ID: 934638138

View in Genome Browser
Species Human (GRCh38)
Location 2:96009716-96009738
Sequence AGGTATCTGGGTGGGTGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 2, 1: 1, 2: 8, 3: 55, 4: 554}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934638138_934638151 30 Left 934638138 2:96009716-96009738 CCGCACCACCCACCCAGATACCT 0: 2
1: 1
2: 8
3: 55
4: 554
Right 934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG 0: 2
1: 1
2: 0
3: 4
4: 63
934638138_934638145 -7 Left 934638138 2:96009716-96009738 CCGCACCACCCACCCAGATACCT 0: 2
1: 1
2: 8
3: 55
4: 554
Right 934638145 2:96009732-96009754 GATACCTTTCCTTAGACAGGTGG No data
934638138_934638144 -10 Left 934638138 2:96009716-96009738 CCGCACCACCCACCCAGATACCT 0: 2
1: 1
2: 8
3: 55
4: 554
Right 934638144 2:96009729-96009751 CCAGATACCTTTCCTTAGACAGG 0: 2
1: 0
2: 1
3: 18
4: 107
934638138_934638149 23 Left 934638138 2:96009716-96009738 CCGCACCACCCACCCAGATACCT 0: 2
1: 1
2: 8
3: 55
4: 554
Right 934638149 2:96009762-96009784 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363
934638138_934638150 24 Left 934638138 2:96009716-96009738 CCGCACCACCCACCCAGATACCT 0: 2
1: 1
2: 8
3: 55
4: 554
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934638138 Original CRISPR AGGTATCTGGGTGGGTGGTG CGG (reversed) Intergenic
900095193 1:937397-937419 AGGTGACTGGGTGGGGGGGGGGG - Intronic
900613740 1:3555154-3555176 GGGTGGGTGGGTGGGTGGTGGGG - Intronic
901399109 1:9004072-9004094 AAGAATCTGGTTGGGTGCTGTGG + Intronic
901854399 1:12035281-12035303 AAGTACCTGGGAGGGTAGTGGGG - Intergenic
901961588 1:12830629-12830651 AGCTATTTGGGTGGCTGGTGTGG - Intronic
901968194 1:12885470-12885492 AGCTATTTGGGTGGCTGGTGTGG - Intronic
901976010 1:12944629-12944651 AGCTATTTGGGTGTCTGGTGTGG - Intronic
901976274 1:12946794-12946816 AGCTATTTGGGTGGCTGGTGTGG - Intronic
901983600 1:13055741-13055763 AGCTATTTGGGTGGCTGGTGTGG - Intronic
901985136 1:13069453-13069475 AGCTATTTGGGTGACTGGTGTGG + Intronic
901985402 1:13071610-13071632 AGCTATTTGGGTGGCTGGTGTGG + Intronic
901996407 1:13155157-13155179 AGCTATTTGGGTGGCTGGTGTGG - Intergenic
901996673 1:13157317-13157339 AGCTATTTGGGTGACTGGTGTGG - Intergenic
901998225 1:13171080-13171102 AGCTATTTGGGTGGCTGGTGTGG + Intergenic
901998488 1:13173183-13173205 AGCTATTTGGGTGGCTGGTGTGG + Intergenic
902008898 1:13254976-13254998 AGCTATTTGGGTGGCTGGTGTGG + Intronic
902009162 1:13257136-13257158 AGCTATTTGGGTGTCTGGTGTGG + Intronic
902016980 1:13316310-13316332 AGCTATTTGGGTGGCTGGTGTGG + Intronic
902176115 1:14652506-14652528 AGGTACATGGGTGGGTGGATAGG - Intronic
902413312 1:16224935-16224957 AGGTAGCTGGATGGGTGGGTGGG + Intergenic
902560755 1:17276045-17276067 ACGTATCTGGCTGGGTGCAGTGG + Intronic
902964237 1:19986823-19986845 AGGTTTCTGGCTGGGTGCAGTGG + Intergenic
903561512 1:24231590-24231612 TGCTATCAGGGTGGGTGCTGTGG - Intergenic
903707567 1:25298025-25298047 AGGTGGATGGGTGGGTGGAGGGG - Intronic
903719674 1:25395329-25395351 AGGTGGATGGGTGGGTGGAGGGG + Intronic
904120740 1:28196137-28196159 GGGTATGTGTGTGTGTGGTGGGG - Intergenic
905488286 1:38323245-38323267 GGGTGACTGGGTGGGTGGTAGGG + Intergenic
905958806 1:42025655-42025677 AGGTATCTGGGAGTGGGGTTAGG + Intronic
905971667 1:42146511-42146533 AGGTGTGTGTGTGTGTGGTGGGG - Intergenic
906290972 1:44618999-44619021 ATGTCTCTGGGTTGGTGATGGGG + Intronic
906436644 1:45802394-45802416 AGGCAACTGGATGGGTGGTAAGG + Intronic
906682189 1:47735903-47735925 AGGTATGGGGGTGGGTGCAGAGG + Intergenic
906684071 1:47751719-47751741 AAGTGGCTGGGTGGGTGGGGAGG + Intergenic
907311085 1:53539513-53539535 TGGTATGTGTGTGTGTGGTGTGG - Intronic
907350199 1:53823190-53823212 AGGTGTTTTGCTGGGTGGTGTGG - Intronic
907861348 1:58356731-58356753 AGATATTTGGCTGGGTGCTGTGG + Intronic
907992723 1:59598561-59598583 AGCAATCTGAGTGGGTGGGGAGG - Intronic
908432353 1:64071566-64071588 GTGTGTCTGTGTGGGTGGTGGGG - Intronic
909017433 1:70394798-70394820 AGCGATCCGGGTGGGGGGTGGGG + Intergenic
909712056 1:78662877-78662899 AGGTAGATGGTTTGGTGGTGTGG + Exonic
911294805 1:96102084-96102106 AATTAGCTGGCTGGGTGGTGTGG - Intergenic
911484100 1:98483913-98483935 AGGTGTCTAGGTAGGTGGAGAGG + Intergenic
911631585 1:100189563-100189585 AGACATCTGGGTGGGAGTTGTGG + Exonic
912028178 1:105205164-105205186 AGCTATCAGGGTGGGTGGTGGGG - Intergenic
912091499 1:106081736-106081758 AGGGATCAGGGTGGGTAGAGAGG - Intergenic
912302620 1:108533855-108533877 TGGGGTTTGGGTGGGTGGTGGGG - Intergenic
913364121 1:118016696-118016718 AGGGATATGCGTGGCTGGTGAGG - Intronic
915288639 1:154868502-154868524 AAATGTCTGGGTGGGGGGTGGGG - Intronic
916830293 1:168484053-168484075 AAATTTCTGGGTGGGTGGGGAGG + Intergenic
916986906 1:170201486-170201508 AGGTGTATGGGTGGGTGGCAGGG + Intergenic
917816498 1:178715118-178715140 AGGTATGTTGGGGGCTGGTGAGG + Intergenic
920242850 1:204566210-204566232 AGCTCTCTTGGTGGCTGGTGGGG - Intergenic
920306636 1:205022385-205022407 GGGGATATGGGTGTGTGGTGGGG - Exonic
920879183 1:209864376-209864398 TGGTGTGTGTGTGGGTGGTGGGG + Intergenic
921211172 1:212900016-212900038 AGGTATCCCAGTGGCTGGTGAGG - Intergenic
921602518 1:217121648-217121670 GGACATCTGGGAGGGTGGTGTGG + Intronic
921878316 1:220224971-220224993 AGGGATCTGGCTGGGTGGTGTGG - Intronic
921974844 1:221191284-221191306 ATGTATGGGGGTGGGGGGTGGGG - Intergenic
922231081 1:223687042-223687064 AGATTTCTGGGTGTTTGGTGAGG - Intergenic
922466776 1:225849838-225849860 AGGGATCTGACTGGCTGGTGGGG + Intronic
922567913 1:226612894-226612916 ATGTGTCTCGGTGGGGGGTGGGG + Intergenic
924523256 1:244823590-244823612 AATTATCTGGGTGGGTGTGGTGG + Intergenic
924802718 1:247339167-247339189 AAGTATCTGGCTGGGTGTGGTGG + Intergenic
924941132 1:248812968-248812990 AGGTAGCTGAGTGGGTGAGGGGG - Exonic
1063150976 10:3336008-3336030 AGGTGTCTGTGTGTGTGCTGGGG + Intergenic
1063255694 10:4324926-4324948 AGTTATCTAGGTGTGTGGAGAGG - Intergenic
1064199430 10:13272084-13272106 AGAGATCTGGTGGGGTGGTGGGG + Intergenic
1064940592 10:20730862-20730884 AGGTCTCTGTGTGAGTGTTGGGG - Intergenic
1064979876 10:21155418-21155440 AGGTTAGTGGGAGGGTGGTGAGG - Intronic
1068517623 10:58044028-58044050 AGAGATTTGGGTGGGTGTTGGGG + Intergenic
1070058193 10:72955099-72955121 AGGTAGCTGGCTGAGGGGTGTGG - Intergenic
1070080319 10:73179674-73179696 AGGTTTCTGGCTGGGTGCAGTGG - Intronic
1070304925 10:75234376-75234398 AGGTGTCTGGGCGGGAGGCGGGG + Intronic
1070664511 10:78333711-78333733 AGGTCTCCGTGTGTGTGGTGGGG + Intergenic
1071885764 10:89949034-89949056 AGGGGCCTGGGTGGGAGGTGGGG + Intergenic
1072336763 10:94403979-94404001 AGGTTGTTGGGGGGGTGGTGAGG + Intronic
1073911155 10:108346279-108346301 AGGTAGGAGGGTGGGTGGAGTGG + Intergenic
1074755088 10:116618530-116618552 AGGTTTCTGGCTGGGTGTGGTGG - Intergenic
1075023442 10:118967488-118967510 AGAGATGGGGGTGGGTGGTGGGG - Intergenic
1076019268 10:127057096-127057118 AGATATCTGTGTGGGACGTGGGG - Intronic
1076096054 10:127736084-127736106 AGGAATCTGGGGGGATGGGGAGG + Intergenic
1076359449 10:129876891-129876913 GGGTAGCTGGGTGGGGGGGGGGG - Intronic
1076725140 10:132409624-132409646 GGGTGGGTGGGTGGGTGGTGAGG - Intronic
1076829385 10:132986346-132986368 GCGGCTCTGGGTGGGTGGTGGGG + Intergenic
1077269060 11:1666548-1666570 GGGCCCCTGGGTGGGTGGTGGGG - Intergenic
1077271488 11:1684167-1684189 GGGCCCCTGGGTGGGTGGTGGGG + Intergenic
1077364138 11:2154760-2154782 GGGTGGCTCGGTGGGTGGTGAGG - Intronic
1077871836 11:6269565-6269587 AGGCATCTGGCTGGGTAGTGAGG + Intronic
1077915301 11:6607846-6607868 AGATATCTAGGTGGTTGGTTTGG + Intronic
1078703694 11:13717167-13717189 AGGGATCTGGGGCGGTGGTGGGG - Intronic
1079797486 11:24824074-24824096 TGGTACCTGGGTGGGTGTGGTGG + Intronic
1079979315 11:27132340-27132362 AGGTTTCTGGGTGGGTTCTTTGG - Intergenic
1080048857 11:27837949-27837971 AGGTATCATGCTGGGTGCTGAGG + Intergenic
1080082734 11:28239641-28239663 AGGTAGCTGGGAAGCTGGTGGGG - Intronic
1080515264 11:33014556-33014578 GGGTTTGTGGGTGGGAGGTGGGG - Intergenic
1080559276 11:33447481-33447503 AGGTAGATGGGTGGGTGGGTGGG - Intergenic
1080569913 11:33546428-33546450 ATGTAGCTGGGTTGGTGGGGGGG - Intronic
1080759423 11:35233774-35233796 AGCTTTCTGGGTGCCTGGTGGGG - Intergenic
1080941105 11:36919364-36919386 GGGTATCTTGCTGGATGGTGTGG - Intergenic
1081655642 11:44855742-44855764 GGGAAGGTGGGTGGGTGGTGTGG - Intronic
1081814689 11:45931957-45931979 AGGCTTGTGGGTGGGTGGAGTGG + Intronic
1081968355 11:47182983-47183005 AGGTATGTGGGGGGGCGGGGGGG - Exonic
1082028026 11:47586859-47586881 AGGCTTCAGGGTGGGTGGAGAGG + Intronic
1083189431 11:61039085-61039107 AGGTATCTGAATGGGTGTTTAGG + Intergenic
1083409393 11:62481477-62481499 AGGTTTGAGGGTGGGAGGTGTGG - Intronic
1083616923 11:64030897-64030919 AGGAAGGTGGGTGGGTGGTGGGG + Intronic
1083804925 11:65067801-65067823 AGGGAAGTGGGTGGGTGGTGTGG + Intronic
1083804958 11:65067912-65067934 ATGTTTCTGGGTGTGGGGTGGGG + Intronic
1084770534 11:71340256-71340278 AGGCTTCTGGGTGGGGTGTGGGG + Intergenic
1085667549 11:78428384-78428406 ACATATCTGGCTGGGGGGTGGGG + Intergenic
1085682248 11:78587913-78587935 AGGTATTTGGATGTGGGGTGTGG + Intergenic
1086701110 11:89901131-89901153 GGGTAACTGGGTTGGGGGTGGGG + Intergenic
1086705057 11:89943396-89943418 GGGTAACTGGGTTGGGGGTGGGG - Intergenic
1087187369 11:95215250-95215272 AGGTCTAGGGGTGGGGGGTGGGG + Intronic
1088672206 11:112153170-112153192 AGGTTCCCGGGTTGGTGGTGGGG - Intronic
1088843017 11:113642549-113642571 AAATATCTGGGTGGGTGGGTGGG + Intergenic
1089104973 11:115995146-115995168 AAATATCTATGTGGGTGGTGTGG - Intergenic
1090095769 11:123741033-123741055 GTGTATCTGGGTGTGTGCTGGGG + Intronic
1090193329 11:124792868-124792890 AGGTATCTGGAGGGGGGGAGGGG - Intronic
1090801362 11:130174500-130174522 AGGTGTGTGGGTGTGGGGTGGGG + Intronic
1090805101 11:130197793-130197815 AGGGAGGTGGGTGGGTGCTGGGG + Intronic
1091216727 11:133906873-133906895 AGGTGTTGGGGTGGGAGGTGGGG - Intergenic
1091218848 11:133919111-133919133 AGGTATACGGGGGGGGGGTGGGG + Intronic
1091517147 12:1196253-1196275 AGGCATTTGGGTGGGGGATGAGG - Intronic
1091689208 12:2584311-2584333 AGGTAGCTAGGAGGGTGATGGGG + Intronic
1091776795 12:3189939-3189961 AGGTGTCTGGATGGGTGGCAGGG - Intronic
1092046527 12:5434820-5434842 AGGGATGTGTGTGGGGGGTGGGG + Intronic
1092074809 12:5664254-5664276 AGGTAGATGGGTGGGTGGATGGG - Intronic
1092097048 12:5851398-5851420 AGGTGTCTGGCTGGGTGTGGTGG + Intronic
1092197971 12:6561535-6561557 AGGTAGCTAGCAGGGTGGTGAGG - Intronic
1092258710 12:6941075-6941097 AGGTATTTGGGTGGGGGGATGGG + Intronic
1092621335 12:10273821-10273843 AGTTATAAGGGTGGGTGGAGTGG + Intergenic
1094783328 12:33818219-33818241 AGGTGGGTAGGTGGGTGGTGGGG + Intergenic
1096168328 12:49444889-49444911 TGGTATCTGGCTGGGTGCAGTGG - Intronic
1096524578 12:52202850-52202872 GGGTGTCTGGGTGCCTGGTGTGG + Intergenic
1096749188 12:53748005-53748027 AGATATCTGGGTGGGAGAGGGGG + Intergenic
1096790170 12:54039514-54039536 AGGTATCAGGGAGGAGGGTGGGG - Intronic
1096908881 12:54962410-54962432 AGGTAAGTGGGTTGGAGGTGAGG - Exonic
1097203883 12:57303667-57303689 AGGTATCTGGGAGGCTGAGGTGG + Intronic
1097860653 12:64515391-64515413 AGGGATCTGGGGTGGAGGTGGGG - Intergenic
1098763942 12:74461089-74461111 AGGGATGTGGATGGGGGGTGTGG + Intergenic
1100089459 12:90953336-90953358 ATGACTATGGGTGGGTGGTGGGG - Exonic
1100700320 12:97140422-97140444 AGCTATCTGGGAGGCTGGGGTGG - Intergenic
1102535016 12:113575042-113575064 AGGCAGCTGGGAGGGTGGTAGGG - Intergenic
1103876424 12:124131004-124131026 AGGTTTCTGAGGGGGCGGTGTGG - Intronic
1104960478 12:132486414-132486436 AGGGACCTGGGCTGGTGGTGGGG + Intergenic
1106090966 13:26593110-26593132 ATGTATGTGGGTGGGGAGTGGGG + Intronic
1106758436 13:32844919-32844941 AGGCATATGTGTGAGTGGTGAGG - Intergenic
1107676114 13:42798905-42798927 AAGTATCTGGCTGGGTGCAGTGG + Intergenic
1108084063 13:46766709-46766731 AGGTTGCCGGGGGGGTGGTGGGG - Intergenic
1108116768 13:47137328-47137350 AGGCATCAAGATGGGTGGTGGGG - Intergenic
1108396743 13:49997223-49997245 AGGGATCTGCGTGGGTTGGGGGG + Intronic
1108440808 13:50451000-50451022 AGGTGTCTTGGTGGGTGGTGGGG + Intronic
1110463225 13:75770323-75770345 GGGGATGTGGGTGGGTGGTGTGG + Intronic
1111946066 13:94667269-94667291 ATGTCTCTGAGTGGGTGGAGAGG + Intergenic
1112045422 13:95591527-95591549 GGGCAACTGGGTGGGTGGTATGG - Intronic
1112151728 13:96772060-96772082 AGCTATCTGGGTTTGTGATGGGG + Intronic
1112173416 13:96996261-96996283 AGTTCTGTGGATGGGTGGTGGGG + Intergenic
1112883373 13:104136828-104136850 ATGTGTCTGGGCCGGTGGTGGGG + Intergenic
1113852306 13:113424775-113424797 GGGTATATGGATGGGTGGTTGGG - Intronic
1114482201 14:23042855-23042877 AGGCATCACGGTGGGTGGCGTGG - Exonic
1115472583 14:33783580-33783602 AGTTTTTTGGGGGGGTGGTGTGG + Intronic
1115852477 14:37598930-37598952 TCTTATCTGGGTGGGGGGTGGGG - Intronic
1116196943 14:41739270-41739292 AGCTATTTGGGAGGGTGGCGTGG + Intronic
1116604447 14:46971552-46971574 AGGTGTATGGGTGGGAGGAGGGG + Intronic
1116643401 14:47495267-47495289 AGGTAGGTGGGTGGGTGGTTGGG + Intronic
1116897891 14:50335010-50335032 AGGTAGCTGGCTGGGTGCGGTGG + Intronic
1116984296 14:51203435-51203457 GGGTATGTCTGTGGGTGGTGTGG + Intergenic
1117342725 14:54805733-54805755 ACATATCAGGGTGTGTGGTGTGG - Intergenic
1117399352 14:55344723-55344745 GGGGATGTTGGTGGGTGGTGGGG - Intronic
1117435669 14:55713207-55713229 AGGAATCTGGCTCTGTGGTGAGG + Intergenic
1119104420 14:71910711-71910733 AGGTGACTTCGTGGGTGGTGAGG + Intergenic
1119411942 14:74437696-74437718 AGGTATAGGGGTGGGAGCTGGGG - Intergenic
1119643764 14:76334196-76334218 AGGGGCCTGGGTGGGTGGCGAGG + Intronic
1121385915 14:93525155-93525177 AGGTAACTGGCTGGGTGTGGTGG + Intronic
1121627583 14:95397607-95397629 AGGTCTCTGTGTGTGTGGTGTGG + Intergenic
1122256640 14:100482954-100482976 ATGTTTCTGGCTGGGTGGCGTGG + Intronic
1122690720 14:103531004-103531026 GGGTGTCTGGGTGGGAGGGGTGG + Intronic
1122923604 14:104890056-104890078 AGGTTGCTGGGTGGGTGGATGGG + Intronic
1123430892 15:20215376-20215398 ATGTATCTGGCTGGGTGCAGCGG - Intergenic
1124244612 15:28058496-28058518 GGGTGGCAGGGTGGGTGGTGGGG - Intronic
1124631156 15:31338445-31338467 AGGCATCTGGCCAGGTGGTGCGG + Intronic
1125100156 15:35902964-35902986 AGGTATGTGGGCTGGTGGTGTGG + Intergenic
1125115458 15:36086248-36086270 ACATTCCTGGGTGGGTGGTGTGG - Intergenic
1125285035 15:38083442-38083464 ATGTATCTGGCTGGGTGCGGTGG - Intergenic
1125341783 15:38682787-38682809 AGGTAGCTGTGTGGTTAGTGGGG - Intergenic
1125727018 15:41873339-41873361 TGGGATCTGGGTGGGAAGTGGGG + Intronic
1125926147 15:43564846-43564868 TGGTATGTGGGTGGGTTTTGGGG - Exonic
1125939291 15:43664397-43664419 TGGTATGTGGGTGGGTTTTGGGG - Intronic
1127710882 15:61596965-61596987 GGGTATCTGGGAGGGAGGAGAGG - Intergenic
1127721677 15:61707970-61707992 AGGAAGCAGGGTGGGTGTTGGGG + Intergenic
1128798296 15:70480371-70480393 AGGTCTGGGGGTGGGGGGTGAGG - Intergenic
1129329494 15:74819855-74819877 AGGTAGACGGGTGGGTGGTGAGG - Intronic
1129334770 15:74845321-74845343 AGGGATCTGGGTGGGGGGTCAGG - Intronic
1129453076 15:75661463-75661485 AGCTATGTCGGGGGGTGGTGAGG - Exonic
1130712745 15:86299808-86299830 GGATATGTCGGTGGGTGGTGTGG + Intronic
1131271061 15:90947946-90947968 AGGGGTCTGGGTGGGGGTTGGGG + Intronic
1131545491 15:93312637-93312659 TGGTCTCTGAGTGGGTGGTGGGG + Intergenic
1132561401 16:596127-596149 AGGTCTCTCGCAGGGTGGTGTGG + Intronic
1133390239 16:5404154-5404176 AGATATGGGGGTGGATGGTGAGG + Intergenic
1133462723 16:6000891-6000913 AGGTAGGTGGGTGGGTGGGCGGG + Intergenic
1133613001 16:7450739-7450761 AGGTTGCTGAGTGGGTGTTGAGG + Intronic
1133908170 16:10040254-10040276 ATGTATCTGTGTGTGTGGTGTGG - Intronic
1133963315 16:10513056-10513078 GGGTATGTGGGTGGTTTGTGGGG + Intergenic
1134065491 16:11225632-11225654 AGGTCTCAGGCTGGATGGTGGGG - Intergenic
1136282858 16:29224113-29224135 AAGTAACAGGGTGGGTGGGGTGG - Intergenic
1136774947 16:32866941-32866963 GGGTTTCTGGGGGGGAGGTGAGG + Intergenic
1136895671 16:33994571-33994593 GGGTTTCTGGGGGGGAGGTGAGG - Intergenic
1137258435 16:46798633-46798655 AGGTACTTGGGAGGCTGGTGAGG + Intronic
1137297564 16:47110806-47110828 AGGTATTTGGTGGGGTGGGGGGG - Intronic
1138198016 16:55068496-55068518 AGGTATCTGTGTGGGGGGGGGGG - Intergenic
1138846038 16:60567738-60567760 AGGTATATGGGAGGTTGGGGAGG - Intergenic
1139795763 16:69481838-69481860 TGGTGTGTGGGTGGGTGATGGGG + Intergenic
1140052290 16:71492798-71492820 GGGTAACTGAGTAGGTGGTGAGG + Intronic
1140286735 16:73609954-73609976 GTGTGTGTGGGTGGGTGGTGGGG + Intergenic
1140295617 16:73706796-73706818 AGGGTTCTGGGTGGAGGGTGGGG - Intergenic
1140760055 16:78101954-78101976 AGGTAGTTGGGGGGGTCGTGAGG + Intronic
1141609679 16:85174345-85174367 AGCAATCCAGGTGGGTGGTGAGG + Intronic
1141993183 16:87621756-87621778 TGGGGTTTGGGTGGGTGGTGGGG + Intronic
1142087235 16:88190009-88190031 AAGTAACAGGGTGGGTGGGGTGG - Intergenic
1142225473 16:88875172-88875194 TGGCATCTGTGTGCGTGGTGTGG - Exonic
1203077365 16_KI270728v1_random:1129050-1129072 GGGTTTCTGGGGGGGAGGTGAGG + Intergenic
1143171953 17:4935500-4935522 AGGTACCTGGGTGGCTGAGGAGG + Intergenic
1143254321 17:5544343-5544365 AGGTATCTAGATCAGTGGTGGGG - Intronic
1143702596 17:8672419-8672441 AGGCATCAGGGTGGTGGGTGAGG - Intergenic
1143705974 17:8697893-8697915 ATGTATGTGGGTAGGAGGTGGGG + Intergenic
1145837908 17:27968645-27968667 TGTTACCTGGGTGGGTGGGGTGG - Intergenic
1146267061 17:31459785-31459807 AGGTATCTGGGGCCGTGGGGAGG - Intronic
1146513209 17:33468679-33468701 ATGTATGTGTGTGGGGGGTGGGG - Intronic
1146684576 17:34832680-34832702 AGGGCACTGGGTGGGTGGTGGGG + Intergenic
1147674992 17:42199058-42199080 AGGGAACTGGTTGGGTGGTTGGG - Intergenic
1147702409 17:42404331-42404353 CAGCAGCTGGGTGGGTGGTGTGG + Exonic
1148586268 17:48783124-48783146 AGGTGTGTGTGTGGGAGGTGGGG + Intronic
1148841158 17:50498253-50498275 AGGGATCTGGGAGGCAGGTGGGG - Intergenic
1149029166 17:52064485-52064507 AGAAATCTGGCTGGTTGGTGAGG - Intronic
1149559133 17:57595714-57595736 ATGAATCTGGGTGGGGGGTCGGG + Intronic
1150571561 17:66391397-66391419 AGGCATTTGGATGGGAGGTGAGG - Intronic
1151375300 17:73684409-73684431 AGGCATGTGAGTGGGAGGTGAGG + Intergenic
1151538724 17:74753322-74753344 AGGGAGCAAGGTGGGTGGTGGGG + Intronic
1151877287 17:76873965-76873987 TGTCATCTGGGTGGGTGCTGAGG + Intronic
1152175026 17:78781950-78781972 AGGGATGTGGGTGGCTGGGGCGG - Intronic
1152596997 17:81242627-81242649 AGGAAGCTGGGCGGGTGGGGGGG + Intergenic
1155081815 18:22418071-22418093 AGGTACCGGGGTGGGCAGTGTGG - Intergenic
1155661148 18:28249544-28249566 AGGAATCTGTTTGGTTGGTGAGG + Intergenic
1156371769 18:36477530-36477552 AGGTAGGTGGGTGGGTGGGTGGG - Intronic
1156504941 18:37584409-37584431 AGGTAATTGGGTGGGTGGGAGGG + Intergenic
1156592791 18:38510459-38510481 AGGTTTCTAGGTGGGTGGGATGG - Intergenic
1157248027 18:46071213-46071235 AGCTACCTGGGTGGGTGGTGGGG + Intronic
1157595752 18:48862690-48862712 AGGGATGAGGGTGGGGGGTGTGG + Intronic
1157701049 18:49761760-49761782 GGGTATGTGTGTGGGGGGTGGGG - Intergenic
1157867304 18:51197532-51197554 AGGTAACTAGGTGGGTGGGTGGG + Intronic
1159863940 18:73682669-73682691 AGTTTTGTGGGTGGGTGGTGGGG - Intergenic
1159911047 18:74147205-74147227 AGGTATCTGCTTGGGGGATGAGG + Intronic
1160380481 18:78451049-78451071 AGCTGACTGGGTGGGTGGGGTGG - Intergenic
1161228215 19:3157841-3157863 AGGTAGCCAGGTGGGAGGTGGGG - Exonic
1161373657 19:3927809-3927831 TTGTATCAGGGTGGGGGGTGTGG + Exonic
1161494441 19:4579892-4579914 AGGTTGTGGGGTGGGTGGTGGGG - Intergenic
1162078695 19:8206006-8206028 AGGGATCGGGGTGGAAGGTGAGG + Intronic
1162387804 19:10370528-10370550 TGGTATCTGGCTGGGTGCAGTGG + Intronic
1163571280 19:18083802-18083824 GGGTAGATGGGTGGATGGTGGGG - Intronic
1163571334 19:18084046-18084068 GGGTAAATGGGTGGATGGTGGGG - Intronic
1163722200 19:18903627-18903649 CGGGAGCTGGGTGGGAGGTGGGG - Intronic
1163906658 19:20154489-20154511 AGCTACCTGGGGGGGTGGGGGGG + Intergenic
1164338447 19:24358941-24358963 GGGTATTTGGGTGAGTGTTGAGG + Intergenic
1164534792 19:29077013-29077035 ATGTGTCTGAGTGTGTGGTGGGG - Intergenic
1165281686 19:34803329-34803351 AAGTATCTGGGTGGGTGTGAGGG + Intergenic
1165724598 19:38103978-38104000 AAGTAGCTGGGTGGGTGGATGGG + Intronic
1166044978 19:40224697-40224719 AGGTATCTGGAAGGGTGTGGGGG - Intronic
1166798364 19:45441380-45441402 AGGTAGCAGGGTGGATGGCGGGG + Intronic
1167030919 19:46959685-46959707 AGGTTTTTGGGTGGGTGCAGTGG - Intronic
1167150380 19:47705622-47705644 AATTATCTGGGCTGGTGGTGTGG + Intergenic
1167285397 19:48596276-48596298 AGGCTCCTGGGTGGATGGTGGGG + Intronic
1167565679 19:50255182-50255204 AGATGTGTGGGTGGGTGGAGGGG - Intronic
1167713469 19:51125948-51125970 CGGAATCTGGGCTGGTGGTGGGG + Intronic
1168587112 19:57602553-57602575 GGGTATCTGGATGGATGTTGTGG + Intronic
1168682449 19:58326104-58326126 GGGTACCTGGGTGAGAGGTGAGG - Intergenic
926916365 2:17895914-17895936 AGGTATATTGGTGGATGCTGAGG + Intronic
927217375 2:20675656-20675678 AGCTATCTGAGTGGGTTTTGAGG - Intergenic
927707912 2:25308182-25308204 AGGTAGGTGGGTGGGTGGATGGG + Intronic
928206505 2:29288346-29288368 AGGGATATGGGTGTGTGGTCAGG - Intronic
928457094 2:31432135-31432157 AGGGATCTGGCTGGGTGCGGTGG + Intergenic
929693208 2:44091670-44091692 AAGTATCTGGGGAGGTGATGGGG + Intergenic
930101838 2:47609440-47609462 AAGGATCTGGGTTGCTGGTGAGG + Intergenic
930754899 2:54964157-54964179 AGGTACCTAAGTGGGTGGTCTGG + Exonic
930929452 2:56862572-56862594 AAATGTCTGTGTGGGTGGTGGGG + Intergenic
931913802 2:66931196-66931218 AAGATTCTGGGTGGGTGGCGAGG - Intergenic
932104667 2:68931797-68931819 AGGTCTCAGGGTGGTGGGTGGGG - Intergenic
932294735 2:70615033-70615055 AGCCATCTGGGTGGGAGGTATGG - Intronic
932745454 2:74330209-74330231 AGGTATAGGTGAGGGTGGTGAGG + Intronic
932745471 2:74330308-74330330 AGGTATAGGTGAGGGTGGTGAGG + Intronic
932745545 2:74330700-74330722 AGGTATAGGTGAGGGTGGTGAGG + Intronic
932745611 2:74331057-74331079 AGGTATAGGTGAGGGTGGTGAGG + Intronic
932745639 2:74331216-74331238 AGGTATAGGTGAGGGTGGTGAGG + Intronic
933267248 2:80194512-80194534 AGGTATGCAGGTGTGTGGTGGGG + Intronic
933708612 2:85309207-85309229 GGGTTTCTGGTTTGGTGGTGAGG - Exonic
933815991 2:86069289-86069311 AGACCTTTGGGTGGGTGGTGAGG + Intronic
934045620 2:88170613-88170635 AGGAACTTGGGAGGGTGGTGCGG + Intronic
934475171 2:94588668-94588690 AGGTGAGTGGGTGGGTGGGGAGG - Intronic
934575966 2:95401859-95401881 AGGTGTCTGGGTGGGTGGTGCGG - Intergenic
934638138 2:96009716-96009738 AGGTATCTGGGTGGGTGGTGCGG - Intergenic
934795514 2:97095694-97095716 AGGTATCTGGGTGGGTGGTGCGG + Intergenic
937027441 2:118711252-118711274 AGGTTGGTGGGGGGGTGGTGGGG - Intergenic
937303507 2:120857416-120857438 AGGTAGGTGGGTGGGTGGGTGGG - Intronic
937349323 2:121150437-121150459 AGGTACCAGGCTGGGAGGTGAGG - Intergenic
937382883 2:121397038-121397060 AGGTTTGTGGGTGGGTGGCACGG + Intronic
937435228 2:121874514-121874536 AGGTAGCATGGTGGGTTGTGGGG + Intergenic
937981585 2:127619202-127619224 TGGTGGCTGGCTGGGTGGTGGGG + Intronic
937981610 2:127619271-127619293 TGGTGGCTGGCTGGGTGGTGGGG + Intronic
938188728 2:129255557-129255579 GGGTATCTTGGTGGGTGGGTAGG - Intergenic
938188792 2:129255899-129255921 AGGTATCTTGGTGGGTGGGTGGG - Intergenic
938248066 2:129794290-129794312 AGGGATTTGGGTGGGTGTTGGGG + Intergenic
938841501 2:135169018-135169040 TTGTATATGGGGGGGTGGTGGGG + Exonic
940064596 2:149612819-149612841 AGGGATCAGGGTGAGTAGTGGGG + Intergenic
940366236 2:152851882-152851904 AGCTACCTGGGTAGGTGGTGGGG + Intergenic
940555449 2:155221143-155221165 AGGTAGTCGGGTGGGTGGGGAGG + Intergenic
940762163 2:157750217-157750239 AGGCTTCTGGGTGGCTTGTGTGG - Intronic
940898346 2:159103003-159103025 AAGTATCTGGCTGGGAGGGGTGG - Intronic
941402264 2:165045216-165045238 TAGAATCTGGGTGGGGGGTGAGG - Intergenic
941799449 2:169640961-169640983 AGGTATGTGAGGGAGTGGTGGGG + Exonic
942242839 2:173979271-173979293 AGCTACCTGGGGGGGTGATGTGG - Intergenic
942488462 2:176465238-176465260 AGGTTCCTGGATGGATGGTGGGG + Intergenic
944875573 2:203961338-203961360 AGGTTTCTGTGTGTGGGGTGGGG + Exonic
945354810 2:208827761-208827783 AACTATCTGGGCCGGTGGTGTGG + Intronic
945502243 2:210590257-210590279 GTGTATCTGTGTGGGAGGTGGGG + Intronic
945680423 2:212906877-212906899 CAGGATCTGGGTGGCTGGTGGGG - Intergenic
946164949 2:217858211-217858233 GGGTATCTGGGTTGGTGGGGGGG - Intronic
946185481 2:217978528-217978550 GGGGATCTGGGTGGGGGGCGCGG - Intronic
946789633 2:223286953-223286975 AGGTTTTTGCGTGGGTGGAGGGG + Intergenic
947527414 2:230886968-230886990 AGGTAATGGGGTGGGGGGTGGGG + Intergenic
947624779 2:231612771-231612793 AGGTTGTTGGGGGGGTGGTGGGG - Intergenic
948125786 2:235563933-235563955 GGGAAGCTGGGTGGGGGGTGTGG + Intronic
948400668 2:237682681-237682703 AGGTCACTGGGTGGGAAGTGGGG - Intronic
948412081 2:237771555-237771577 TGGTATCTGGGCGGGGGGGGGGG - Intronic
948470556 2:238174894-238174916 AGGTGACTGGGTGTCTGGTGTGG + Intronic
948992158 2:241560690-241560712 AGGTCTCTGGGTGGGAGCTAGGG + Intronic
1170363471 20:15573754-15573776 AGGAATAAGGGTGTGTGGTGGGG - Intronic
1170560382 20:17552138-17552160 AGGGAACTGGGAGGATGGTGGGG + Intronic
1170883398 20:20317424-20317446 AGCTGTCTGGGTGTGTGCTGGGG - Intronic
1171795699 20:29565489-29565511 TGGTAGCTGGATGGGTGGGGTGG - Intergenic
1172033157 20:31995578-31995600 AGGTGTTTGGGTGGGAGATGGGG - Intronic
1172587381 20:36093894-36093916 AGGGCTCTGGGTGGGTGGGAAGG + Intronic
1172865345 20:38092081-38092103 AGGTGACTTGGTGGGTGGGGTGG + Exonic
1173384082 20:42572389-42572411 AGGGTTCTTGGTGGGTGGTGAGG - Intronic
1174105494 20:48159527-48159549 AGGTATGTGGGTGTGTGCTTGGG + Intergenic
1175150731 20:56931931-56931953 AGTTCCCTTGGTGGGTGGTGGGG - Intergenic
1175488550 20:59363287-59363309 GGGTATCCGCGAGGGTGGTGAGG - Intergenic
1175612932 20:60366789-60366811 AGGTTTGTGTGTGTGTGGTGTGG + Intergenic
1175766261 20:61594759-61594781 AGGTATCTGTGTGGGGGCCGAGG - Intronic
1175780257 20:61677651-61677673 AGGTAGGTGGGTGGGTGGGTGGG + Intronic
1175888213 20:62303982-62304004 AGGTGCCTGGGTTGGAGGTGTGG + Intronic
1176105439 20:63383762-63383784 AGGTGCCTGGGTGGTTGGTGGGG - Intergenic
1176189665 20:63802564-63802586 CGGTTTCTGGGAGGGTGCTGGGG - Intronic
1176241626 20:64078263-64078285 AGGAAACTGGGCCGGTGGTGAGG - Intronic
1176728569 21:10465958-10465980 AGGCATCTGCCTGAGTGGTGGGG + Intergenic
1177027479 21:15937435-15937457 TGGTATTGGGGTGGGTGGGGAGG - Intergenic
1177736907 21:25102380-25102402 AGGCATCTAGATAGGTGGTGTGG - Intergenic
1178985821 21:37302019-37302041 AGGTACCTGGGAGGCTGATGTGG + Intergenic
1179173321 21:38989890-38989912 AGGTTTCTGTGTGAGGGGTGGGG - Intergenic
1179663381 21:42892824-42892846 AGGGAGCTGGGCGCGTGGTGTGG + Intronic
1179824954 21:43958885-43958907 TGGTGTGTGTGTGGGTGGTGGGG + Intronic
1180613269 22:17111066-17111088 AGAGATCGGGGTGGGGGGTGGGG + Exonic
1181102925 22:20553583-20553605 AGAAATCTGGCTGGGTGCTGTGG + Intronic
1181661734 22:24355450-24355472 AGGTAGGTGGGTGGGTGGATAGG - Intronic
1182367084 22:29786511-29786533 AGGTCTCTGGCTGGGTGCGGTGG + Intergenic
1182447782 22:30399610-30399632 AGGCATCGGGGTGAGTGGTAGGG - Intronic
1183423697 22:37726244-37726266 AGGTCACTGGGTGGGTGGCGGGG - Exonic
1183660936 22:39220757-39220779 AGGTAGATGGGTGGGTGGATGGG + Intergenic
1183958014 22:41394020-41394042 AGGTGTCTGGGTGTGTGGCGTGG + Intronic
1184172652 22:42768940-42768962 GGGTGGGTGGGTGGGTGGTGGGG + Intergenic
1184788973 22:46687574-46687596 AGGTGGGTGGGTGGGTGGAGTGG - Intronic
1185339043 22:50283519-50283541 GGGTGACTGGGTGGGTGGGGAGG - Intronic
950117351 3:10460038-10460060 AGGTCACTGGCTGGTTGGTGAGG + Intronic
950532217 3:13558796-13558818 AGGTAGGTGGGTGGGTGGGTGGG - Intronic
950826528 3:15828649-15828671 TAGTATCTGGGGGGGTGGGGGGG + Intronic
950932992 3:16809578-16809600 AGGTATAGGGGTGGGTGGAGCGG + Intronic
950948314 3:16974098-16974120 AAGTATCAGGGAGAGTGGTGGGG + Intronic
951895588 3:27606747-27606769 AGGTATGTGTGTGTGTGGAGAGG + Intergenic
952509460 3:34038701-34038723 ATGTATGTGGGATGGTGGTGTGG + Intergenic
952610791 3:35206479-35206501 AGGAATGGGAGTGGGTGGTGAGG - Intergenic
953026597 3:39148665-39148687 GAGTGACTGGGTGGGTGGTGGGG - Intronic
954150456 3:48654694-48654716 AGGCATCTGGCTGGCTGGGGAGG + Intronic
954287254 3:49627731-49627753 AGGTGTCTGGGTGGGTGATGGGG + Intronic
954398147 3:50303705-50303727 AGGGATCTTGGTTGGGGGTGGGG + Intronic
954888937 3:53905012-53905034 AGGGATCTGGGTGTGTGTTGGGG - Intergenic
955071448 3:55575649-55575671 AGGGATCATGGTGGCTGGTGGGG - Intronic
955598694 3:60620879-60620901 AGGAAACTGGGGGAGTGGTGGGG + Intronic
956168894 3:66417340-66417362 AGTTATATTGGTGGGGGGTGGGG - Intronic
960383149 3:116989055-116989077 GTGTATCTGAGTGTGTGGTGAGG + Intronic
960820019 3:121720307-121720329 AGCTGTCTGGGGAGGTGGTGTGG - Intronic
960968941 3:123125437-123125459 AGGGAGCTGGGTTGGTGGCGGGG - Intronic
961722466 3:128906050-128906072 AGGGAGCTGGGTGGCTGGGGAGG - Intronic
962342328 3:134596054-134596076 TGGTCTCTGGGTGGGTGGGTGGG + Intergenic
962609179 3:137058797-137058819 AGCTATCTGGGTGGCTGAGGTGG + Intergenic
962945216 3:140162615-140162637 ATGTATTTGGCTGGGTGGCGGGG + Intronic
963033673 3:141005201-141005223 GGGTAGCGGGGTGGGTGGAGAGG - Intergenic
963041813 3:141075699-141075721 GGGTAGATGGGTGGATGGTGGGG - Intronic
963329729 3:143900697-143900719 AGGTATCTGGCCGGGTGTGGTGG - Intergenic
963687161 3:148450905-148450927 AGGTATCTGGGTCAGAGGAGTGG + Intergenic
963727358 3:148937385-148937407 AGGGATCTGGGTGGGTGGAGTGG - Intergenic
964517833 3:157531910-157531932 GGCTGTTTGGGTGGGTGGTGTGG - Intronic
964549445 3:157870518-157870540 AGCCATCGGGGTGGGTTGTGAGG - Intergenic
964624835 3:158748952-158748974 AGGGATCGGGGAGGTTGGTGGGG - Intronic
965795743 3:172436881-172436903 AATTAGCTGGGTGTGTGGTGGGG + Intergenic
967146859 3:186613549-186613571 AGGGAGCTGGGTGGGGTGTGAGG + Intronic
967190241 3:186978508-186978530 GGTTAGCTGGGTGGATGGTGGGG + Intronic
967200181 3:187066056-187066078 AGGTATCTGGATGGGTTGGCAGG + Intronic
967828626 3:193899163-193899185 ATGTATGAGGGTGGGTGGAGTGG - Intergenic
968194505 3:196695339-196695361 GGGTGTGTGGGTGTGTGGTGTGG - Intronic
968480149 4:829611-829633 AAGGTTCTGGGTGGGTGCTGTGG - Intergenic
968919918 4:3517155-3517177 GGGTTTGGGGGTGGGTGGTGAGG + Intronic
969341683 4:6545950-6545972 AGTTCCCTGGGTGGGGGGTGGGG + Intronic
969702214 4:8773868-8773890 AGGACGCTGGGAGGGTGGTGTGG - Intergenic
970158782 4:13168573-13168595 AGGAATCTGTATGGGTTGTGGGG - Intergenic
972907127 4:43764195-43764217 AGGTAAGAGGGTGGGTGGAGAGG + Intergenic
975264294 4:72343455-72343477 AATTATCTAGGTGGGTAGTGAGG - Intronic
975867652 4:78740775-78740797 AGGAATCTGGCTGGGTGTGGTGG - Intergenic
977561480 4:98537657-98537679 AGCTCTCTGGGAGGGCGGTGAGG - Intronic
981423447 4:144577582-144577604 AAGTTACTGGGTGGCTGGTGAGG - Intergenic
982348824 4:154392135-154392157 ATGTATCTTTGTGGGTGGAGTGG - Intronic
983918960 4:173324723-173324745 AGGTATCTGGCTTTCTGGTGAGG - Intergenic
984016631 4:174434551-174434573 AGGTATGTGTGTGGGTAGTAAGG - Intergenic
984442149 4:179786037-179786059 AGGTTTCTGGGTCTGTGGTTTGG + Intergenic
984828189 4:183947068-183947090 CGGTATCCTGGTGGGGGGTGGGG + Intronic
984879326 4:184396719-184396741 AGGAATCTGGCTGGGTGTGGTGG - Intronic
985309667 4:188583564-188583586 AAGTCTCTGGGTGGAAGGTGAGG - Intergenic
985782076 5:1876658-1876680 AGGGCTCGGGGTGGGGGGTGGGG + Intergenic
986486757 5:8245657-8245679 GGGTGTGGGGGTGGGTGGTGTGG - Intergenic
986969080 5:13311105-13311127 AGGTAGGTGGGTGGGTGGGTGGG + Intergenic
988254986 5:28809430-28809452 AGGTCTCAGGGCGGGCGGTGGGG + Intergenic
988316194 5:29632475-29632497 AAGTATCTAGTAGGGTGGTGTGG - Intergenic
988685948 5:33525812-33525834 GGGTAAGTGGGTGGGTGGAGGGG - Exonic
989221085 5:38965388-38965410 TGATAGCTGGTTGGGTGGTGAGG - Intronic
990461053 5:56031463-56031485 GAGTGTGTGGGTGGGTGGTGAGG + Intergenic
991048122 5:62244330-62244352 ATGTATCTGGCTGGGTGCAGCGG - Intergenic
991257282 5:64629135-64629157 TAGTATCTGTGGGGGTGGTGGGG - Intergenic
991394678 5:66191757-66191779 AGGTATTTGGGTGGATGGTGGGG + Intergenic
991543022 5:67750806-67750828 AGCTGTCTGGGGAGGTGGTGGGG - Intergenic
991966889 5:72101578-72101600 AGGTATATGGGTGGCTGGGTGGG + Intergenic
992707651 5:79413583-79413605 AGGTATGGGGGTAGGGGGTGGGG - Intronic
992852494 5:80824446-80824468 AGATTTCTGGGAGGGAGGTGGGG - Intronic
993032398 5:82720489-82720511 AGGAATGTGGGTGGGAGATGAGG + Intergenic
994050069 5:95352608-95352630 GGGTTGCGGGGTGGGTGGTGAGG - Intergenic
997085841 5:130797498-130797520 AGGTATGGGTGTGGCTGGTGAGG - Intergenic
997218645 5:132137321-132137343 ATGTATCAGGCTGGGTGCTGTGG + Intergenic
997285184 5:132672804-132672826 AGGCACCTGAGTGAGTGGTGGGG + Intergenic
998887005 5:146705437-146705459 ATGAATCTGGGTGGGTGGTGGGG + Intronic
999857783 5:155613893-155613915 AGGAATTTGGGTGGGGGCTGGGG + Intergenic
1000340212 5:160271244-160271266 AGGTAAGTGCTTGGGTGGTGAGG + Intronic
1001920247 5:175594194-175594216 AGGTATCTGGAGGTGGGGTGGGG - Intergenic
1002099004 5:176848179-176848201 AGGGATCTGGGTGCGGGGGGCGG - Intronic
1002366022 5:178711721-178711743 AGATATCCGAGTGGGTGGGGAGG - Exonic
1003717404 6:8663286-8663308 TGGTATGTGTGTGTGTGGTGGGG + Intergenic
1004682410 6:17909246-17909268 AGGTTTTTGGCTGGGTGCTGTGG + Intronic
1006269698 6:32954414-32954436 GGGTGGCTGGGTGGGTGGTCAGG + Intronic
1006623092 6:35380779-35380801 AGGTAACTGGTTGGGTGCAGTGG - Intronic
1006715806 6:36119609-36119631 AGGGGTCTGGGGTGGTGGTGGGG - Intergenic
1007077227 6:39075492-39075514 AGGTCTCTGAGTGGGAGATGGGG + Intronic
1007119848 6:39370805-39370827 GGGGATCTGTGTGGGTGCTGGGG + Intronic
1007136948 6:39531685-39531707 TGGTGTCTGGGTGGCTGGTGAGG - Intronic
1007582292 6:42966717-42966739 ATGTAGATGGGTGGGTGGTGAGG - Intronic
1008218245 6:48822523-48822545 AGACTTCTGGGTGGGTGGGGAGG + Intergenic
1008434714 6:51462104-51462126 GGGTATGTGTGTGGGGGGTGGGG + Intergenic
1008563034 6:52740523-52740545 TGTAAGCTGGGTGGGTGGTGTGG - Intergenic
1008822699 6:55652540-55652562 AGGTATCTGTGTCTGTGCTGAGG + Intergenic
1008983555 6:57514860-57514882 GGGTATGTGTGTGGGTGGGGAGG - Intronic
1009171609 6:60407754-60407776 GGGTATGTGTGTGGGTGGGGAGG - Intergenic
1010641621 6:78335745-78335767 AGGCATGTGGGTGGGTGATGGGG - Intergenic
1011202699 6:84854965-84854987 AGGGGTCTTGGTGGGTGGTGAGG - Intergenic
1011778400 6:90758912-90758934 AGGTATCCAGGTAGGTGATGAGG + Intergenic
1011851764 6:91638276-91638298 AGGCATCTGAGGGGGTGGTGTGG - Intergenic
1012079368 6:94736252-94736274 AGCTACCAAGGTGGGTGGTGGGG - Intergenic
1013222443 6:108090907-108090929 AACTATCTGGGCTGGTGGTGAGG + Intronic
1013494980 6:110689308-110689330 AGCTACCAGGGTGGGTGGAGGGG - Intronic
1013597181 6:111670761-111670783 TGGTGGGTGGGTGGGTGGTGGGG + Intronic
1014531935 6:122569175-122569197 AGCTATCAGCGTGGGTGGAGGGG - Intronic
1015620219 6:135124141-135124163 AGGTTTCTGGGTGGGTGACAGGG - Intergenic
1015783293 6:136894080-136894102 AGCTATTTGGGAGGGTGGAGTGG + Intronic
1015836617 6:137426922-137426944 AGATAAATGGGGGGGTGGTGCGG + Intergenic
1016713154 6:147196147-147196169 AGGTATCTTGCTGGATGTTGTGG - Intergenic
1016738641 6:147507222-147507244 TGGCATTTGGGTGGGTGGTTAGG - Intergenic
1016877691 6:148880240-148880262 AGAGATCTGGCTGGGTGCTGTGG - Intronic
1016906810 6:149158993-149159015 AGGTATCTAGATGGGTGGAAGGG - Intergenic
1017341139 6:153323244-153323266 AGGTACTTGGGAGGCTGGTGTGG - Intergenic
1018538973 6:164856259-164856281 AGGTGTGTGGGTGGGTGGACGGG + Intergenic
1018871930 6:167790273-167790295 AGGGGTATGGGTGGATGGTGGGG - Intronic
1018871939 6:167790293-167790315 AGGGGTATGGGTGGATGGTGAGG - Intronic
1018871946 6:167790313-167790335 AGGGGTATGGGTGGATGGTGAGG - Intronic
1018927598 6:168217328-168217350 TGGGATTTGGGTGGGTGATGGGG + Intergenic
1019350364 7:551566-551588 AAGGACCTGGGTGGGAGGTGGGG - Intronic
1019350383 7:551628-551650 AAGGACCTGGGTGGGAGGTGGGG - Intronic
1019350441 7:551813-551835 AAGGACCTGGGTGGGAGGTGGGG - Intronic
1019350501 7:551998-552020 AAGGACCTGGGTGGGAGGTGGGG - Intronic
1019350519 7:552059-552081 AAGGACCTGGGTGGGAGGTGGGG - Intronic
1019350538 7:552120-552142 AAGGACCTGGGTGGGAGGTGGGG - Intronic
1019350575 7:552242-552264 AAGGACCTGGGTGGGAGGTGGGG - Intronic
1019350633 7:552426-552448 AAGGACCTGGGTGGGAGGTGGGG - Intronic
1019350652 7:552488-552510 AAGGACCTGGGTGGGAGGTGGGG - Intronic
1019556507 7:1634102-1634124 AGGTGCCTGGGTGGGTGCTCAGG + Intergenic
1019658944 7:2213092-2213114 AGGCATCTCTGTGGCTGGTGCGG - Intronic
1019956602 7:4419943-4419965 ATGTCACTGGGTGGGTGCTGTGG - Intergenic
1020968429 7:14902536-14902558 TGGCTTCTGGGTGTGTGGTGCGG - Intronic
1021153724 7:17183307-17183329 AGGTATGTGGCTGGGTGCGGTGG + Intergenic
1021459408 7:20869016-20869038 AGGCATCTGGTGGGGTGGGGTGG - Intergenic
1022026074 7:26448990-26449012 GGGTATGTGGGTGGGAGCTGAGG + Intergenic
1022292035 7:29014109-29014131 AGCTCTCTGGCTGGGAGGTGGGG + Intronic
1023813194 7:43928229-43928251 AGGTATCTGGGTCGTGGGGGCGG - Intronic
1026961242 7:74409117-74409139 AATTAGCTGGGTTGGTGGTGTGG + Intergenic
1028317577 7:89422437-89422459 AGGTATCTGGGAGGCTGAGGTGG + Intergenic
1029986762 7:104929736-104929758 AGGTATATGTGTGCGTGTTGGGG + Intergenic
1030037407 7:105419724-105419746 AGTTAGCTGGGTGTGTGCTGTGG + Intergenic
1030511092 7:110482734-110482756 AGGAATGTGTGTGTGTGGTGGGG - Intergenic
1031382274 7:121101867-121101889 AGGTATTTGGGTTGCAGGTGTGG - Intronic
1031660387 7:124416937-124416959 ATGTGTATGGGTGGGGGGTGAGG - Intergenic
1032473357 7:132194240-132194262 AGGGACCTGGGTAGGTGCTGTGG - Intronic
1033123696 7:138688555-138688577 AGGGATCTGGCTGGGCGCTGTGG - Intronic
1033161627 7:139001988-139002010 ACGACTCTGGGTGAGTGGTGGGG + Intergenic
1033346791 7:140531849-140531871 AACTATCTGTGTGTGTGGTGGGG + Intronic
1033447969 7:141438518-141438540 AGGTAGATGGGTGGATTGTGTGG + Intronic
1033756023 7:144398898-144398920 AGTTATCTGGGTGGGGGTAGGGG - Intronic
1034517051 7:151589274-151589296 ATGTCTCTGGGTGGGAGTTGGGG - Intronic
1034601523 7:152262003-152262025 AGGCATCTGCCTGAGTGGTGGGG - Intronic
1035516562 8:238511-238533 AGGTTTCTGGCTGGGTGCGGTGG + Intronic
1035713933 8:1739483-1739505 AGGTGTCTGGGTCACTGGTGTGG + Intergenic
1037413614 8:18623525-18623547 AGCTATCTGGGTGGCTGAGGTGG + Intronic
1037417860 8:18670478-18670500 TGGAATCTGGGTGAGAGGTGAGG + Intronic
1037550342 8:19964815-19964837 ATGCATCTGGCTGGGTGCTGTGG - Intronic
1038352180 8:26786704-26786726 AGGTATATGGATGGGTGGAAGGG - Intronic
1038577559 8:28717806-28717828 AGGTATCTGGGTGAGGCGTAGGG - Exonic
1039056181 8:33538647-33538669 AGCTATATGGGTGGGTGTGGTGG - Intergenic
1040907066 8:52480057-52480079 AGGTTTCTAGGTGAGTGGTTGGG - Intergenic
1041467121 8:58168007-58168029 ATGTGACTGGGTGGGGGGTGGGG - Intronic
1041887692 8:62830764-62830786 AGTTCTCTGCATGGGTGGTGGGG - Intronic
1042559674 8:70063978-70064000 AAGTGTTTTGGTGGGTGGTGTGG - Intronic
1042649567 8:71024407-71024429 AGCTCTCTGGGTGGATGTTGGGG + Intergenic
1042677190 8:71334633-71334655 AGGTGTGTGTGTGTGTGGTGGGG - Intronic
1042896878 8:73680124-73680146 CAGAATCTGGGTGGGGGGTGGGG + Intronic
1043256406 8:78143114-78143136 AGTAATCTTGGTGGGAGGTGAGG - Intergenic
1043645001 8:82506808-82506830 AGGTATCTGGCTGGGTGTGGTGG + Intergenic
1047557219 8:125945698-125945720 TGGTATGTGTGTGTGTGGTGGGG + Intergenic
1047634378 8:126744386-126744408 AGCTACCAGGGAGGGTGGTGGGG + Intergenic
1048427070 8:134332730-134332752 AGGTAGATGGGTGGGTGGATAGG - Intergenic
1048965078 8:139609242-139609264 AGGTAGGTGGGGGGGGGGTGGGG - Intronic
1049041698 8:140116968-140116990 CTGTATCTGGGTGGTTGGTGTGG - Intronic
1049317205 8:141975583-141975605 AGGGGTTTGGGTGGGTGGGGGGG + Intergenic
1050112708 9:2233197-2233219 AGGTATCTGGGTATGTTCTGGGG + Intergenic
1050151337 9:2621974-2621996 AGGTGGCTGGGTGGGTGGGGAGG + Exonic
1050235488 9:3574824-3574846 AGGTAACAGGATGGGTGTTGGGG + Intergenic
1050411941 9:5375310-5375332 AGGTATGTGTGGGGGAGGTGGGG + Intronic
1051301571 9:15656723-15656745 GGGTATGTGGTGGGGTGGTGAGG + Intronic
1051648815 9:19299447-19299469 TGGTAACTGGGTGGATGGTGGGG + Intronic
1051750936 9:20340387-20340409 CCGTGTCTGGGTGGGTGGTCTGG - Intergenic
1052017192 9:23482703-23482725 AGGTAGATGGGTGGGTAGGGAGG + Intergenic
1052832457 9:33227658-33227680 AGGTATTTGGGTGGCTGAGGTGG - Intronic
1053466468 9:38312177-38312199 GGGGAGCTGGGTGTGTGGTGTGG - Intergenic
1054154819 9:61632805-61632827 TGGTAACTGGGTGGGCGGGGTGG - Intergenic
1054296001 9:63332923-63332945 AGGTGAGTGGGTGGGTGGGGAGG + Intergenic
1055441676 9:76342810-76342832 AGGCAACTGGGTGAATGGTGGGG - Intronic
1055939524 9:81636438-81636460 AGGCTTCTGGGTGGGGGGTGGGG + Intronic
1056072271 9:82999889-82999911 AGATATCTGGCTGGGTGCGGTGG - Intronic
1056241952 9:84656503-84656525 AAGATTCTTGGTGGGTGGTGAGG + Intergenic
1056329094 9:85507207-85507229 AGGTACATGGGGTGGTGGTGGGG - Intergenic
1056725155 9:89107716-89107738 AGGGATCAGGGTTGGGGGTGGGG + Intronic
1056758961 9:89401342-89401364 AAGTATTTGGCTGGGTGCTGTGG - Intronic
1057431803 9:95001888-95001910 AGCTATCTGGGAGGGTGAGGTGG - Intronic
1057946913 9:99338134-99338156 AGGTCACTGGATGGATGGTGGGG + Intergenic
1058154718 9:101502460-101502482 AGGTATTTGGCTGGGTGAGGGGG - Intronic
1058882424 9:109297187-109297209 AGGCAGCTGGGGGGGTGGGGGGG + Intronic
1058896730 9:109406609-109406631 AGGTGTCCGCCTGGGTGGTGGGG + Exonic
1059010359 9:110451325-110451347 AGGAATCTGTGTTGATGGTGTGG - Exonic
1059248081 9:112865184-112865206 AGGTATGTGGGTGTGGTGTGTGG - Intronic
1059252053 9:112894575-112894597 AGGTATTTGGGAGGCTGGGGTGG + Intergenic
1059308159 9:113370701-113370723 AGGTGACTGGGTGGATGTTGTGG + Exonic
1060108103 9:120887165-120887187 AGGTTTCTGGCTGGGTGCGGTGG + Intronic
1060293798 9:122329564-122329586 TGGCACCTGGGTGGATGGTGAGG - Intergenic
1060301092 9:122375095-122375117 AGGTGTCAGGGTGGGCGGAGAGG - Intronic
1060708169 9:125827023-125827045 AGGGGTGTGGGTGGGAGGTGTGG - Intronic
1060769020 9:126317341-126317363 ATGTGTGTGGGTGGGTGGGGGGG + Intergenic
1061613295 9:131762724-131762746 TGGGAACTGGGTGGGTCGTGGGG + Intergenic
1061667358 9:132168362-132168384 AGGTCTCTGGGTTTGTGGTGGGG + Intronic
1062112137 9:134787981-134788003 AGGTGGCTGGGTGAGTGGAGGGG + Intronic
1062130285 9:134888773-134888795 AGCCCCCTGGGTGGGTGGTGTGG - Intergenic
1062135993 9:134928867-134928889 AGGTCTCTGGGTGGGTGAAGGGG - Intergenic
1062538794 9:137032426-137032448 GGGTAGCTGGGTGGGGGCTGGGG - Exonic
1062589453 9:137266838-137266860 AGGTATCTGGGGGAGTGGGAGGG + Intronic
1062729542 9:138101433-138101455 AGCTAGCTGGGTGGGAGATGGGG + Intronic
1185705002 X:2260299-2260321 GGGTATCTGTGAGGGTGGAGGGG + Intronic
1185867800 X:3639099-3639121 AGGTGTGTGGGTGGGTGGGTGGG + Intronic
1185967912 X:4628538-4628560 AGGTATTTGGGAGGGTGGTTAGG + Intergenic
1186180209 X:6966834-6966856 AGGTGGCTGGGTGGGTGCAGTGG - Intergenic
1186438517 X:9564792-9564814 AGGGATGTGGGTGGGTGTTGCGG + Intronic
1186540564 X:10395923-10395945 AGGTACGTGTGTGGGTGGTGGGG - Intergenic
1188371608 X:29376478-29376500 AGCTATCTGGGTGGCTAGTGAGG - Intronic
1188956092 X:36436287-36436309 AAGTACCAGGGTGGGTTGTGGGG - Intergenic
1189267019 X:39725064-39725086 AGGTAACTGGGTGGGTGGCTGGG - Intergenic
1189746260 X:44171795-44171817 AAGCATCTGGGTGGGTGGATGGG + Intronic
1189826935 X:44928756-44928778 AGTTATCTGGGTGGTAGTTGGGG + Intronic
1190005714 X:46735900-46735922 AGGTGTCTGGGTGCGGGGAGAGG - Intronic
1190055930 X:47181156-47181178 AGGTGTGGGGGTGGGGGGTGGGG - Intronic
1190059743 X:47203046-47203068 AGGTATGTGGGTGGGACCTGTGG + Exonic
1190234345 X:48604409-48604431 GGGGATCTGGGTGGCTGGGGAGG + Intronic
1190832716 X:54073717-54073739 AGGTATCCGGCTGGGTGTGGTGG - Intronic
1190879472 X:54482603-54482625 AGGGAGATGGGTGGGTGTTGGGG - Intronic
1192101769 X:68271910-68271932 ATGTGTCTGGGTGGGTGGCTGGG + Intronic
1192428541 X:71097365-71097387 AGGTGTTGGGGTGGGAGGTGGGG - Intronic
1192693505 X:73390692-73390714 AAGTTTCTGTGTGGGTTGTGGGG - Intergenic
1193803684 X:85968834-85968856 AGGTAAGTGGGTGGGTGGGTAGG - Intronic
1194090180 X:89575732-89575754 AGCTACCAGGGCGGGTGGTGGGG + Intergenic
1194506823 X:94743748-94743770 AGTGAACTGGGTGGGGGGTGGGG - Intergenic
1194669092 X:96708226-96708248 AATGATCTGGGTGGGGGGTGGGG - Intronic
1194809698 X:98375192-98375214 AGGGTTTTGGGTGGGGGGTGGGG + Intergenic
1196059242 X:111389773-111389795 AGTTATGTGGGTGGATGGTGGGG - Intronic
1196892868 X:120307893-120307915 AGGAATCTGGGGTGGAGGTGGGG - Intronic
1196928718 X:120660141-120660163 AGGCATCAGGGTGGTTGTTGGGG + Intergenic
1197411651 X:126123668-126123690 AGGTCCCTGAGTAGGTGGTGTGG + Intergenic
1197590335 X:128402189-128402211 GGGTAACTGGGTGGGAGGTGGGG - Intergenic
1197796533 X:130304842-130304864 AGGTTTCTGGGCAGCTGGTGTGG + Intergenic
1198719613 X:139602091-139602113 TGGTAGTTGGGTGGGTGGAGGGG + Intronic
1200135253 X:153871582-153871604 AGGTAACTGGAGGGGTGGGGAGG + Intronic
1200442827 Y:3231785-3231807 AGCTACCAGGGTGGGTGGTGGGG + Intergenic
1201927039 Y:19298623-19298645 AGTTATAGGTGTGGGTGGTGGGG + Intergenic