ID: 934628455

View in Genome Browser
Species Human (GRCh38)
Location 2:95886758-95886780
Sequence ACATCCACGTTGATCGATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 3, 1: 0, 2: 0, 3: 4, 4: 59}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934628455 Original CRISPR ACATCCACGTTGATCGATTT AGG (reversed) Intronic
904969910 1:34411378-34411400 AAATCCAGGTTCATCTATTTGGG + Intergenic
908736354 1:67280951-67280973 ACAGCCATGTTGATCCATGTGGG + Intergenic
918367555 1:183824743-183824765 ACAACCACCTTGATCTCTTTAGG + Intronic
1081362489 11:42197564-42197586 AAATCCACGTTGTTGGAGTTTGG - Intergenic
1099091467 12:78315433-78315455 TTATCCACATTTATCGATTTAGG - Intergenic
1111018854 13:82419436-82419458 ACATCAACATTGATAGTTTTAGG + Intergenic
1119150187 14:72352000-72352022 ACATCCATGTTTATACATTTGGG + Intronic
1121744914 14:96280518-96280540 ACATCCACTTTGAACAATTAGGG - Intergenic
1136863822 16:33724066-33724088 ATATCCAAGATGATCAATTTAGG - Intergenic
1136863952 16:33725943-33725965 ATATCCAAGGTGATCAATTTAGG - Intergenic
1136865347 16:33746249-33746271 ATATCCAAGCTGATCAATTTAGG - Intergenic
1138374827 16:56555744-56555766 ACATCCACAGTGAGCGATTTGGG + Intergenic
1203125438 16_KI270728v1_random:1574081-1574103 ATATCCAAGGTGATCAATTTAGG - Intergenic
1203126709 16_KI270728v1_random:1592515-1592537 ACATCCAAGCTGATCAATTTAGG - Intergenic
1144875175 17:18393766-18393788 ACAGCAGCGTTGATCGCTTTGGG + Intergenic
1145157049 17:20550655-20550677 ACAGCAGCGTTGATCGCTTTGGG - Intergenic
926288375 2:11508793-11508815 ACAACCACGGTGAACGTTTTGGG - Intergenic
929615303 2:43302192-43302214 ACCTCAACTTTGATAGATTTGGG + Intronic
934628328 2:95884883-95884905 ATATCCAAGGTGATCAATTTAGG - Intronic
934628455 2:95886758-95886780 ACATCCACGTTGATCGATTTAGG - Intronic
934630617 2:95916685-95916707 ATATCCAAGGTGATCAATTTAGG - Intronic
934630754 2:95918557-95918579 ATATCCAAGGTGATCAATTTAGG - Intronic
934630896 2:95920436-95920458 ATATCCAAGGTGATCAATTTAGG - Intronic
934631144 2:95924198-95924220 ATATCCAAGCTGATCAATTTAGG - Intronic
934631399 2:95927913-95927935 ATATCCAAGGTGATCAATTTAGG - Intronic
934633864 2:95963065-95963087 ATATCCAAGCTGATCAATTTAGG - Intronic
934799761 2:97142100-97142122 ATATCCAAGCTGATCAATTTAGG + Intronic
934802638 2:97181072-97181094 ATATCCAAGGTGATCAATTTAGG + Intronic
934803019 2:97186657-97186679 ATATCCAAGCTGATCAATTTAGG + Intronic
934803154 2:97188550-97188572 ATATCCAAGGTGATCAATTTAGG + Intronic
934803294 2:97190440-97190462 ATATCCAAGGTGATCAATTTAGG + Intronic
934803431 2:97192320-97192342 ATATCCAAGGTGATCAATTTAGG + Intronic
934803855 2:97197927-97197949 ATATCCAAGGTGATCAATTTAGG + Intronic
934804820 2:97211009-97211031 ATATCCAAGGTGATCAATTTAGG + Intronic
934805069 2:97214765-97214787 ACATCCACGTTGATCGATTTAGG + Intronic
934805197 2:97216640-97216662 ATATCCAAGGTGATCAATTTAGG + Intronic
934832288 2:97540745-97540767 ATATCCAAGGTGATCAATTTAGG - Intronic
934832413 2:97542621-97542643 ACATCCACGTTGATCGATTTAGG - Intronic
934832654 2:97546376-97546398 ATATCCAAGGTGATCAATTTAGG - Intronic
934833181 2:97553890-97553912 ATATCCAAGCTGATCAATTTAGG - Intronic
934833299 2:97555763-97555785 ATATCCAAGCTGATCAATTTAGG - Intronic
934833564 2:97559499-97559521 ATATCCAAGGTGATCAATTTAGG - Intronic
938598893 2:132817265-132817287 ACATTTATGTTGATCGATGTTGG + Intronic
1175037156 20:56010504-56010526 ACAGCCAAGTTGATTGGTTTGGG - Intergenic
963217927 3:142771919-142771941 ACATTCACTTTGCTGGATTTAGG + Intronic
963314060 3:143739943-143739965 ACATCCATGTTGAGATATTTTGG + Intronic
967874848 3:194261022-194261044 ACATACAAGTGGATGGATTTTGG - Intergenic
974719526 4:65719552-65719574 ACATCCAAGTTGATGGTATTGGG - Intergenic
997587272 5:135050839-135050861 ACATCAATGTAGATCGCTTTGGG - Intronic
1001003379 5:168028744-168028766 ACATCAACCCTGCTCGATTTAGG - Intronic
1003432309 6:6050984-6051006 AAATCCACGTTGGTTAATTTGGG + Intergenic
1010437761 6:75854711-75854733 ACATCCAAATTGATCTATTTAGG + Intronic
1014343607 6:120238709-120238731 ACATGCACTTTTATCGAATTTGG - Intergenic
1018949100 6:168367228-168367250 ACATTCACATTGATCAACTTTGG + Intergenic
1018993344 6:168691727-168691749 GCGTCCACGTTGATCGCTTTGGG - Intergenic
1022194458 7:28050535-28050557 ACGTCCATGTTGTTAGATTTGGG + Intronic
1026932877 7:74234550-74234572 TCAGCCACGTTGATCTAGTTTGG + Intronic
1035270519 7:157717167-157717189 AAAGCCTCGTGGATCGATTTTGG - Intronic
1041969766 8:63726443-63726465 ACATACACCTTCATCTATTTAGG - Intergenic
1186640100 X:11446409-11446431 ACATCCATGTTGGTCCATATTGG - Intronic
1190680169 X:52819956-52819978 TCAACCACTTTGATCCATTTGGG - Intergenic
1194432390 X:93825468-93825490 ACATACACTTTTATTGATTTGGG - Intergenic
1194432464 X:93826646-93826668 ACATACACTTTTATTGATTTGGG + Intergenic
1196640891 X:118059487-118059509 ACATCCATTTTAAGCGATTTGGG + Intronic
1197733700 X:129834017-129834039 ACATCCAATGTGATGGATTTTGG + Intronic
1201247393 Y:12018778-12018800 ACATCCCAGTAGAACGATTTAGG + Intergenic