ID: 934625612

View in Genome Browser
Species Human (GRCh38)
Location 2:95847966-95847988
Sequence GAGCTTTCTGTTCAGGTTAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 170}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934625612 Original CRISPR GAGCTTTCTGTTCAGGTTAT CGG Intronic
900075817 1:816807-816829 GAGTTTTCTGTTCTGTTCATTGG - Intergenic
904569197 1:31448488-31448510 GGGCTCTCTGTTCTGGTTATTGG + Intergenic
907544868 1:55250881-55250903 GAGATCTCTGACCAGGTTATTGG - Intergenic
910819481 1:91330460-91330482 TATTTTTCTGTTCAGGTTTTGGG - Intronic
916810859 1:168304427-168304449 GAGATATCTTTTCAGGTTTTTGG - Intronic
919739013 1:200971535-200971557 AAACTTTCTGTTCAGGTTGGCGG + Intronic
922069821 1:222180880-222180902 GAGGTGTCTGTTAAGGTTTTTGG - Intergenic
1063032610 10:2250786-2250808 GAGGTGTCTGTTCAGGTCCTTGG + Intergenic
1063288766 10:4718422-4718444 GAGATTTTTTTTCAGGTTCTAGG + Intergenic
1065650428 10:27883282-27883304 GAGGTTTCTACTCAGCTTATTGG - Intronic
1066198279 10:33122792-33122814 GAGCATTCTGTTCAGGCCACAGG - Intergenic
1072115953 10:92370451-92370473 GAGGTTTCTGTTCAGATCTTTGG - Intergenic
1074928736 10:118101613-118101635 GAGCTTTTCATTCAAGTTATGGG - Intergenic
1076943719 10:133628218-133628240 TAGCTTTCTATTGAGTTTATAGG - Intergenic
1079019140 11:16894715-16894737 GGGCTCTCTGTTAGGGTTATGGG - Intronic
1079935525 11:26611197-26611219 GAGCTGCATGGTCAGGTTATTGG + Intronic
1081695172 11:45104686-45104708 GAGGTTTCTGGGCAGGTTTTAGG - Intronic
1082667819 11:55995893-55995915 GTGCTATTTGCTCAGGTTATAGG - Intergenic
1084061943 11:66681484-66681506 CATCTTTCTTTTCAGGTTGTAGG + Intergenic
1086091052 11:83005148-83005170 GAGCTTTCTCTTGAGGTTGTTGG - Intronic
1087754958 11:102045467-102045489 GTTCTTTCTATTCAGTTTATTGG - Intergenic
1088047216 11:105468762-105468784 GTGCATACTGTTCAGGTGATGGG - Intergenic
1088371589 11:109094624-109094646 GAGCTTTCTGCCCAGTTTGTTGG + Intergenic
1091120267 11:133051694-133051716 GAGCTTTGTGTTATGGTTGTGGG - Intronic
1094038589 12:26098265-26098287 GAAATGTCTGTTCAGGTTCTTGG - Intergenic
1094087930 12:26614214-26614236 GAGCTCTCTGGTCAGGTTTCAGG - Intronic
1095159423 12:38899372-38899394 GAGCTTTTTTTTCAGGTTACAGG - Intronic
1097911015 12:64969217-64969239 CAGCTTCCTGGTCTGGTTATGGG + Intergenic
1098837244 12:75438220-75438242 GAGCTGTCTGTTAAGGTTTGAGG - Intergenic
1100455767 12:94750270-94750292 GAGGTTTCTGCTCAGGTTGAGGG - Intergenic
1100678292 12:96892233-96892255 AAACATTCTGTTCAGTTTATTGG - Intergenic
1102824438 12:115935963-115935985 GAGGTATCTGTTAAGGTTTTTGG - Intergenic
1102844909 12:116170209-116170231 GATCTTTCTGCTGAGATTATTGG - Intronic
1105631360 13:22172326-22172348 GAGCTGTCTATTCAGGTCATGGG + Intergenic
1106277075 13:28220494-28220516 GAGCTTTATGTTCTAGTTTTTGG + Intronic
1106637765 13:31547852-31547874 GAGATGTCTGTTCAGATTGTTGG + Intergenic
1106803753 13:33284861-33284883 GAGTTTTGTGTGCAGGTTACGGG + Intronic
1107455857 13:40553987-40554009 GGGCTTTCTGTTCAAGTGCTTGG - Intergenic
1111168739 13:84497628-84497650 GAATTTACTGTGCAGGTTATAGG - Intergenic
1112035069 13:95489532-95489554 GAGCTGTCTGTTCATGTCCTTGG + Intronic
1116143447 14:41032013-41032035 GAGCATTTTTTTCATGTTATTGG + Intergenic
1117025497 14:51615973-51615995 GATCTTTCCTTTCAGATTATAGG - Intronic
1118160542 14:63285333-63285355 AAGGTTTCTTTTCAGATTATAGG - Intronic
1118990378 14:70792153-70792175 GAGCATCCTGTTCAGTTGATGGG - Intronic
1202894517 14_KI270722v1_random:191711-191733 GAGGTATCTGTTAAGGTTTTTGG + Intergenic
1123960167 15:25389983-25390005 GAGGTGTCTGTTAAGGTTGTTGG - Intronic
1127032684 15:54881170-54881192 GTGCAGTCTGTGCAGGTTATGGG + Intergenic
1128217424 15:65944210-65944232 GAGCTTTCTGTTTAGTAGATGGG + Intronic
1128626318 15:69209070-69209092 GAGCTTTTTATTTTGGTTATTGG + Intronic
1129920966 15:79318828-79318850 GAGCTTTCTTTTCTGGTGGTTGG + Intronic
1130415295 15:83688352-83688374 CGGCTTTCTTTTCATGTTATGGG - Intronic
1132039758 15:98515277-98515299 GAGCTTTCTGTCGAGGTTCAGGG - Intergenic
1133071382 16:3248896-3248918 GAGCTTTCTGGTAAGGTCAGAGG - Exonic
1134327992 16:13224638-13224660 GAGCTTTATATTCTGGTTAAGGG + Intronic
1136641858 16:31572388-31572410 GAGCTTTTTGTTGCTGTTATTGG - Intergenic
1136663524 16:31787269-31787291 GAGCTTTTTGTTGTTGTTATTGG + Intronic
1138242887 16:55443005-55443027 GAGCTTGCTCTTGAGGTTTTGGG - Intronic
1138631988 16:58303833-58303855 GTGCATACTGTTCAGGTGATGGG - Intronic
1139629772 16:68222911-68222933 GTGTTTTCTGTGCAGGTTCTGGG - Intronic
1144360522 17:14487426-14487448 GAAATTTCTGTTCAGTATATCGG + Intergenic
1144791522 17:17862177-17862199 GAGCTTTCTGTTCAGCCTAAAGG - Intronic
1147567215 17:41545167-41545189 GAGCTTTCTGTTCTGTTTTTTGG + Intergenic
1151464328 17:74274740-74274762 GAGCTTTCTGCTCAGGATAGAGG + Intronic
1151539046 17:74755374-74755396 GGGCTCTCTGTGCAGGTTCTGGG - Intronic
1153560067 18:6362754-6362776 GCACTTTCTGTACAGGGTATTGG + Intronic
1156358175 18:36360708-36360730 GAGGTTTCTGTACAGTTTGTGGG + Intronic
1156630836 18:38966517-38966539 GTTCTCTCTGTTCAGGTTCTTGG - Intergenic
1157506837 18:48232310-48232332 GGGCTCTCTCTTAAGGTTATAGG - Intronic
1158044106 18:53134507-53134529 GAGATTTGTTTTCAGGTTATTGG + Intronic
1159560557 18:69988450-69988472 GAGCTTTCTCTGGAGGTTTTTGG - Intergenic
1160056533 18:75487408-75487430 GCTCTCTTTGTTCAGGTTATGGG - Intergenic
1160414900 18:78702456-78702478 GAGCTTTGATTTCAGGTTGTTGG + Intergenic
1165321333 19:35087065-35087087 GAGGTGTCTGTCCAGGTTAATGG + Intergenic
1165983015 19:39741355-39741377 GAATTTTCTGTTCAGGTCCTTGG + Intergenic
925194855 2:1914665-1914687 CAGCTTTCTGTACAGATTATCGG + Intronic
926435219 2:12830333-12830355 CAGTTTTATGTTTAGGTTATAGG + Intergenic
927223793 2:20741078-20741100 GAGGTATCTGTTAAGGTTTTTGG + Intronic
931337852 2:61366580-61366602 AAGCTTTCATTTCAGGTTGTAGG - Intronic
932814096 2:74848021-74848043 GAGCTTTCTGTTCCTGGAATTGG + Intronic
934625612 2:95847966-95847988 GAGCTTTCTGTTCAGGTTATCGG + Intronic
934807959 2:97253351-97253373 GAGCCGTCTGTTCAGGTTATCGG - Intronic
934829551 2:97503836-97503858 GAGCCGTCTGTTCAGGTTATCGG + Intronic
937095534 2:119232985-119233007 TTGCTTTCTGCTTAGGTTATAGG - Intronic
938301628 2:130218356-130218378 TTGCTTTCTGTTGATGTTATAGG + Intergenic
938455076 2:131456097-131456119 TTGCTTTCTGTTGATGTTATAGG - Intergenic
939625734 2:144474635-144474657 GAGGATTCTGATCTGGTTATAGG + Intronic
940062286 2:149586011-149586033 TCTCTTTCTGTGCAGGTTATGGG + Intronic
940163865 2:150745997-150746019 GAGGTGTCTGTTAAGGTCATCGG - Intergenic
941294672 2:163721778-163721800 GAGCTTTCAGTAAAGGTTATAGG + Intronic
944707630 2:202307283-202307305 GAGCTTTCTCTTAATGCTATTGG - Intergenic
944940151 2:204616306-204616328 GAGGTGTCTGTTCAGGTCTTTGG - Intronic
945327786 2:208502586-208502608 GAGGTTTCTGTTAAGGTCTTTGG + Intronic
945863419 2:215149660-215149682 GAGCTTTATGCTGAGCTTATTGG + Intergenic
946574789 2:221063236-221063258 GAGATTTCTTTTCAGGGAATAGG + Intergenic
946600388 2:221353751-221353773 GAGGCTTCTGTTCCGGTGATGGG - Intergenic
949081899 2:242107899-242107921 GAGTTTTCTGTTCTGTTCATTGG + Intergenic
1169998386 20:11585530-11585552 GAGTTTTCTGTTCTCGTTCTGGG + Intergenic
1177639269 21:23825693-23825715 GAGCATTCAGTTCAGTTTCTTGG + Intergenic
1183517620 22:38276293-38276315 GGGCTTTCAGTTCAGGGTCTTGG + Intergenic
1183766300 22:39879141-39879163 GAGGTGTCTGTTAAGGTTTTAGG - Intronic
1184396134 22:44242580-44242602 GAGCTGTCTGTTCTGTTCATTGG + Intergenic
949879164 3:8648408-8648430 TTGCTTTCTGTTCAGCTGATTGG - Intronic
953577540 3:44125208-44125230 GAGGTATCTGTTCAGGTCTTTGG - Intergenic
955775496 3:62428233-62428255 GAGCCTTCTTTTCAGGTTTTTGG + Intronic
960019593 3:112933359-112933381 CAGCCTGCTTTTCAGGTTATGGG - Intronic
960208543 3:114932217-114932239 CAGCTTGCTGTACAGGTTACAGG - Intronic
961723295 3:128909874-128909896 CACCTTTCTCTTCAGGTTGTGGG - Exonic
962112294 3:132465356-132465378 GAGCTTTCAGTTAAGGTGACAGG + Intronic
964996639 3:162890865-162890887 GAGATGTCTGTTCAGGATTTTGG - Intergenic
966695786 3:182789643-182789665 GAATTTTCTGATCAGGTTAATGG - Intergenic
967567706 3:190991302-190991324 CTGCTTTCTGTTGAGTTTATGGG + Intergenic
968447826 4:661315-661337 GTGCTTTCTGTTTAGGTGATGGG - Intronic
973553448 4:52058129-52058151 GAGATAGCTGTTCAGGCTATGGG + Intronic
975458242 4:74618712-74618734 GAGCTTTGTGGCCAGGTTATAGG - Intergenic
975590601 4:75996006-75996028 GAGATTTCTGTTTAGTTTGTGGG - Intergenic
975772485 4:77742039-77742061 TAGCTTTCTGTTGATTTTATAGG + Intronic
976173577 4:82329670-82329692 GAGCTTTCTGTTCTTATTTTAGG - Intergenic
976703761 4:88000424-88000446 AAGGTGTCTGTTCAGGTTGTTGG - Intergenic
977304965 4:95312097-95312119 GTGCTTTCTTTTCTGGTTTTGGG - Intronic
980564058 4:134515229-134515251 AAGCATACTGTTAAGGTTATTGG + Intergenic
980804217 4:137790890-137790912 GAGCATTATGCTCAGGTTATTGG + Intergenic
985447074 4:190028680-190028702 TAGCTTTCTATTGAGTTTATAGG - Intergenic
985762368 5:1756428-1756450 GGGTTTTCTGTTCTGGTTAAGGG + Intergenic
988080379 5:26407316-26407338 GGGCTTTCTCTTCAAGATATTGG + Intergenic
989988312 5:50730142-50730164 GAGCTCTCAGTTCAGATTTTAGG + Intronic
990007623 5:50962646-50962668 GATATTTTTTTTCAGGTTATTGG - Intergenic
990056454 5:51586569-51586591 GAGCTTTCTGTTAAGACTGTGGG + Intergenic
991370744 5:65916831-65916853 TCCCTTTCTGTTCAGGTCATGGG + Intergenic
992761383 5:79953753-79953775 GAGCTGATTGTTCAGGTTAGGGG - Intergenic
993701752 5:91127052-91127074 GTGCTCTTTGTTCAGGTTGTTGG - Intronic
994871362 5:105353105-105353127 GAACTTTCTATTCAGAATATTGG - Intergenic
994941153 5:106326059-106326081 GAGCTTTCTGTTCAGAAAGTAGG + Intergenic
995267510 5:110180629-110180651 AAGCTCTCTGTTCAGGCCATGGG + Intergenic
995818458 5:116199265-116199287 GAGGTTTCTGTTTAGGTTTTTGG + Intronic
996546923 5:124689581-124689603 GAGCTGACTGTTAAGGTTTTTGG - Intronic
997184540 5:131868481-131868503 GAGGTGTCTGTTCAGGTCTTTGG + Intronic
998260921 5:140631495-140631517 GGGCTTTCTGAGCAGATTATTGG - Intergenic
1000721863 5:164718315-164718337 GAGCTTTATATTTAGGTGATGGG - Intergenic
1001960060 5:175874564-175874586 GAGTTTTCAGTTGAGGTGATTGG + Intronic
1002591935 5:180296331-180296353 GAGCTGTCTGTTCAGATTCAAGG - Intergenic
1003467143 6:6391575-6391597 CCCCTTTCTGTTCAGGTTTTGGG + Intergenic
1006528328 6:34627679-34627701 GAGATATCTGTTCAGGTCTTTGG + Intronic
1008292563 6:49735649-49735671 AAGCTTTATAATCAGGTTATAGG + Intronic
1008735510 6:54538889-54538911 GGGCTATCTGTTTGGGTTATGGG + Intergenic
1011874943 6:91947637-91947659 GAGGTGTATGTTCAGGTTTTTGG - Intergenic
1014524315 6:122482919-122482941 GAGCTTGCTGTTAAGTTTCTTGG + Intronic
1020211667 7:6162786-6162808 GAGCTTTCTGTTTTGGGTGTTGG - Exonic
1020288541 7:6705290-6705312 GAACTTTCTGTGTAGGTTTTGGG - Intronic
1024717413 7:52095717-52095739 GAGGTTTCTGTTAAGGTCTTTGG - Intergenic
1028751879 7:94391907-94391929 GGGCATTCAGTTCAGGTTCTGGG + Intergenic
1032598777 7:133270806-133270828 CTGCTATCTGTTCAGGTTAAGGG + Intronic
1034950805 7:155296242-155296264 GAGCTTTCCCTTCTGCTTATCGG + Intergenic
1035539816 8:424692-424714 GAGTTTTCTGTTCTGTTCATTGG + Intronic
1037318222 8:17618942-17618964 GAGATTTCCGTTCAGGGTAAGGG + Intronic
1037503443 8:19507038-19507060 GAGCTTTCTGATCAGGAACTGGG + Intronic
1038248717 8:25882838-25882860 GAGCTCTATGCTCAGGCTATTGG - Intronic
1038664251 8:29523900-29523922 GAGCTATCGGTTAAGTTTATAGG - Intergenic
1038963949 8:32550552-32550574 TAGCATCCTGTTCAGGTAATAGG + Intronic
1039696612 8:39919492-39919514 GAGCAGTCTGCTCAGGATATAGG + Intronic
1039837963 8:41272013-41272035 TAGCTTTCTGTTCTTGTTTTAGG - Intronic
1040793600 8:51264102-51264124 GAGGTTTCTGTTAAGGTCTTTGG + Intergenic
1043134202 8:76500683-76500705 GGTCTTTCTGTTCAGGTCAGTGG + Intergenic
1044642339 8:94396490-94396512 GAGCTTTCTGTGGAGGTTACAGG - Intronic
1045668527 8:104519060-104519082 GTGTTTCCTGTTCAGGTTACAGG - Intronic
1046766882 8:118079450-118079472 GAGTTTCCTGTTCAGGTTTTAGG - Intronic
1046884389 8:119347719-119347741 GAGGTGTCTGTTCAGGTCTTTGG + Intergenic
1047553189 8:125899036-125899058 GTGCTTTCTGTTAAGTCTATTGG + Intergenic
1047626582 8:126663000-126663022 GAGGTGTCTGTTCAGGTCTTTGG - Intergenic
1049486249 8:142865171-142865193 GAGCTATCTGTTCAGTGGATGGG + Intronic
1051016890 9:12488812-12488834 GAGTTGTCTGTTCAGGTCATTGG - Intergenic
1052141562 9:24991630-24991652 GAGCCTACTGTTCAGGAGATGGG + Intergenic
1052268630 9:26603422-26603444 AAGCTTTAAGTTCAGTTTATAGG - Intergenic
1055105037 9:72503395-72503417 GAGGTTTCTGCTCAGTTTTTAGG - Intergenic
1056454973 9:86751426-86751448 GAGATATTTGTTCAGGTGATGGG + Intergenic
1056477823 9:86969855-86969877 GAGCGTTCTTTTCAGGTCAGTGG + Intergenic
1057875832 9:98753949-98753971 GAGCCGACTGTTCAGTTTATAGG - Intronic
1059150499 9:111945346-111945368 GGACTTTCTGTTGAGGTTTTTGG - Intergenic
1059811483 9:117860308-117860330 GATGTTTCTGTTCAGTTCATGGG + Intergenic
1061351028 9:130065065-130065087 GAGCTTTGGGGTGAGGTTATTGG - Intronic
1186868631 X:13747399-13747421 GAGTTTTCTGTTCTAGTTCTGGG + Intronic
1186930753 X:14386904-14386926 GAGGTGTCTGTTCATGTCATTGG + Intergenic
1187639018 X:21266237-21266259 GAGCTTTCCGTTTATGTTTTGGG - Intergenic
1187721132 X:22151849-22151871 GAGCTTTCTGTTCTGGACATCGG - Intronic
1188131347 X:26437152-26437174 GACCTTTCTCTTCAAGTTAAGGG + Intergenic
1189448343 X:41102681-41102703 GATCTTTCTTTTCAGTGTATTGG + Intronic
1193628241 X:83846558-83846580 TCCCTTTCTGTTCAGTTTATGGG - Intergenic
1193747624 X:85301028-85301050 GAACATTCTGTTCTGTTTATGGG + Intronic
1194038967 X:88916202-88916224 ATGCTTTCTGTTAAGGCTATGGG - Intergenic
1194593110 X:95825344-95825366 GAGGTGTCTGTTAAGGTTTTTGG - Intergenic
1196268527 X:113682356-113682378 GAGCTTTCTCTCCTGGTTTTAGG + Intergenic
1199326819 X:146508882-146508904 GAGTTTCCTGTTCTGGGTATGGG + Intergenic
1199828775 X:151528071-151528093 GAGCTTACTGTAGTGGTTATTGG + Intergenic