ID: 934623220

View in Genome Browser
Species Human (GRCh38)
Location 2:95829070-95829092
Sequence ACTCCCTGGACAGAGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 516
Summary {0: 23, 1: 44, 2: 53, 3: 68, 4: 328}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934623220_934623231 27 Left 934623220 2:95829070-95829092 CCTGGAGGCTCTGTCCAGGGAGT 0: 23
1: 44
2: 53
3: 68
4: 328
Right 934623231 2:95829120-95829142 CTGGCAGGGGGGTTAGGTAGAGG No data
934623220_934623226 13 Left 934623220 2:95829070-95829092 CCTGGAGGCTCTGTCCAGGGAGT 0: 23
1: 44
2: 53
3: 68
4: 328
Right 934623226 2:95829106-95829128 CTGGCTCGACAGCTCTGGCAGGG No data
934623220_934623227 14 Left 934623220 2:95829070-95829092 CCTGGAGGCTCTGTCCAGGGAGT 0: 23
1: 44
2: 53
3: 68
4: 328
Right 934623227 2:95829107-95829129 TGGCTCGACAGCTCTGGCAGGGG No data
934623220_934623230 21 Left 934623220 2:95829070-95829092 CCTGGAGGCTCTGTCCAGGGAGT 0: 23
1: 44
2: 53
3: 68
4: 328
Right 934623230 2:95829114-95829136 ACAGCTCTGGCAGGGGGGTTAGG No data
934623220_934623229 16 Left 934623220 2:95829070-95829092 CCTGGAGGCTCTGTCCAGGGAGT 0: 23
1: 44
2: 53
3: 68
4: 328
Right 934623229 2:95829109-95829131 GCTCGACAGCTCTGGCAGGGGGG No data
934623220_934623225 12 Left 934623220 2:95829070-95829092 CCTGGAGGCTCTGTCCAGGGAGT 0: 23
1: 44
2: 53
3: 68
4: 328
Right 934623225 2:95829105-95829127 ACTGGCTCGACAGCTCTGGCAGG No data
934623220_934623228 15 Left 934623220 2:95829070-95829092 CCTGGAGGCTCTGTCCAGGGAGT 0: 23
1: 44
2: 53
3: 68
4: 328
Right 934623228 2:95829108-95829130 GGCTCGACAGCTCTGGCAGGGGG No data
934623220_934623223 -6 Left 934623220 2:95829070-95829092 CCTGGAGGCTCTGTCCAGGGAGT 0: 23
1: 44
2: 53
3: 68
4: 328
Right 934623223 2:95829087-95829109 GGGAGTGGCTGAGTTGCTACTGG No data
934623220_934623224 8 Left 934623220 2:95829070-95829092 CCTGGAGGCTCTGTCCAGGGAGT 0: 23
1: 44
2: 53
3: 68
4: 328
Right 934623224 2:95829101-95829123 TGCTACTGGCTCGACAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934623220 Original CRISPR ACTCCCTGGACAGAGCCTCC AGG (reversed) Intergenic
900107709 1:991947-991969 AGAACCTGGACAGAGACTCCCGG - Intergenic
900138233 1:1127836-1127858 ACTCCATGGGCAGAGCCACAGGG + Intergenic
900369445 1:2324833-2324855 CCTGCCTGGACAGCGCCTCGGGG + Intronic
900393022 1:2441984-2442006 ACACCCGGCACAGAGTCTCCAGG + Intronic
900709110 1:4101251-4101273 ACCACCTGGACAGAGTTTCCAGG - Intergenic
900754874 1:4426391-4426413 AGACCCTGGACAGAGCAGCCAGG - Intergenic
901712722 1:11128315-11128337 GCTGGCTGGACAGACCCTCCTGG + Intronic
901865609 1:12104838-12104860 ACTCCCAGGACAGAGACTTGAGG - Intronic
901954554 1:12774948-12774970 GCTCCCTGGGCAGCTCCTCCAGG - Exonic
901989086 1:13097869-13097891 GCTCCCTGGGCAGCTCCTCCAGG + Intergenic
901992727 1:13128898-13128920 GCTCCCTGGGCAGCTCCTCCAGG - Intergenic
902271473 1:15308125-15308147 ACTCCTTCAACAGAGCCTCATGG - Intronic
904388258 1:30161751-30161773 CCTTCCTGGACCGAGCGTCCGGG - Intergenic
905848722 1:41257419-41257441 ACTCCCTGCACAGAGCCTCCAGG - Intergenic
906954315 1:50359494-50359516 CCTCACTGGGCAGGGCCTCCCGG + Intergenic
907407581 1:54263082-54263104 ACACCCATAACAGAGCCTCCTGG - Intronic
907623967 1:56010526-56010548 ACTCCATTGACAGAGCCCCTAGG + Intergenic
907714884 1:56917294-56917316 ACTCCCTGGACAGAGCCCCCAGG + Intronic
908727298 1:67190351-67190373 CCTCACCAGACAGAGCCTCCTGG + Intronic
909051518 1:70773873-70773895 ACTCCCTGGACAGAGCCTCCAGG - Intergenic
912100082 1:106193151-106193173 ACTCCCAGTACAGAGCCACCAGG + Intergenic
912480106 1:109976715-109976737 ACTCCACGGACGAAGCCTCCTGG + Intergenic
913054549 1:115145438-115145460 ACTCCAGGGACAGAGCCCTCTGG - Intergenic
913410187 1:118542562-118542584 ACTCCTTGGATGGAGCCTCCAGG + Intergenic
914414604 1:147468525-147468547 ACTCCCTGGACAGAGCCTCCAGG - Intergenic
914916220 1:151820882-151820904 ACTCCCTGGAAGGAGCAGCCTGG - Intronic
915618992 1:157067343-157067365 ACTTCCTGGACAAAGTTTCCAGG - Intergenic
915844926 1:159252826-159252848 ATGCTCTGGACAGAACCTCCAGG + Intergenic
916724565 1:167511047-167511069 ACTACCTGCACCGAGCCTGCAGG + Intronic
917149398 1:171928710-171928732 ATTCCCTGGACAAAGCCTCCGGG - Intronic
917259078 1:173148040-173148062 ACTCCCTGGACAGAGCTTCCAGG - Intergenic
919260754 1:195190761-195190783 ACTCCCCGGACAGAGCCACCAGG + Intergenic
919577988 1:199336415-199336437 ACTCCCTGGACAGAGCCTCCAGG - Intergenic
920536353 1:206739182-206739204 ACTTCCTGGCCAGAGGCTCTGGG - Intergenic
920786946 1:209050974-209050996 ACTCCCTGGACAGAGCCTCCAGG + Intergenic
921012965 1:211161302-211161324 ACTCCCTGAACAGAGTCTCCAGG - Intergenic
921577955 1:216859294-216859316 ACTTCCTTGAGAGAGGCTCCAGG + Intronic
922466414 1:225847976-225847998 TCTCTCTGCACACAGCCTCCAGG - Intronic
924019120 1:239761972-239761994 ACTCCCGGGAGAGAGCTTCCAGG - Intronic
924313893 1:242775862-242775884 AGGCCCTGGCCAGAGCCTCTAGG + Intergenic
1062977130 10:1692386-1692408 ACTCCATGGACTCAGGCTCCCGG - Intronic
1063052085 10:2462541-2462563 ACTGCTTGGCCAGAGCCTCACGG + Intergenic
1063193879 10:3721789-3721811 GCTCCCAGGACTGAGCCTCCTGG - Intergenic
1063739918 10:8806252-8806274 ACTCCATAGACAGAGCAGCCTGG - Intergenic
1064165263 10:12980314-12980336 TCTCACTGGACAGACCCTCAGGG - Intronic
1064807360 10:19150573-19150595 ACTGCCTAGACAGAGTTTCCAGG - Intronic
1064898228 10:20262921-20262943 ACTCCCTGGACAGAGCCTCCAGG + Intronic
1070075553 10:73131494-73131516 ACTTCCTCAACAGAGCCTCAGGG - Exonic
1070719128 10:78744405-78744427 ACACCCTGGTCAGGCCCTCCAGG + Intergenic
1070738170 10:78879228-78879250 ACTGCCTGGAGAGAGATTCCAGG + Intergenic
1071088823 10:81895745-81895767 ACTTGCTGGAGTGAGCCTCCAGG + Intronic
1072543849 10:96419133-96419155 ATTCCCTGCACACAGCCTCAGGG + Intronic
1072688235 10:97551620-97551642 TGGCCCTGGACAAAGCCTCCAGG + Intronic
1073109237 10:101050892-101050914 AGTCCCTGGGGAGAACCTCCAGG - Intergenic
1073783769 10:106866134-106866156 ACTTCCTGGACAGAGCCCCCAGG + Intronic
1073875900 10:107920871-107920893 ACTCCCTGAACAGAACCTCCAGG + Intergenic
1075099354 10:119495255-119495277 TCTGCCTGGACAGGGCCTTCGGG - Intergenic
1075881850 10:125859341-125859363 ACTCTCTGGCCTGAGCCTGCTGG + Intronic
1075893835 10:125977947-125977969 ACTCCCCGAACAGAGCCTCCAGG - Intronic
1075893852 10:125978023-125978045 CCTCACTGGACAGGTCCTCCAGG - Intronic
1076323772 10:129604641-129604663 ACTCCCAAGACAGAGCCACAGGG - Intronic
1076413121 10:130265760-130265782 ACTCCCAGGGCAGAGCCTTGGGG + Intergenic
1077168778 11:1157197-1157219 CCTCCCTGGAGAGGGGCTCCTGG - Intergenic
1077341739 11:2029279-2029301 ACACCCTGGTCAGTGCTTCCCGG + Intergenic
1077469618 11:2751025-2751047 GCTGCCTGCACAGAGCCACCAGG - Intronic
1077852341 11:6085344-6085366 ACTCCCCAGACAGATCCCCCTGG + Intergenic
1078539415 11:12201143-12201165 CCTCTCTGGATAGAGCCACCGGG - Intronic
1078561853 11:12378964-12378986 ACTCCATAGACAGAGCAGCCTGG + Intronic
1078960679 11:16264981-16265003 ACTGCCTGGAGAGAGTTTCCAGG + Intronic
1081008818 11:37781809-37781831 CCCCCTTGGACAGAGGCTCCAGG + Intergenic
1081779592 11:45700727-45700749 GCTCCCTGGACAGGGCAGCCAGG + Intergenic
1082094034 11:48112378-48112400 CCTCCCTGAACAGAGACTCTAGG + Intronic
1082096045 11:48130096-48130118 CCTCCCTGAACAGAGGCTCTGGG + Intronic
1084067627 11:66714434-66714456 AGTCCCTGGACAGGAACTCCTGG + Intronic
1084267987 11:68014724-68014746 CCTCCCTGGGCAGTGCCCCCAGG + Intronic
1084335372 11:68454696-68454718 AGTGCCTGGAGAGAGTCTCCTGG + Intergenic
1084556917 11:69880963-69880985 ACCTCCCGGGCAGAGCCTCCTGG - Intergenic
1084659529 11:70538742-70538764 GCCCCCGGGGCAGAGCCTCCAGG + Intronic
1086569139 11:88262947-88262969 ACTCCCTGGTCAGATCCCCCAGG - Intergenic
1087374714 11:97326561-97326583 ACTCCCTGGACAGAGCCTCCAGG - Intergenic
1088796192 11:113268633-113268655 AGTGCCTGGACAGAGACCCCTGG + Intronic
1089466854 11:118691039-118691061 AATCCCTGAACAGTGCCTCAGGG + Intergenic
1089617791 11:119704755-119704777 CCTGCCCGGAGAGAGCCTCCCGG - Intronic
1090033507 11:123228397-123228419 AAGCCCTGGACAGAGTTTCCTGG - Intergenic
1090856039 11:130609942-130609964 GCTCCCTGGACAGAGTCCTCGGG - Intergenic
1090950825 11:131471783-131471805 AGTCCCCAGACAGAACCTCCAGG - Intronic
1202824725 11_KI270721v1_random:84468-84490 ACACCCTGGTCAGTGCTTCCCGG + Intergenic
1091673946 12:2474301-2474323 AAACCCTTGACAGAGCCTCTTGG - Intronic
1091914503 12:4260374-4260396 TCTACCTGCACAGAGCCTCCAGG + Intergenic
1092158766 12:6303438-6303460 AATCCCTGCCCAGACCCTCCTGG - Intergenic
1092195954 12:6549887-6549909 GCTCCCTGGACAGAACCTGTCGG - Exonic
1093562041 12:20552866-20552888 ACTGCCTGGACAGATCCTTTCGG + Intronic
1093735796 12:22618795-22618817 ACTCCATAGACAGAGCAGCCTGG - Intergenic
1095824314 12:46515936-46515958 ACTCCCTGGACAGACCCTCCAGG - Intergenic
1095835902 12:46638316-46638338 ACTCCCTGGGCAGAGCTTCCAGG + Intergenic
1096389637 12:51218212-51218234 TGTCCCGGGAGAGAGCCTCCGGG - Intergenic
1096689197 12:53309080-53309102 CCTCCCTTGACAGAGCTTCCAGG + Intronic
1098589970 12:72199428-72199450 ACTACCTGGATAGAGCCTGTTGG + Intronic
1099667744 12:85653569-85653591 ACTCCCTAGACAGTGTCTCCAGG - Intergenic
1099719501 12:86342391-86342413 ACTCCCTGGAAAGAGCCTCCAGG + Intronic
1100135127 12:91544844-91544866 ACCCCCTGGACAGAGCCTGCAGG + Intergenic
1100555978 12:95694343-95694365 ACTCCCTCGGCAGCGCCTCCAGG + Intronic
1101738431 12:107481368-107481390 AGCCCCTGGGCAGGGCCTCCGGG - Intronic
1102418211 12:112782909-112782931 AATTCCTGGACAGAGTCTCATGG + Intronic
1102484539 12:113246982-113247004 AGACCCTGGGCAGAACCTCCAGG - Intronic
1104333060 12:127865957-127865979 ACTCCCTAGTGAGATCCTCCCGG - Intergenic
1104398337 12:128454624-128454646 ACCCCCTGGATAGGACCTCCAGG + Intronic
1104682921 12:130763646-130763668 CCTCCCTGGGCAGCCCCTCCAGG - Intergenic
1104808332 12:131603819-131603841 ACTCCTGGAACTGAGCCTCCAGG - Intergenic
1106164570 13:27231653-27231675 ACAACCTGGATAGAACCTCCAGG + Intergenic
1108469821 13:50756579-50756601 ACTGCCTGGAAACAGCCTCAGGG - Intronic
1109508444 13:63337116-63337138 ACTGCCTGGAAAGAGACTTCTGG - Intergenic
1110035034 13:70672627-70672649 ACTCCCTGGACAAAACCTCCAGG - Intergenic
1110867024 13:80407576-80407598 ACTCCCTGGGCAGATCTCCCAGG - Intergenic
1113677412 13:112216110-112216132 ACGCTCTGAACAGAACCTCCTGG - Intergenic
1114059006 14:19001954-19001976 GTTCCTTGGACAGAGCTTCCAGG + Intergenic
1114103537 14:19399800-19399822 GTTCCTTGGACAGAGCTTCCAGG - Intergenic
1114131736 14:19800452-19800474 CCTCACTGGACAGGGCCTCCCGG + Intronic
1115326939 14:32150195-32150217 AATCCCTGGAGATGGCCTCCAGG + Intronic
1115961177 14:38837350-38837372 TCTGCCTGGACAGCACCTCCTGG + Intergenic
1119830478 14:77697571-77697593 ACATCCTGGCCAGAGTCTCCCGG - Intronic
1120250186 14:82053748-82053770 ACTTCCAGGACAGAGCCTAGAGG - Intergenic
1121754690 14:96392569-96392591 AGAACCTGGACAGAGACTCCAGG + Intronic
1122981817 14:105195460-105195482 CTTCCTTGGACAGAGCTTCCAGG - Intergenic
1202836267 14_GL000009v2_random:79497-79519 ATTCCCTGGACAGAGCTTCCAGG + Intergenic
1123496812 15:20834674-20834696 ACTCCCTGGACAGAGCTTCCAGG - Intergenic
1123554044 15:21408266-21408288 ACTCCCTGGACAGAGCTTCCAGG - Intergenic
1123590291 15:21845631-21845653 ACTCCCTGGACAGAGCTTCCAGG - Intergenic
1124432422 15:29619002-29619024 ACTCCCAGTGCAGAGCCACCCGG + Intergenic
1125711529 15:41790912-41790934 AGTCTCTGCACAAAGCCTCCTGG + Intronic
1126225220 15:46262151-46262173 ACTCCCTGGACAGAGCCTCCAGG - Intergenic
1126430140 15:48574462-48574484 ACTCCTTTGCCAGAGCCACCAGG - Intronic
1127188548 15:56506060-56506082 ACTCCCTGGACAGAGCCTCCAGG + Intergenic
1129237196 15:74230785-74230807 CCACCCTGCACAGAGCCTGCTGG + Intergenic
1129273314 15:74430704-74430726 ACTCCCTCCACAGAGTCTCATGG - Intronic
1129736733 15:77970715-77970737 ATTCCTGGGCCAGAGCCTCCTGG + Intergenic
1129849342 15:78782918-78782940 ATTCCTGGGCCAGAGCCTCCTGG - Intronic
1130273637 15:82465249-82465271 AAGCCCTTGACAGACCCTCCTGG - Intergenic
1130465987 15:84192620-84192642 AAGCCCTTGACAGACCCTCCTGG - Intergenic
1130498276 15:84480916-84480938 AAGCCCTTGACAGACCCTCCTGG + Intergenic
1130588277 15:85197216-85197238 AAGCCCTTGACAGACCCTCCTGG - Intergenic
1131286762 15:91065826-91065848 TCACCCTGGACAGAGCCTCGGGG + Intergenic
1131609562 15:93946901-93946923 ACTCCCCAGACAGAGTCCCCTGG - Intergenic
1202962392 15_KI270727v1_random:135462-135484 ACTCCCTGGACAGAGCTTCCAGG - Intergenic
1132642350 16:983610-983632 TTTCCCTGGTCAGAGCCTCCTGG + Intronic
1133324871 16:4936536-4936558 GCCCCCTGGACGGAGCTTCCTGG + Intronic
1133743269 16:8667724-8667746 AGTTCCTGGACAGCGCCTCAGGG + Intergenic
1133780475 16:8935282-8935304 ACTCCTGGGTTAGAGCCTCCTGG + Intronic
1134831855 16:17330432-17330454 ACTCCCTGGGCTGTGACTCCAGG + Intronic
1137703749 16:50519199-50519221 CCTCCCTGGAAACAGCCACCTGG - Intergenic
1139751702 16:69112882-69112904 ACTCCCTTGGCCGAGCCTCTCGG - Intronic
1139991530 16:70943733-70943755 ACACCCTGGACAGAGGTTCTGGG - Intronic
1140418515 16:74796089-74796111 ACTGCCTGGAAAGAGTTTCCAGG + Intergenic
1141528562 16:84629582-84629604 AGTCCCTGGTCAGTGGCTCCCGG - Intergenic
1141722324 16:85763308-85763330 ACTCCCTGGGCAGGGCCTCACGG - Intergenic
1142604749 17:1075246-1075268 ACCCCAGGGACAGAGCATCCAGG - Intronic
1142763561 17:2054375-2054397 AGTGGCTGGACAGCGCCTCCGGG - Intronic
1143026207 17:3943414-3943436 CCACCCGGGACAGAGCCTGCAGG + Exonic
1144106222 17:11988322-11988344 ACTGCCTAGACAGAGGATCCAGG + Intronic
1144131150 17:12249033-12249055 ACTGCCTGGAGAAAGTCTCCAGG + Intergenic
1144197336 17:12907118-12907140 ACACCCAGCCCAGAGCCTCCTGG - Intronic
1144741272 17:17583764-17583786 ACTCTCTGGAGGGACCCTCCTGG + Intronic
1145215874 17:21051992-21052014 GCTGCCTGGACAGAGCTTGCAGG + Intergenic
1145906934 17:28521461-28521483 GCTCCCTGGACAGCTCCTCCTGG - Intronic
1146127186 17:30238690-30238712 ATGCCCAGGACAGGGCCTCCCGG - Intergenic
1146280048 17:31538833-31538855 ACTCACTGGACTTAGCCTCCTGG + Intergenic
1146530507 17:33604113-33604135 ATTTCCTTGACACAGCCTCCAGG - Intronic
1146687190 17:34849055-34849077 CCTCTCTGGAGAGAGCATCCAGG + Intergenic
1147285755 17:39401683-39401705 GCTCATTGGACAGAGCCGCCCGG + Intronic
1147448634 17:40490227-40490249 ACTCCCTGGTCGGGGCATCCAGG + Intronic
1147732843 17:42614567-42614589 ACTTCCTCGACAGGGCCACCTGG - Exonic
1147740102 17:42666394-42666416 ACTTCCTCGACAGGGCCACCTGG - Exonic
1148074696 17:44928542-44928564 CCTCTCTGCCCAGAGCCTCCAGG - Exonic
1151849719 17:76683166-76683188 AGTCCCTGGACAGAGGCTAGAGG - Intronic
1151929028 17:77219190-77219212 ACTCCCTGGACTGACCTGCCAGG + Intergenic
1152194810 17:78911311-78911333 GCTCCTTGGACAGAGACTGCAGG + Intronic
1152287743 17:79422410-79422432 ACTCCCAGGCCGGTGCCTCCAGG + Intronic
1152934533 17:83128317-83128339 ACCCCCTGGAAAGGGGCTCCAGG - Intergenic
1153785373 18:8529325-8529347 ACTCCCTGGAAAGAGCCTCCAGG + Intergenic
1154181369 18:12142522-12142544 ACTCCATTGACACAGCCTCCAGG - Intergenic
1154181656 18:12144186-12144208 ATGCCCTGAACAGAGCCTCCAGG - Intergenic
1154182248 18:12147398-12147420 ATGCCCTGAACAGAGCCTCCAGG + Intergenic
1154182535 18:12149062-12149084 ACTCCATTGACACAGCCTCCAGG + Intergenic
1154454715 18:14510358-14510380 ACTCCCTGGACAGAGCTTCCAGG - Intronic
1156244595 18:35285054-35285076 ACAGCATGGGCAGAGCCTCCTGG + Intronic
1156369949 18:36464471-36464493 CATCCCTGGCCTGAGCCTCCTGG - Intronic
1156513723 18:37662323-37662345 TCTGCCTGGACTGAGGCTCCTGG + Intergenic
1160070149 18:75621354-75621376 ACTCTCTGAACAGAGGCTCCTGG + Intergenic
1160738184 19:674288-674310 TCACCCTGCACAGAGCCTCTGGG + Intergenic
1161077121 19:2291200-2291222 ACTCCCCGGACAGAGCCGTGAGG + Exonic
1161559041 19:4960658-4960680 ACTGCCTGGACAGATCCTTTCGG + Exonic
1163029635 19:14535922-14535944 ACTCACTGGGCAGATTCTCCTGG + Intronic
1163528697 19:17836945-17836967 ACTCCTTGGAAAGCGGCTCCAGG - Intronic
1163675024 19:18651373-18651395 ACAGACTGGACAGAGGCTCCAGG - Intronic
1164242457 19:23401713-23401735 CATCCATGGACAGAGCCTACTGG - Intergenic
1164281750 19:23775217-23775239 CATCCATGGACAGAGCCTACTGG + Intronic
1165039041 19:33055838-33055860 CCAGCCTGGACAGGGCCTCCGGG - Intronic
1167748297 19:51365739-51365761 TCTCCCTAGCTAGAGCCTCCTGG + Intronic
1168564070 19:57408526-57408548 ACTCACTGTCCAGAGCCTCCTGG + Intronic
1168622674 19:57891710-57891732 ACTCCATAGACAGAGCCGCCCGG - Intronic
1202636371 1_KI270706v1_random:47868-47890 ATTCCCTGGACAGAGCTTCCAGG - Intergenic
925249540 2:2421044-2421066 TCTCTCTGCACTGAGCCTCCTGG + Intergenic
928462163 2:31485195-31485217 ACTCCCTGGACACAGCCCCCAGG - Intergenic
930229440 2:48828013-48828035 ACTCACTAGACAGAGTCCCCAGG + Intergenic
930739466 2:54815345-54815367 ACTCCCTGGACAGAGTTCACTGG + Intronic
930939519 2:56997567-56997589 ACTCCCTGGACAGAGCCTCTAGG - Intergenic
931543384 2:63354000-63354022 ACTCCCTGAACAGAGCCTTCAGG + Intronic
932003090 2:67902414-67902436 CCTCCCAGCACTGAGCCTCCTGG + Intergenic
934623220 2:95829070-95829092 ACTCCCTGGACAGAGCCTCCAGG - Intergenic
934810546 2:97273023-97273045 ACTCCCTGGAGAGAGCCTCCAGG + Intergenic
934827146 2:97434916-97434938 ACTCCCTGGAGAGAGCCTCCAGG - Intergenic
936176192 2:110222179-110222201 ACTGCCTGGAGAGAGTTTCCAGG - Intergenic
937100000 2:119261301-119261323 TCTGCATGGACTGAGCCTCCTGG - Intronic
938077033 2:128345640-128345662 ACTCCGGTGACAGAGCGTCCTGG - Intergenic
938849740 2:135248292-135248314 ACTCCCTGTACAGAGCCTCCAGG + Intronic
939120561 2:138111097-138111119 TGTCCCTGGACACAGCTTCCAGG - Intergenic
940674728 2:156714365-156714387 ACTTTCTGGACAGAGCCTCCAGG - Intergenic
941344325 2:164348563-164348585 ACTCCCCGGACAGAGCCTCCAGG - Intergenic
941821472 2:169848075-169848097 ACTTCCTTGACAGAGTTTCCAGG - Intronic
942134169 2:172908998-172909020 ACTCCCTGTCCAAACCCTCCAGG - Intronic
942216060 2:173720062-173720084 ACACTCTGGCCAGAGGCTCCGGG + Intergenic
942763726 2:179429434-179429456 ACTCCCATTACAGAGCCCCCGGG - Intergenic
947104829 2:226658627-226658649 AATCCCTGGTCATAGCCTCTGGG + Intergenic
947161769 2:227222381-227222403 ACTCTCTGGACAAAGCCTGCAGG - Intronic
947170239 2:227303736-227303758 ACCCATAGGACAGAGCCTCCAGG + Intronic
947895952 2:233672180-233672202 ACTCCCGGTCCAGATCCTCCAGG - Exonic
948513424 2:238488151-238488173 GCTCCCTGCACAGAGGCTCTTGG + Intergenic
948938079 2:241181404-241181426 ACTCCCTCCTCAGAGCCTGCAGG - Intronic
948942124 2:241201825-241201847 ACACCCTGGACACAGCTGCCAGG + Intronic
1168767130 20:389291-389313 ACTCTCTGGGCTCAGCCTCCTGG - Intronic
1169255625 20:4095031-4095053 ACTGCCTGGAGAGAATCTCCAGG + Intergenic
1170580648 20:17697245-17697267 TCTCCCTGGACAATTCCTCCTGG - Intronic
1171279479 20:23883765-23883787 ACTCCCTGGTCCCAGCCTGCAGG + Intergenic
1171282066 20:23909627-23909649 ATTCCATGTACAGAGCCTCCAGG - Intergenic
1171882501 20:30628796-30628818 ATTCCCTGGACAGAGCTTCCAGG - Intergenic
1172952345 20:38730193-38730215 AGTCCCTGGACTGGCCCTCCTGG - Intergenic
1173440883 20:43075010-43075032 ATTCCCCGGACAGAGCCTCTGGG + Intronic
1173595440 20:44256059-44256081 ACTCCCTGGAAGGAGCCCTCAGG + Intronic
1173973482 20:47170305-47170327 ACTCCCAGGACATGGCTTCCAGG + Intronic
1174420354 20:50395457-50395479 AGTCTCTGGCCAGAGCCTGCGGG + Intergenic
1175132657 20:56801145-56801167 ACTCCCGGGATAGAGTCCCCTGG - Intergenic
1175826975 20:61941790-61941812 AGTCCCTGGGCCGGGCCTCCTGG + Intergenic
1175981849 20:62742697-62742719 AGCCACTGGTCAGAGCCTCCTGG + Intronic
1176689264 21:9883502-9883524 CCTCACTGGTCAGGGCCTCCTGG - Intergenic
1176819449 21:13642950-13642972 ACTCCCTGGACAGAGCTTCCAGG + Intergenic
1176977063 21:15334564-15334586 ACTCCCTGGACAGAGCCTTCAGG - Intergenic
1178479197 21:32964432-32964454 ACTCCATAGACAGAGCAGCCCGG - Intergenic
1178792641 21:35714272-35714294 ACTCCCTGGAAGGATCCTCCAGG - Intronic
1179612333 21:42560337-42560359 CCACCCTGGACAGCGCCCCCTGG - Intronic
1180364494 22:11926448-11926470 ATTCCCTGGACAGAGCTTCCAGG + Intergenic
1180477490 22:15724570-15724592 GTTCCTTGGACAGAGCTTCCAGG + Intergenic
1181546244 22:23604146-23604168 ATTCCCTGCAAACAGCCTCCAGG + Intergenic
1181592503 22:23894092-23894114 ACCCCCGGCACAGCGCCTCCTGG + Exonic
1182702828 22:32254269-32254291 GCACCCTGGCCAGAGCCTCTGGG - Intronic
1183041711 22:35184866-35184888 ACTTCCTGGACAGAGCCTCCAGG + Intergenic
1183951853 22:41356891-41356913 ACTCCCTGCACACCACCTCCAGG - Intronic
1183984485 22:41562017-41562039 TCTCCCTGGGAAGAGCCTGCAGG - Intronic
1185280667 22:49968598-49968620 CCGCCCTCCACAGAGCCTCCAGG + Intergenic
951197058 3:19836161-19836183 ACTTTCTGGACAGAGCCTCCAGG + Intergenic
951283406 3:20779975-20779997 ACTTTCTGGACAGAGCCTCCAGG + Intergenic
951741721 3:25932011-25932033 GCTCCCTGGACAGAGCACCCCGG + Intergenic
953386829 3:42511345-42511367 AGTCCCAGGAGTGAGCCTCCTGG + Intronic
953508710 3:43512903-43512925 ACTGCCTAGACAAAGTCTCCAGG + Intronic
953993355 3:47500758-47500780 GTTCCCTGAACAGAGCTTCCAGG + Intronic
954287292 3:49627993-49628015 ACGCCCTGGACACAGCACCCAGG - Intronic
954486774 3:50860323-50860345 ACTCCCTAAGCAGAGCCTCCAGG - Intronic
954498655 3:50988898-50988920 ACTCCCTGGACAGAGCCTCCAGG + Intronic
954810491 3:53244288-53244310 TCTCCCTCGGCAGAGCATCCTGG + Intronic
956289891 3:67650409-67650431 AGTCCCTGGACAGAAGCTCTGGG + Intronic
957256574 3:77844990-77845012 TCTCCCTGGACAGAGCATCTGGG - Intergenic
957403109 3:79742336-79742358 AGTCTCTGGACATAGCGTCCTGG + Intronic
958969978 3:100600833-100600855 ACTGCCTGGACACAGACTCGGGG - Intergenic
960157193 3:114307985-114308007 TCTGCCTGGACACAGCTTCCTGG - Exonic
960342923 3:116497263-116497285 ACTCCCTGGACAGAGACTCCAGG + Intronic
960685267 3:120288326-120288348 ACTTCCAGGACAGTGCCTCCAGG + Intergenic
960691886 3:120354761-120354783 AATCCCTAGACAGAGCCCCTAGG - Intergenic
960841564 3:121963862-121963884 ACTCCCTGAACAAAGCCCCCAGG + Intergenic
963037082 3:141040112-141040134 ACTACCTGGATAGAGTTTCCAGG + Intergenic
963053021 3:141158467-141158489 ATTCCCTGAGCAGAGCCTCCAGG + Intergenic
966000535 3:174943902-174943924 ACTCCCTGGGCAGAGCCTCCAGG - Intronic
966000555 3:174943979-174944001 CCTCACTGGACAGATCCCCCAGG - Intronic
966211376 3:177457046-177457068 ACTCCCTGGAGAGAGTTTCCGGG + Intergenic
966237878 3:177722488-177722510 ACTCCCTGGAGAAAGATTCCAGG - Intergenic
966883744 3:184363213-184363235 CCGCCCTGGGCAGAGCCACCTGG + Intronic
967503056 3:190222495-190222517 GTTCCCTGAACAGAGCCTCTAGG - Intergenic
967891760 3:194368928-194368950 ACTCCCTGCTCAAAGCCTCCAGG + Intronic
968359824 3:198139014-198139036 CCTCCCATGACAGAGCCTCATGG - Intergenic
968540485 4:1165840-1165862 ACTCCACGGTCAGAGCCACCGGG - Intergenic
968713367 4:2137028-2137050 GCCCTCTGGACACAGCCTCCCGG + Intronic
968878305 4:3285784-3285806 ACTGGCTGGTCAGAGCCACCAGG + Intergenic
968908832 4:3466465-3466487 CCTTCCTGAGCAGAGCCTCCTGG + Intronic
968970508 4:3791236-3791258 ACTCCCTGGGTACAGCCTCCTGG - Intergenic
969561165 4:7949289-7949311 ACACCCTGGATAGAAGCTCCAGG + Intergenic
970169382 4:13274600-13274622 ACTCCCTGGAGATAGTTTCCAGG - Intergenic
970453134 4:16191856-16191878 AATCCCTGCACATAGCCTGCTGG + Intronic
971106007 4:23524772-23524794 ACTCCGTGGACAGAGCCTCCAGG + Intergenic
971605316 4:28651259-28651281 ACTCCTTGGATCGAGCATCCAGG - Intergenic
973140842 4:46766016-46766038 ACTCAGTGGACACAGGCTCCAGG + Intronic
973366172 4:49211239-49211261 ATTCCCTGGACAGAGCTTCCAGG - Intergenic
973394424 4:49581197-49581219 ATTCCCTGGACAGAGCTTCCAGG + Intergenic
973574540 4:52273660-52273682 ACTTCCTAGACAAAGCCCCCAGG + Intergenic
974199875 4:58623617-58623639 ACTACCTGGACAGAGCCTCCAGG + Intergenic
974985944 4:69026306-69026328 ACTCCTTGGAGAGAGCCACTGGG - Intronic
975022115 4:69502692-69502714 ACTCCCTGGACAGAGCCTCCAGG + Intronic
975106179 4:70571565-70571587 ACTCCCTGAACAGAGCCTCTGGG - Intergenic
977649535 4:99454069-99454091 ACTCCCTGAACAGAGTCTCCAGG - Intergenic
977819846 4:101458699-101458721 ACACCCTGGACAGAGCCTCCAGG + Intronic
978043026 4:104092888-104092910 ACTCACTGGGCAGGTCCTCCAGG + Intergenic
978043040 4:104092965-104092987 ACTCCCTGGACAGAGCCTCTAGG + Intergenic
978208235 4:106105028-106105050 ACTCCCTGCCCAGAGCCTACAGG + Intronic
978238344 4:106487417-106487439 CCTCCCTAGACAGAGCCCCCAGG - Intergenic
978683735 4:111414837-111414859 ACTGCCTGGACAGAACCTCTAGG - Intergenic
979013107 4:115396234-115396256 ACTCCCTAGACAGAGCCCCCAGG - Intergenic
980331369 4:131415266-131415288 ACTCCCTGGACAGACCCTCCAGG + Intergenic
980352649 4:131701317-131701339 CCTCACTGGTCAGGGCCTCCTGG - Intergenic
981227605 4:142314947-142314969 ACTTCCTGGACAGAGCTGCCTGG + Intronic
982646204 4:158027387-158027409 ACTCCCTGGACAGAGCCTCCAGG + Intergenic
985392914 4:189510726-189510748 ACTGCTTGCACAGAGCCTCAAGG + Intergenic
1202763688 4_GL000008v2_random:133735-133757 ATTCCCTGGACAGAGCTTCCAGG - Intergenic
985587152 5:746386-746408 CCTCCCTGGGCAGTGACTCCGGG - Intronic
985601720 5:838569-838591 CCTCCCTGGGCAGTGACTCCAGG - Intronic
986197296 5:5549742-5549764 GCTCCCTGAACAGGGCCTGCAGG + Intergenic
986719779 5:10552818-10552840 GCACCCTGGATAGTGCCTCCTGG - Intergenic
987887584 5:23831460-23831482 ACTCACCGGACATAGCCTCCAGG + Intergenic
988936009 5:36083455-36083477 ACTCTCTGGACAGAGCCTCCAGG + Intergenic
989693296 5:44170692-44170714 ATTCCCTGAACAGAGCCTCCAGG + Intergenic
990500310 5:56389978-56390000 ACTCCCTGGATAGCACCTCCAGG + Intergenic
993351271 5:86853273-86853295 GCTCCCTGGACAGAGCCCCCAGG - Intergenic
993450838 5:88070482-88070504 ACTCCCTGAACAGAGCCCCCAGG + Intergenic
994095246 5:95841997-95842019 ACTCACAGGTCAGAGCCTTCAGG - Intergenic
994242762 5:97444149-97444171 ACTCCCTGAACAGAGCCTTCAGG - Intergenic
994804353 5:104424646-104424668 AGTCCCTGAGCAGAGCATCCTGG + Intergenic
995187822 5:109290223-109290245 ATTCCCTGGACAGAGCCTCCAGG + Intergenic
995428664 5:112050547-112050569 ATTCCCTGTACAGAGCCTCCAGG + Intergenic
996324121 5:122252884-122252906 AGTCCCTGGAGAGAATCTCCTGG + Intergenic
996901595 5:128547920-128547942 ACTCCATAGACAGAGCAGCCTGG + Intronic
999052166 5:148534509-148534531 CCTCCCGGGACAGAGACTCCAGG + Intronic
999847390 5:155499415-155499437 TCTCCCACAACAGAGCCTCCAGG - Intergenic
999976476 5:156916715-156916737 ACTACTAGGACAGAGGCTCCTGG + Intergenic
1000757950 5:165184337-165184359 ACTGCCTGGAAAGAGACTCAGGG - Intergenic
1001677126 5:173528243-173528265 ACTCCCAGGACAGGGGCCCCAGG + Intergenic
1001823189 5:174725397-174725419 ACTCCCCAGGCAGAGACTCCGGG - Intronic
1002013375 5:176303159-176303181 ATTCTCTGGACTCAGCCTCCTGG - Intronic
1002070725 5:176677611-176677633 ACTCCCTGTCTAGAGTCTCCTGG - Intergenic
1002711863 5:181199967-181199989 CCTCCCGGGACAGTTCCTCCAGG + Exonic
1003046662 6:2739714-2739736 ACAACCTGTACAGTGCCTCCTGG - Intronic
1003639914 6:7868023-7868045 ACTTCCTAGACTGAGTCTCCTGG - Intronic
1005847856 6:29795479-29795501 ACTACCTGGACATCCCCTCCTGG - Intergenic
1005933499 6:30500788-30500810 ACTCTTTGGACAGAGTCACCTGG - Intergenic
1006835429 6:36996020-36996042 TCTCACAGGACAGAGGCTCCAGG - Intergenic
1007421454 6:41722362-41722384 GCTCCCTGGCCAGAGCCCACAGG + Intronic
1007697575 6:43743551-43743573 CCTCTCTGCACACAGCCTCCAGG + Intergenic
1008173216 6:48234568-48234590 CCTCACTGGGCAGATCCTCCAGG + Intergenic
1008211423 6:48729490-48729512 CCTCAATGGACAGATCCTCCAGG + Intergenic
1008647976 6:53534611-53534633 ACTGCCTGGGGAGAGGCTCCAGG + Intronic
1008864026 6:56188513-56188535 TCTCCCTGGACAGAGCACCTGGG + Intronic
1008973903 6:57401978-57402000 ACTCCCTGGACAGAGCAACCAGG - Intronic
1009162793 6:60303483-60303505 ACTCCCTTGACTGAGCAACCAGG - Intergenic
1009325775 6:62346186-62346208 ACTTCCTGGACAGGGCCGCCAGG + Intergenic
1009888866 6:69656406-69656428 ACTCCATGGACAGAGCCTCCAGG + Intergenic
1011370610 6:86633406-86633428 CCTCCCTGGATAGAGCTCCCAGG - Intergenic
1011507778 6:88067548-88067570 ACTCCCCAGACAGAACCTCTGGG - Intergenic
1011507825 6:88067694-88067716 CCTCACTGGACAGGTCCTCCAGG - Intergenic
1012052505 6:94362190-94362212 AGTCTCTGCACAGGGCCTCCCGG - Intergenic
1012616419 6:101284073-101284095 ACTACCTGGACAGAACTTCTAGG - Intergenic
1014124383 6:117759870-117759892 ACTCCTTGGACAGAGCCCCCAGG + Intergenic
1014183287 6:118408022-118408044 AGTCCCTGGACAGAGCCTCCAGG + Intergenic
1015197282 6:130537323-130537345 ACTCCCTGGACAGGGCCTCCAGG + Intergenic
1015494373 6:133865308-133865330 ACTATCTGGACAGAGCCTCCAGG - Intergenic
1016835423 6:148471991-148472013 ACTCCCTTCACAAAGCCGCCCGG - Intronic
1016845692 6:148566099-148566121 CCTCCCTGGACTGAGCTCCCAGG + Intergenic
1016845968 6:148568994-148569016 CCTCCCTGGACTGAGCTCCCAGG - Intergenic
1016997997 6:149974554-149974576 CCTGCCTGCACAGAACCTCCAGG - Intergenic
1017010503 6:150060165-150060187 CCTGCCTGCACACAGCCTCCAGG + Intergenic
1017344976 6:153369902-153369924 ACTCTCTAGACAGAGCCCCCAGG + Intergenic
1019260165 7:77634-77656 CCTCCCATGACAGAGCCTCATGG + Intergenic
1019278215 7:187131-187153 ACTCCCTGGCCACAGCTCCCAGG + Intergenic
1019482151 7:1271889-1271911 GCTCCCGGGCCAGAGCCACCTGG - Intergenic
1019486911 7:1293608-1293630 AGTCCCTGGGCAGAGTGTCCCGG - Intergenic
1020248202 7:6447168-6447190 ATTCCCTGCACAGATCCTCTGGG + Intronic
1020702330 7:11499011-11499033 ACTCCTTTGACAGAGCCTCCAGG + Intronic
1021175832 7:17449179-17449201 ACTCCCTGGACAGAGCACCCTGG - Intergenic
1022123491 7:27333213-27333235 ACTACCTGGAGAGAGTTTCCAGG - Intergenic
1023744486 7:43310201-43310223 GGTCTCTGGACAGAGCCTCCTGG + Intronic
1023812135 7:43919766-43919788 ACTTCCTCGACAGGGCCACCTGG - Intronic
1024516920 7:50267066-50267088 ACACCCAGGACAGAGGCTCTCGG - Intergenic
1024991728 7:55240060-55240082 TCTCCATGGACAGAGCCACCTGG - Intronic
1025158905 7:56636038-56636060 ACTCCCTGGCCAGAGCCTCCAGG + Intergenic
1025250617 7:57349033-57349055 AGTCACTGGCCAGAGCCTGCAGG - Intergenic
1025756824 7:64352026-64352048 ACTCCCTGGACAGAGCCTCCAGG - Exonic
1026500333 7:70938272-70938294 ACTCTCTGAACAGAGTCCCCAGG + Intergenic
1027278487 7:76587285-76587307 ACTGCCTGGAGAAAGCTTCCAGG - Intergenic
1027329410 7:77075850-77075872 ACTGCCTTGAGAGAGTCTCCAGG - Intergenic
1028082918 7:86600063-86600085 ACTCCCTGGACAGAGCCTCAAGG + Intergenic
1028176958 7:87671335-87671357 ACTCCCTGGACAGGGCCTCTAGG - Intronic
1028319241 7:89438935-89438957 AGTCCATTGTCAGAGCCTCCAGG + Intergenic
1029113464 7:98224771-98224793 TCTCCCTGCACAGGGCCTTCGGG - Intronic
1029633949 7:101771380-101771402 ACTCCACGAACAGAGCCCCCTGG - Intergenic
1029726614 7:102410159-102410181 CCTGCTTGCACAGAGCCTCCAGG + Intronic
1029786354 7:102795515-102795537 ACTGCCTTGAGAGAGTCTCCAGG + Intronic
1030644666 7:112046789-112046811 ACTCCCTTGATAGAGGGTCCAGG + Intronic
1031024142 7:116662166-116662188 CCTCCCTGAGCACAGCCTCCAGG + Intergenic
1031432529 7:121689927-121689949 ACACCATGGACAGAGCTTACAGG + Intergenic
1032154292 7:129455447-129455469 GCTCCCTGGATCCAGCCTCCTGG - Intronic
1033532077 7:142274457-142274479 ACTCCCTGGACTGAGCCTCCAGG - Intergenic
1035132570 7:156669464-156669486 TCTGCCTGGACAGAGGTTCCAGG - Intronic
1035757299 8:2043714-2043736 ACTGCCTGGGGAGAGCCTTCTGG - Intergenic
1036553823 8:9839202-9839224 TCTCCCTGGACAGAGCACCTGGG + Intergenic
1037086640 8:14859456-14859478 ACTCCCTTGAAAGAGTCTCAGGG + Intronic
1038176247 8:25184427-25184449 ACCCCCGGGACCCAGCCTCCGGG + Intergenic
1038959105 8:32498968-32498990 ACTCCCTGGACAGTTCCAGCTGG - Intronic
1040087846 8:43364564-43364586 ATTCCCTGGACAGAGCTTCCAGG + Intergenic
1040372294 8:46788750-46788772 ACTCCCTGGACAGAGCCTCTAGG - Intergenic
1040380563 8:46868097-46868119 ACTCCCTGGACAGAGCTTCCAGG + Intergenic
1040404562 8:47087237-47087259 GTTCCCTGGACAGTGCTTCCAGG - Intergenic
1041536400 8:58930688-58930710 CATGCCTGGACAGATCCTCCAGG + Intronic
1041561808 8:59226567-59226589 ACTCTCTAGATAGAGCCTCTGGG + Intergenic
1042619929 8:70693916-70693938 ACTCCATAGACAGAGCCTCTGGG - Intronic
1043229876 8:77788363-77788385 AGTCCCTGTTCAGAGCCTCCAGG - Intergenic
1043280914 8:78465491-78465513 AACCCCTGGACAGAGCCTCCAGG + Intergenic
1044162459 8:88936116-88936138 ACAACCAGGACAGAGCCTCCAGG + Intergenic
1045594289 8:103635319-103635341 ACTCCCTGGACAGAGCCTCCAGG - Intronic
1047127969 8:121984120-121984142 ATTCCCTGGAGAGAGTTTCCAGG - Intergenic
1047430761 8:124789683-124789705 ACTCCATTGAGAGAGCCACCTGG + Intergenic
1048254277 8:132893913-132893935 ACTCACTAGACTGAGCCGCCAGG - Exonic
1048970182 8:139641117-139641139 GCACCCTGGTCAGAGCCTCAGGG - Intronic
1049428776 8:142549683-142549705 ACTCCCAGGTCTGGGCCTCCAGG - Intergenic
1049533759 8:143168649-143168671 ACCCCATGGCCAGCGCCTCCAGG - Intergenic
1049787964 8:144460206-144460228 AGTCACTGAACAGAGCCCCCAGG + Intronic
1049995388 9:1029319-1029341 ACTGCCTGGACAGTGGTTCCCGG - Intergenic
1050391401 9:5147444-5147466 ACTCCCTGGACAGAGCCTCCAGG - Intronic
1050963370 9:11766084-11766106 TCTCCCTGGACAGAGCACCTAGG + Intergenic
1051488038 9:17629801-17629823 ACTTCCTGGACTGAGACACCTGG - Intronic
1052311614 9:27074756-27074778 ACTCCATGGACAGAGCCTCCAGG - Intergenic
1052626470 9:30982137-30982159 ACTCCCTGGAGAGAGCCTCCAGG + Intergenic
1052703024 9:31960465-31960487 ACTCCCTGGACAGAGCCTCCAGG + Intergenic
1052762221 9:32604292-32604314 ACTCCTAGGACCAAGCCTCCTGG - Intergenic
1052766995 9:32651163-32651185 ACTCCCTGGGCAGAGCCCACAGG + Intergenic
1053780063 9:41598394-41598416 CCTCACTGGTCAGGGCCTCCTGG + Intergenic
1054168020 9:61808637-61808659 CCTCACTGGTCAGGGCCTCCTGG + Intergenic
1054669526 9:67772267-67772289 CCTCACTGGTCAGGGCCTCCTGG - Intergenic
1055121901 9:72669945-72669967 ACTGCCTGGAGAGAGATTCCAGG + Intronic
1055132706 9:72793893-72793915 ACTCCCTGGACAGGATCCCCAGG + Intronic
1055894848 9:81162929-81162951 TCTCCCTGGACAGAGCACCTGGG + Intergenic
1057294409 9:93826999-93827021 ACTCCCTGGTCAGGGCCCCTGGG + Intergenic
1057867822 9:98695238-98695260 AAGCCCAGGACAGAGCCTGCAGG - Intronic
1057933476 9:99216313-99216335 ACTCCATGGTAAGAGCCACCAGG + Intergenic
1058461673 9:105189467-105189489 ACTCCCTGGACAGAACCCTCAGG - Intergenic
1059599177 9:115757634-115757656 AATCTCTGGGCAGAGCCACCAGG + Intergenic
1060209340 9:121700257-121700279 GCTCCCTGGCCAGCGTCTCCCGG - Intronic
1061564146 9:131426526-131426548 ACTCCCTGGACCTAGCCTCAGGG + Intronic
1061912708 9:133733530-133733552 CTTTCCTGGACAGAGCCACCAGG - Intronic
1061956322 9:133963193-133963215 ACTGTCTTCACAGAGCCTCCTGG - Intronic
1062625308 9:137439761-137439783 ACCCCCAGGCCTGAGCCTCCAGG + Intronic
1062744527 9:138202835-138202857 CCTCCCATGACAGAGCCTCATGG - Intergenic
1203527909 Un_GL000213v1:106620-106642 ACTCCCTGGACAGAGCTTCCAGG - Intergenic
1203544442 Un_KI270743v1:118608-118630 ATTCCCTGGACAGAGCTTCCAGG - Intergenic
1185587318 X:1249518-1249540 AAGCCCTGGAGAGAGCCTCTAGG + Intergenic
1186104098 X:6187364-6187386 ATTCCCTGGCCTCAGCCTCCGGG - Intronic
1186248001 X:7635116-7635138 ACAACCTGGAGAAAGCCTCCAGG + Intergenic
1186955155 X:14673575-14673597 ACTCCCTGGACTGAGCTTGTTGG - Intronic
1188715005 X:33449583-33449605 ACTTCCTGGACACAGCCCCCAGG + Intergenic
1188842884 X:35037491-35037513 ACTCCTTGGACAGAGCCTCTGGG + Intergenic
1189276978 X:39793873-39793895 ACCCCCAGGACTGACCCTCCAGG + Intergenic
1189397710 X:40638106-40638128 ACTCCCTGGACCCAGCTTCCTGG - Intronic
1190133184 X:47769357-47769379 ACTCCCTGGACAGAGCCTCCAGG + Intergenic
1191155243 X:57266474-57266496 CCTCTCTGGACGGAGCCGCCAGG + Intergenic
1191738911 X:64416859-64416881 ACTTCCTGGACAGAGTCTCCAGG - Intergenic
1191743701 X:64463736-64463758 ACTCTCTGGACAGAGCATCCAGG - Intergenic
1191922500 X:66271375-66271397 ACTCTCTGGATAGAGCCTCCAGG + Intergenic
1191988863 X:67010488-67010510 GCTCCCTGGACAAAGCCTCCAGG + Intergenic
1192254346 X:69443052-69443074 ACTCCCAGGACAGAGCCCCCAGG - Intergenic
1192353795 X:70380660-70380682 ACTTCCTGGTTAGAACCTCCAGG - Intronic
1192891903 X:75399249-75399271 ACTCCCTGGACAGAGCCTCCAGG + Intronic
1192926410 X:75759279-75759301 ACTCCCTGGACAGAGTTTCCAGG + Intergenic
1192930238 X:75799202-75799224 CCTCACTGGGCAGGGCCTCCTGG - Intergenic
1193061714 X:77214457-77214479 ACTCCCTGGACAGAGCCTCCAGG - Intergenic
1193482667 X:82046676-82046698 ACTCCCTGGGCAGAACCTTCAGG + Intergenic
1193714915 X:84926852-84926874 ACTCCCTGTGCAGAGCCTCCAGG - Intergenic
1193739674 X:85202921-85202943 ACTCTCTGGACAGAGGCCCCAGG - Intergenic
1193789132 X:85797343-85797365 ACCCCCTGGACAGAGCTTCCAGG - Intergenic
1193805201 X:85985947-85985969 ACTCCCTGGACAGAGCCCCCAGG + Intronic
1194055602 X:89127859-89127881 ACTCCCTGGTCAGAGCTTCCAGG - Intergenic
1194067736 X:89283686-89283708 AATTCCTGGACAGAGCCTCCAGG - Intergenic
1194247920 X:91537979-91538001 ACTCCCTGGACAGAGCCTCCAGG + Intergenic
1194366374 X:93019009-93019031 CCTCACTGGGCAGAGCCTCCTGG + Intergenic
1194593963 X:95835744-95835766 ATTCCCTGGACAGAGCCTCCAGG - Intergenic
1194781467 X:98029368-98029390 ACTCCCTGGACAGAGCCTTTAGG - Intergenic
1194854683 X:98914832-98914854 ACTACCTGGACAGAGCCTCCAGG - Intergenic
1194917521 X:99723373-99723395 ACTCCCTGGACAGAGCCTCCAGG + Intergenic
1194948060 X:100091893-100091915 ACTCCCTGAACAGAGTCTCCAGG + Intergenic
1195361175 X:104085053-104085075 ACTTCCTGGACAGAGTCCCCAGG - Intergenic
1195765116 X:108287873-108287895 ATTACCTGGACAGAGTTTCCCGG - Intronic
1196152654 X:112392185-112392207 ACTCCCTGGACAGAGCCCCCAGG - Intergenic
1196227940 X:113188653-113188675 ACTCCCTGGACAGAGCCTCCGGG - Intergenic
1196528852 X:116759617-116759639 ACTCCCTGAACAAAGACCCCAGG + Intergenic
1196932624 X:120696432-120696454 GCTCCCTGTGCAGATCCTCCAGG + Intergenic
1197076956 X:122364246-122364268 ACTCCCTGGACAGAGCTTCCAGG - Intergenic
1198862707 X:141088148-141088170 ACTCCATAGACAGAGCAGCCCGG + Intergenic
1198899986 X:141499238-141499260 ACTCCATAGACAGAGCAGCCCGG - Intergenic
1199249029 X:145638180-145638202 ACTCCCCAGACAGAGCCTCCAGG + Intergenic
1199307013 X:146279089-146279111 ACTCTCTGGATAGAGCCCCTAGG - Intergenic
1199593988 X:149492559-149492581 ACTCCCTGGATAGACCCACCAGG - Intronic
1200566936 Y:4779508-4779530 ACTCCCTGGACAGAGCCTCCAGG + Intergenic
1200674601 Y:6135271-6135293 CCTCACTGGGCAGAGCCTCCTGG + Intergenic
1200721884 Y:6617847-6617869 AATTCCTGGACAGAGCCTCCAGG - Intergenic
1200847871 Y:7850440-7850462 ACTCCATGGACAGAGCTTCTGGG + Intergenic
1200899744 Y:8417442-8417464 ACTTCCTGGACAGAGCCTATAGG + Intergenic
1201080825 Y:10243001-10243023 ACTCCCTGGTCAGAGGAACCCGG + Intergenic
1201416825 Y:13755316-13755338 ATGCCCTGGACAAAGCATCCTGG - Intergenic
1202250406 Y:22865237-22865259 ACTTCCTGGACACAGCCTCTAGG + Intergenic
1202269192 Y:23053950-23053972 ACTCCATGGACACAGCTTCCAGG - Intergenic
1202403395 Y:24498985-24499007 ACTTCCTGGACACAGCCTCTAGG + Intergenic
1202422184 Y:24687690-24687712 ACTCCATGGACACAGCTTCCAGG - Intergenic
1202448602 Y:24982388-24982410 ACTCCATGGACACAGCTTCCAGG + Intergenic
1202467384 Y:25171096-25171118 ACTTCCTGGACACAGCCTCTAGG - Intergenic