X:125444960-125444982 CTCCCTGGACTGAGCCACTGTGG + Intergenic
1199213017 X:145236101-145236123 TTCCCTGGACCGGCCCTCCAAGG + Intergenic
1199249030 X:145638181-145638203 CTCCCCAGACAGAGCCTCCAGGG + Intergenic
1199307012 X:146279088-146279110 CTCTCTGGATAGAGCCCCTAGGG - Intergenic
1200566937 Y:4779509-4779531 CTCCCTGGACAGAGCCTCCAGGG + Intergenic
1200721883 Y:6617846-6617868 ATTCCTGGACAGAGCCTCCAGGG - Intergenic
1200847872 Y:7850441-7850463 CTCCATGGACAGAGCTTCTGGGG + Intergenic
1200858959 Y:7969635-7969657 CTCCCTGGACACTGCCTACAAGG - Intergenic
1200890078 Y:8313866-8313888 CTGCCTGGACACTGCCTACAAGG + Intergenic
1200899745 Y:8417443-8417465 CTTCCTGGACAGAGCCTATAGGG + Intergenic
1201582849 Y:15528971-15528993 ATTCCTGGACACAACCTCCAAGG - Intergenic
1201619300 Y:15937828-15937850 CTCTCTTCACAGAGTCTCCATGG - Intergenic
1202269191 Y:23053949-23053971 CTCCATGGACACAGCTTCCAGGG - Intergenic
1202422183 Y:24687689-24687711 CTCCATGGACACAGCTTCCAGGG - Intergenic
1202448603 Y:24982389-24982411 CTCCATGGACACAGCTTCCAGGG + Intergenic