ID: 934636292

View in Genome Browser
Species Human (GRCh38)
Location 2:95992379-95992401
Sequence CCGGGCATGGGCTTCGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934636292_934636310 27 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934636310 2:95992429-95992451 CCGCGGCCAGGCTGGCCCCGGGG No data
934636292_934636304 15 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934636304 2:95992417-95992439 CTGCCTGACTTGCCGCGGCCAGG No data
934636292_934636307 25 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934636307 2:95992427-95992449 TGCCGCGGCCAGGCTGGCCCCGG No data
934636292_934636306 19 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934636306 2:95992421-95992443 CTGACTTGCCGCGGCCAGGCTGG No data
934636292_934636303 10 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934636303 2:95992412-95992434 GCAGACTGCCTGACTTGCCGCGG No data
934636292_934636308 26 Left 934636292 2:95992379-95992401 CCCCGGCCGAAGCCCATGCCCGG No data
Right 934636308 2:95992428-95992450 GCCGCGGCCAGGCTGGCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934636292 Original CRISPR CCGGGCATGGGCTTCGGCCG GGG (reversed) Intergenic