ID: 934623222

View in Genome Browser
Species Human (GRCh38)
Location 2:95829084-95829106
Sequence GTAGCAACTCAGCCACTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934623222_934623228 1 Left 934623222 2:95829084-95829106 CCAGGGAGTGGCTGAGTTGCTAC No data
Right 934623228 2:95829108-95829130 GGCTCGACAGCTCTGGCAGGGGG No data
934623222_934623232 19 Left 934623222 2:95829084-95829106 CCAGGGAGTGGCTGAGTTGCTAC No data
Right 934623232 2:95829126-95829148 GGGGGGTTAGGTAGAGGCCCAGG No data
934623222_934623231 13 Left 934623222 2:95829084-95829106 CCAGGGAGTGGCTGAGTTGCTAC No data
Right 934623231 2:95829120-95829142 CTGGCAGGGGGGTTAGGTAGAGG No data
934623222_934623226 -1 Left 934623222 2:95829084-95829106 CCAGGGAGTGGCTGAGTTGCTAC No data
Right 934623226 2:95829106-95829128 CTGGCTCGACAGCTCTGGCAGGG No data
934623222_934623227 0 Left 934623222 2:95829084-95829106 CCAGGGAGTGGCTGAGTTGCTAC No data
Right 934623227 2:95829107-95829129 TGGCTCGACAGCTCTGGCAGGGG No data
934623222_934623225 -2 Left 934623222 2:95829084-95829106 CCAGGGAGTGGCTGAGTTGCTAC No data
Right 934623225 2:95829105-95829127 ACTGGCTCGACAGCTCTGGCAGG No data
934623222_934623224 -6 Left 934623222 2:95829084-95829106 CCAGGGAGTGGCTGAGTTGCTAC No data
Right 934623224 2:95829101-95829123 TGCTACTGGCTCGACAGCTCTGG No data
934623222_934623229 2 Left 934623222 2:95829084-95829106 CCAGGGAGTGGCTGAGTTGCTAC No data
Right 934623229 2:95829109-95829131 GCTCGACAGCTCTGGCAGGGGGG No data
934623222_934623230 7 Left 934623222 2:95829084-95829106 CCAGGGAGTGGCTGAGTTGCTAC No data
Right 934623230 2:95829114-95829136 ACAGCTCTGGCAGGGGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934623222 Original CRISPR GTAGCAACTCAGCCACTCCC TGG (reversed) Intergenic
No off target data available for this crispr