ID: 934636292

View in Genome Browser
Species Human (GRCh38)
Location 2:95992379-95992401
Sequence CCGGGCATGGGCTTCGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 2, 1: 3, 2: 2, 3: 9, 4: 145}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934636292_934636303 10 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG 0: 2
1: 3
2: 2
3: 9
4: 145
Right 934636303 2:95992412-95992434 GCAGACTGCCTGACTTGCCGCGG 0: 5
1: 2
2: 2
3: 7
4: 92
934636292_934636304 15 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG 0: 2
1: 3
2: 2
3: 9
4: 145
Right 934636304 2:95992417-95992439 CTGCCTGACTTGCCGCGGCCAGG 0: 5
1: 0
2: 2
3: 13
4: 123
934636292_934636306 19 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG 0: 2
1: 3
2: 2
3: 9
4: 145
Right 934636306 2:95992421-95992443 CTGACTTGCCGCGGCCAGGCTGG 0: 3
1: 2
2: 2
3: 11
4: 99
934636292_934636310 27 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG 0: 2
1: 3
2: 2
3: 9
4: 145
Right 934636310 2:95992429-95992451 CCGCGGCCAGGCTGGCCCCGGGG 0: 3
1: 1
2: 4
3: 41
4: 329
934636292_934636307 25 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG 0: 2
1: 3
2: 2
3: 9
4: 145
Right 934636307 2:95992427-95992449 TGCCGCGGCCAGGCTGGCCCCGG 0: 3
1: 2
2: 4
3: 42
4: 340
934636292_934636308 26 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG 0: 2
1: 3
2: 2
3: 9
4: 145
Right 934636308 2:95992428-95992450 GCCGCGGCCAGGCTGGCCCCGGG 0: 3
1: 1
2: 6
3: 56
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934636292 Original CRISPR CCGGGCATGGGCTTCGGCCG GGG (reversed) Intergenic
900176801 1:1294679-1294701 CTGGGCAGGGGCCTCGGGCGAGG + Intronic
900192384 1:1356916-1356938 CAGGGCATGGGCGTGGGCCAGGG + Intronic
900788486 1:4664571-4664593 CCGGTCATGCCCTTCTGCCGGGG + Intronic
901551322 1:9997743-9997765 CCGGGCAGAGGCTTCGGTCCCGG - Intronic
902624595 1:17669216-17669238 CCAGGCATGTGCTTTGGCTGAGG + Intronic
903263365 1:22142946-22142968 CGGGGCAGCGGCTGCGGCCGCGG + Exonic
904068460 1:27773501-27773523 CCCGGCTGGGGCTACGGCCGAGG + Intronic
904419063 1:30379764-30379786 CAGGGCCTGGGTTTCAGCCGTGG - Intergenic
905643706 1:39609875-39609897 GCGGGCTTGGACCTCGGCCGTGG + Intergenic
905800127 1:40837920-40837942 GAGGGCGGGGGCTTCGGCCGGGG - Intronic
905990696 1:42335013-42335035 CCGGGCCTGGGCGGCGGGCGAGG - Intronic
908293098 1:62687919-62687941 CCGGGCCTGGACTTCTGCGGAGG - Intronic
914885559 1:151581663-151581685 ACAGGCATGGGCTTCGGGCTAGG - Exonic
915563272 1:156699987-156700009 CCAGTGGTGGGCTTCGGCCGCGG + Exonic
920511856 1:206557507-206557529 CCGGGCTTGGGATGCGGCGGAGG - Intronic
923171715 1:231422428-231422450 CCGGGCCTCGGCTTCTGCCTCGG + Exonic
1062874016 10:931291-931313 CCGGGCCTGGGCCGGGGCCGGGG - Intronic
1064393275 10:14959608-14959630 CCGGGGTGGGGCTACGGCCGGGG - Intronic
1067168388 10:43883580-43883602 CTGGGCATGGGTCTGGGCCGGGG + Intergenic
1067478007 10:46578938-46578960 CCGGGCCTGGGCCTGGGCCAGGG + Intronic
1067616732 10:47762849-47762871 CCGGGCCTGGGCCTGGGCCAGGG - Intergenic
1073254108 10:102140071-102140093 CCGGGCTTGGGCTCGGGCCTGGG + Exonic
1076877625 10:133224259-133224281 CCGGCCCTGGGCCCCGGCCGTGG + Intronic
1077043748 11:535497-535519 CCGCGCATGGGCTCCGTCCGCGG + Exonic
1081863553 11:46347609-46347631 CCCGGCATGGGCGTCTCCCGCGG + Intronic
1081995033 11:47358851-47358873 CCGGGCCTGGGCTCCTGCCTGGG - Exonic
1082774513 11:57235253-57235275 CAGGGAATGGGCTGGGGCCGGGG - Exonic
1084086210 11:66856507-66856529 ACCGGCACGGGGTTCGGCCGTGG - Intronic
1084214693 11:67640957-67640979 CCGGGCATGGGGTTGGGCCAGGG - Intergenic
1089262613 11:117232818-117232840 CCGGGCATGGGGGTCGGGTGGGG + Intronic
1091000995 11:131910775-131910797 CGGGGCAGGGGCTGCGGCGGTGG - Intronic
1091124273 11:133082157-133082179 CCGGGCCTGGGCCTCCGCCTCGG + Intronic
1092155285 12:6278488-6278510 CCGGCCATGGGCGGCCGCCGCGG - Intergenic
1092239559 12:6828590-6828612 CGGGGCTTGGGCGCCGGCCGTGG + Exonic
1092894959 12:13001698-13001720 CCGGGCAATGCCTCCGGCCGCGG + Intergenic
1104929167 12:132329256-132329278 CCGGGCCTGGGCTTCAGCTTCGG + Intronic
1105927171 13:25018592-25018614 CCGGGCATGGGCTTCGGCCCAGG - Intergenic
1107102249 13:36606246-36606268 CTGGGCTTGGGCTTGGGCTGGGG + Intergenic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1107787056 13:43968373-43968395 CCCGGCATGGGCGTCTCCCGCGG + Intergenic
1113679013 13:112229375-112229397 CCAGGCCTGGGCTTCTGCCTTGG + Intergenic
1113931293 13:113970356-113970378 CCGGGCATGGGCACAGGTCGGGG - Intergenic
1114082199 14:19210975-19210997 CCGGGCATAGGCTTCTCCCTGGG - Intergenic
1114083472 14:19220367-19220389 CCGGACATGGGGTCCGGCTGGGG + Intergenic
1116886963 14:50231392-50231414 CCGGGCCGAGGCTACGGCCGAGG + Exonic
1122325887 14:100880444-100880466 CCGGGCATGGGCTTGGGACCTGG + Intergenic
1123025202 14:105420724-105420746 CTGGGCAGGGGCTTCCTCCGTGG + Intronic
1125589106 15:40843827-40843849 CTGGGTATGCGCTTCGGGCGCGG + Intergenic
1128153554 15:65377874-65377896 CGGGGCTGGGGCTCCGGCCGGGG + Exonic
1128257963 15:66212289-66212311 CTGGGCCTGGGGTTCGGCCGTGG - Intronic
1131144052 15:90000476-90000498 CAGGGCCTGGGCCTCGGCCCCGG - Intergenic
1132574884 16:659732-659754 CGGGGCCTGGGCTGCGGCAGTGG + Intronic
1132862429 16:2078197-2078219 CAGGGCATGGGCATGGGCCTGGG + Intronic
1133138567 16:3728946-3728968 CCTGGCATGGGCTGCTGCTGGGG + Exonic
1135415649 16:22266434-22266456 CCTGCCGAGGGCTTCGGCCGTGG + Exonic
1141521256 16:84581212-84581234 CTGGGCCTGGGCTCAGGCCGGGG - Intronic
1141620883 16:85235972-85235994 CCGGGCCTGGGCCTGGGCCTGGG + Intergenic
1142468335 17:148303-148325 CTGGGCCTGGGCCTCCGCCGGGG + Intronic
1142799705 17:2337536-2337558 CCGGGCAGTGGCTGCGGCGGCGG + Exonic
1143003778 17:3813439-3813461 GCGGGCAGGGGCTGCGGCCCGGG - Intronic
1147629150 17:41918879-41918901 CCGCGCACGGACTTCGGCAGAGG - Exonic
1147688502 17:42301060-42301082 GCTGGCATGGGCTGCGGCCCAGG - Intronic
1149571428 17:57675097-57675119 CCGGGCTCGGGCTTCGGCCACGG + Exonic
1150217080 17:63476920-63476942 CCGGGCAGGGGCGCGGGCCGGGG - Intergenic
1152594592 17:81232175-81232197 ATGGGCATGTGCTTCCGCCGCGG + Intronic
1153382332 18:4454342-4454364 CCGGGAATTGGCCTTGGCCGCGG + Intronic
1154992864 18:21612593-21612615 TCGGGCCTGGGCTTCCGCCTGGG + Intronic
1160451007 18:78966056-78966078 CCTGGCCTGGGCTTGGGCTGGGG - Intergenic
1160888882 19:1366481-1366503 CCGGGCCTGGACTCCTGCCGGGG - Intronic
1161029493 19:2051095-2051117 CCGGGGTCGGGCTTGGGCCGGGG + Exonic
1161203620 19:3029131-3029153 GCGGGCAGGGGCAGCGGCCGGGG + Exonic
1161333244 19:3698158-3698180 ACGGGCATGGGCCTCAGCAGGGG + Intronic
1161608745 19:5229445-5229467 CCGGGGACGGGCTCCGGGCGGGG - Intronic
1162033082 19:7925701-7925723 CCGGGCATGGGCGTAGCCCGGGG - Intronic
1165436916 19:35800560-35800582 CAGGGTATGGGCTTGGGCTGGGG + Intronic
1166293922 19:41879681-41879703 CCGGGCGAGGGCCTGGGCCGAGG + Intronic
1167040538 19:47020573-47020595 CCGGGGATGGGCTTGGGGGGCGG + Intronic
1167643684 19:50695045-50695067 CCGGGCCGGGGCTGGGGCCGCGG - Intronic
1168239300 19:55081352-55081374 TCGGGAATGGGCTTCGCCTGGGG - Exonic
1168384992 19:55955750-55955772 CGAGGCCTGCGCTTCGGCCGTGG + Exonic
931249936 2:60521357-60521379 CCGGGCCTGGGCCTGGGCCTGGG + Intronic
931652245 2:64479142-64479164 CAGGGCATGGGCTCTGGCAGAGG - Intergenic
933876154 2:86623478-86623500 TGGGGCCTGGGCTTCGGGCGCGG - Exonic
934113734 2:88765291-88765313 CTGGGCATGGGCTTCGGCCCGGG + Intergenic
934636292 2:95992379-95992401 CCGGGCATGGGCTTCGGCCGGGG - Intergenic
934797350 2:97113047-97113069 CCGGGCATGGGCTTCCGCCGGGG + Intergenic
934836054 2:97590392-97590414 CCGGGCATGGGCTTCGGCCGGGG - Intergenic
938135173 2:128750747-128750769 CGGGGCATGGGCCCCGGCCCAGG - Intergenic
944156491 2:196612533-196612555 CCTGGCATGGGCTGCAGCAGTGG + Intergenic
946921254 2:224584662-224584684 GCGGGCGTCGGCTGCGGCCGGGG - Intronic
1174373951 20:50113053-50113075 GGGGGCATGGGCTTGGGCCGGGG - Intronic
1176284635 21:5012845-5012867 CCGGGCAGGGACTGCGGCCTGGG + Intergenic
1176547782 21:8208965-8208987 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176574608 21:8436199-8436221 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176611221 21:8987491-8987513 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1176866255 21:14056577-14056599 CCTGGCATGGACTTTGGCCCTGG - Intergenic
1178534982 21:33403622-33403644 CCGGGCCTGGGCCTCCGCGGCGG + Intronic
1179872546 21:44250630-44250652 CCGGGCAGGGACTGCGGCCTGGG - Intronic
1180147835 21:45931054-45931076 CCGGCCATGGGAGGCGGCCGTGG + Intronic
1180294503 22:10872900-10872922 CCGGACATGGGGTCCGGCTGGGG - Intergenic
1180497309 22:15902314-15902336 CCGGACATGGGGTCCGGCTGGGG - Intergenic
1180498576 22:15911695-15911717 CCGGGCATAGGCTTCTCCCTGGG + Intergenic
1184698008 22:46150513-46150535 CCGGGCATGGGCCGTGGACGCGG + Intronic
1185245179 22:49769593-49769615 CCGGGCATGGGGACAGGCCGGGG + Intergenic
1185409639 22:50674882-50674904 CTGGGGCGGGGCTTCGGCCGCGG + Intergenic
1203252656 22_KI270733v1_random:125250-125272 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203260712 22_KI270733v1_random:170336-170358 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
949891158 3:8734482-8734504 CTGGGCATGGCCCTCGGCCTTGG - Intronic
950404512 3:12796511-12796533 CAGGGCAAGGGCTGGGGCCGGGG + Intronic
950921105 3:16695696-16695718 GCGGGCAGGGGCTTCGGAAGTGG - Intergenic
951982054 3:28576311-28576333 CGGGGGATGGGCTCCGGGCGCGG - Intergenic
954707635 3:52489515-52489537 CTGGGCAGGGGCCTCGGCTGGGG - Exonic
954733495 3:52685645-52685667 CCGGGGCGGGGCTTCCGCCGCGG + Intronic
957048807 3:75396257-75396279 CCGGGCATGGGCTTCGGCCCGGG - Intergenic
968647097 4:1746516-1746538 GCGGGCAGGGGCTTCAGCCTGGG + Intergenic
970416058 4:15858078-15858100 ACAGGCATGGGCTACTGCCGTGG + Intergenic
986015611 5:3754566-3754588 CAGGGCATGGGCTTTGGGGGTGG + Intergenic
986695946 5:10354137-10354159 CCGGGCAGGGGCCGGGGCCGGGG + Intronic
988264139 5:28928146-28928168 CCGGGCATGGGCTTTGGCCCGGG - Intergenic
992663553 5:78984739-78984761 CCGGGCATGCGCAGAGGCCGCGG + Intronic
993246596 5:85459743-85459765 GGGGGCAGGGGCTTCAGCCGTGG + Intergenic
996154936 5:120086882-120086904 CTGGGCATGGGCTTCAGCCATGG + Intergenic
998862625 5:146459101-146459123 CTGGGCTTGGGCTTGGGCCTGGG - Exonic
1003076718 6:2989006-2989028 CCGGGAGTGGGCGGCGGCCGAGG - Intronic
1004650160 6:17600537-17600559 CGGGGCCTGGGGTTCGGCCTGGG - Exonic
1006313461 6:33277344-33277366 CCGGGCCTGGGTCACGGCCGGGG - Exonic
1007669466 6:43539558-43539580 CCGGGCCGGGGCTGAGGCCGCGG - Intronic
1008545115 6:52577107-52577129 CTGGGCGGGGGCTGCGGCCGGGG - Intergenic
1017671845 6:156777224-156777246 CCGGGCTTGGGCTAAGGCTGGGG - Intergenic
1022573553 7:31476204-31476226 CCTGGGATGGGCTTCTGCTGTGG - Intergenic
1023262656 7:38373397-38373419 CCGGTCATGGGCCTCAGCCCAGG + Intergenic
1025988742 7:66478623-66478645 CTGGGCCTGGGCTTGGGCCTGGG - Intergenic
1026941591 7:74290401-74290423 CCGGGGAGGGGCGGCGGCCGCGG + Intronic
1030614759 7:111728293-111728315 CGGGGCAGGGGCCTGGGCCGCGG + Exonic
1034445984 7:151114694-151114716 CCGGGCCGGGGCCGCGGCCGGGG - Intronic
1035171731 7:157021059-157021081 GCGGGCCTGGGCTTGGGCCTGGG + Intergenic
1035666472 8:1384281-1384303 CCGGGCATAGGCCACGGCAGAGG - Intergenic
1035666586 8:1384707-1384729 CAGGGGATGGGCATAGGCCGGGG - Intergenic
1035666823 8:1385620-1385642 CAGGGGATGGGCATAGGCCGGGG - Intergenic
1035666855 8:1385745-1385767 CAGGGGATGGGCATAGGCCGGGG - Intergenic
1038828574 8:31033230-31033252 CCGGGCAGGGGCATCGCCCGCGG + Exonic
1048266389 8:132991129-132991151 CAGGGCATGACCTTCAGCCGAGG + Intronic
1049668523 8:143859346-143859368 CCGGGCCTGGGCCTGGGCCTGGG + Exonic
1049668939 8:143860948-143860970 CCGGGCCTGGGCCTGGGCCTGGG + Exonic
1049669354 8:143862550-143862572 CCGGGCCTGGGCCTGGGCCTGGG + Exonic
1049669766 8:143864143-143864165 CCGGGCCTGGGCCTGGGCCTGGG + Exonic
1049670181 8:143865751-143865773 CCGGGCCTGGGCCTGGGCCTGGG + Exonic
1049697303 8:143990496-143990518 GCGGGTAGGGGCTGCGGCCGTGG - Intronic
1049756350 8:144312797-144312819 CCGGGCATGAGCGTCGGGCCTGG + Intronic
1049757767 8:144318396-144318418 ACGGGCATGGCCTCCGGCTGTGG - Intronic
1053715574 9:40884670-40884692 CCGGACATGGGTTTTGGCCCGGG - Intergenic
1059331185 9:113536714-113536736 CCAGGGATGGGCTTGGGCCTGGG + Intronic
1060981260 9:127793605-127793627 GCGGGGATGAGCTTAGGCCGGGG + Intergenic
1062029770 9:134356951-134356973 CTGGGCATGGGCATGGGCCTTGG - Intronic
1062219119 9:135404819-135404841 CCAGGCCTGGGCTTAGGCTGGGG - Intergenic
1062550881 9:137086062-137086084 CCGGGCGTGAGGTTCGGCTGGGG + Intergenic
1203469059 Un_GL000220v1:108401-108423 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1203476880 Un_GL000220v1:152373-152395 CCGGGCCGGGGCCTCGGCCCCGG + Intergenic
1185610866 X:1392898-1392920 CCCGGCGGGGGCTGCGGCCGGGG + Intergenic
1190008123 X:46759154-46759176 CCGGGCCGGGGCTGCGCCCGGGG + Intronic
1200151272 X:153952557-153952579 CAGGGCCTGGGCTTCCTCCGTGG + Exonic