ID: 934623226

View in Genome Browser
Species Human (GRCh38)
Location 2:95829106-95829128
Sequence CTGGCTCGACAGCTCTGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934623220_934623226 13 Left 934623220 2:95829070-95829092 CCTGGAGGCTCTGTCCAGGGAGT 0: 23
1: 44
2: 53
3: 68
4: 328
Right 934623226 2:95829106-95829128 CTGGCTCGACAGCTCTGGCAGGG No data
934623222_934623226 -1 Left 934623222 2:95829084-95829106 CCAGGGAGTGGCTGAGTTGCTAC No data
Right 934623226 2:95829106-95829128 CTGGCTCGACAGCTCTGGCAGGG No data
934623218_934623226 15 Left 934623218 2:95829068-95829090 CCCCTGGAGGCTCTGTCCAGGGA 0: 21
1: 37
2: 41
3: 97
4: 483
Right 934623226 2:95829106-95829128 CTGGCTCGACAGCTCTGGCAGGG No data
934623219_934623226 14 Left 934623219 2:95829069-95829091 CCCTGGAGGCTCTGTCCAGGGAG 0: 21
1: 37
2: 45
3: 69
4: 356
Right 934623226 2:95829106-95829128 CTGGCTCGACAGCTCTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934623226 Original CRISPR CTGGCTCGACAGCTCTGGCA GGG Intergenic
No off target data available for this crispr