ID: 934625627

View in Genome Browser
Species Human (GRCh38)
Location 2:95848142-95848164
Sequence AAGGAAAAACAGAATGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2674
Summary {0: 3, 1: 0, 2: 12, 3: 244, 4: 2415}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934625627 Original CRISPR AAGGAAAAACAGAATGAGAA GGG Intronic
Too many off-targets to display for this crispr