ID: 934636305

View in Genome Browser
Species Human (GRCh38)
Location 2:95992420-95992442
Sequence CAGCCTGGCCGCGGCAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934636305_934636312 -5 Left 934636305 2:95992420-95992442 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934636312 2:95992438-95992460 GGCTGGCCCCGGGGTCCGCGCGG No data
934636305_934636321 17 Left 934636305 2:95992420-95992442 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934636321 2:95992460-95992482 GCTGGAGGCGCAGGCCTGGTCGG No data
934636305_934636322 18 Left 934636305 2:95992420-95992442 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934636322 2:95992461-95992483 CTGGAGGCGCAGGCCTGGTCGGG No data
934636305_934636318 8 Left 934636305 2:95992420-95992442 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934636318 2:95992451-95992473 GTCCGCGCGGCTGGAGGCGCAGG No data
934636305_934636323 19 Left 934636305 2:95992420-95992442 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934636323 2:95992462-95992484 TGGAGGCGCAGGCCTGGTCGGGG No data
934636305_934636320 13 Left 934636305 2:95992420-95992442 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934636320 2:95992456-95992478 CGCGGCTGGAGGCGCAGGCCTGG No data
934636305_934636316 2 Left 934636305 2:95992420-95992442 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934636316 2:95992445-95992467 CCCGGGGTCCGCGCGGCTGGAGG No data
934636305_934636313 -1 Left 934636305 2:95992420-95992442 CCTGACTTGCCGCGGCCAGGCTG No data
Right 934636313 2:95992442-95992464 GGCCCCGGGGTCCGCGCGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934636305 Original CRISPR CAGCCTGGCCGCGGCAAGTC AGG (reversed) Intergenic