ID: 934638139

View in Genome Browser
Species Human (GRCh38)
Location 2:96009721-96009743
Sequence AGGAAAGGTATCTGGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 2, 1: 1, 2: 1, 3: 42, 4: 486}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934638139_934638149 18 Left 934638139 2:96009721-96009743 CCACCCACCCAGATACCTTTCCT 0: 2
1: 1
2: 1
3: 42
4: 486
Right 934638149 2:96009762-96009784 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363
934638139_934638150 19 Left 934638139 2:96009721-96009743 CCACCCACCCAGATACCTTTCCT 0: 2
1: 1
2: 1
3: 42
4: 486
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638139_934638151 25 Left 934638139 2:96009721-96009743 CCACCCACCCAGATACCTTTCCT 0: 2
1: 1
2: 1
3: 42
4: 486
Right 934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG 0: 2
1: 1
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934638139 Original CRISPR AGGAAAGGTATCTGGGTGGG TGG (reversed) Intergenic
900269980 1:1782138-1782160 AGGAAAGGGAGCTGGGGGGTGGG + Intergenic
900552096 1:3261937-3261959 AGGAAAGGAGACAGGGTGGGGGG - Intronic
901150006 1:7095054-7095076 AGGAAAGGGGGCTGGCTGGGTGG - Intronic
901154162 1:7124256-7124278 GGGACAGGTGTCTGGGAGGGAGG - Intronic
901159365 1:7163300-7163322 GGGAAAGGTCACTGGATGGGGGG + Intronic
901178187 1:7320440-7320462 AGGAAAGACATCTGGCTGGTGGG + Intronic
901420433 1:9147033-9147055 AGGGCAGGCATCTTGGTGGGGGG + Intergenic
901618405 1:10560665-10560687 ATAAAAGGTATCTGGGAGGCTGG - Intronic
901685991 1:10943669-10943691 ATAAAAGGTATCTGGGAGGCTGG + Intergenic
902106203 1:14038234-14038256 AGGAAAGGGATCTGGGGGTCTGG + Intergenic
902473223 1:16664790-16664812 AGGAAATGAAGTTGGGTGGGAGG + Intergenic
902485580 1:16742652-16742674 AGGAAATGAAGTTGGGTGGGAGG - Intronic
902499315 1:16898105-16898127 AGGAAATGAAGTTGGGTGGGAGG - Intronic
902621830 1:17655294-17655316 TGGATAGGTAGGTGGGTGGGTGG - Intronic
902689543 1:18101660-18101682 AGTAATGGTAGGTGGGTGGGTGG - Intergenic
902706292 1:18207468-18207490 AGGAAAGGCATCTGGGTATGTGG + Intronic
903161998 1:21495640-21495662 AGGAGAGGTACGGGGGTGGGTGG + Intergenic
904660634 1:32081862-32081884 TGGAAAGGAAACTGGGTGGCTGG - Intronic
904918531 1:33987636-33987658 ATGAAGGAGATCTGGGTGGGAGG - Intronic
905078550 1:35296196-35296218 AGGAAATGTAGTTGGGTGGTAGG + Intronic
905273984 1:36805388-36805410 ACGCATGGTATCTGGGTGAGTGG + Intronic
905276112 1:36819328-36819350 AGGCAGGGAGTCTGGGTGGGAGG - Intronic
905885497 1:41489662-41489684 AGGAAAGGTGGATGGATGGGTGG - Intergenic
905885543 1:41489860-41489882 AGGAAAGGTGGATGGATGGGTGG - Intergenic
905885565 1:41489959-41489981 AGGAAAGGTGGATGGATGGGTGG - Intergenic
906057607 1:42929085-42929107 AGGCAAGGCCTCTGGGTGGGTGG - Intronic
906120641 1:43388265-43388287 AGGAAGGGCTTATGGGTGGGGGG - Intronic
906476203 1:46171312-46171334 AGGACAGGAAGCTGGGTGGAAGG - Intronic
907191143 1:52650025-52650047 GGGAAAGGTCTCTGGCTGGGAGG - Intronic
907775704 1:57512415-57512437 AGAAAAGAAATCTGGGTGGAAGG + Intronic
907831150 1:58065479-58065501 AGTAAAGGGAACTGGGTGTGAGG + Intronic
907970545 1:59376818-59376840 TGGAAAGTTATCTGGATGGTAGG + Intronic
908566400 1:65360904-65360926 ATGAAAGGTGTGTGGGTGAGAGG + Intronic
908785207 1:67728811-67728833 AGGAGGGGTTTCTGTGTGGGGGG - Intronic
908907447 1:69032397-69032419 GGGAAAGGTGTGTGGGTGGGAGG + Intergenic
909662088 1:78095573-78095595 AGGAAAGGTATTGGGGAAGGGGG - Intronic
910946657 1:92599994-92600016 AGAAAAGGAAACTGGATGGGAGG + Intronic
911092544 1:94029434-94029456 AGGTCAGGTACCTGGGGGGGCGG + Exonic
912857762 1:113186579-113186601 AGGAAGGGCATGCGGGTGGGAGG + Intergenic
913519062 1:119628615-119628637 ATGAATGGTATCTGGGTGACAGG - Intronic
915523784 1:156464091-156464113 AGGAATGGTATTTGTATGGGGGG - Exonic
915569642 1:156737547-156737569 AGGAAACTTAGATGGGTGGGAGG + Intronic
915858301 1:159414242-159414264 AGGAATGGTGTGTGGGTAGGAGG - Intergenic
915935122 1:160085978-160086000 AGGAAAGGGAACGGGGTGAGTGG - Intronic
916306391 1:163339134-163339156 AGGATAGGTATGTGTGTGGATGG + Intronic
916502801 1:165401161-165401183 AGGAAGGGGGTCAGGGTGGGAGG + Exonic
918037128 1:180884632-180884654 GGGAAGGGTTGCTGGGTGGGTGG + Exonic
919568422 1:199218266-199218288 AGGAAATGGAGCTGGGTAGGTGG + Intergenic
919578189 1:199337507-199337529 AGGTAAGGCAGCTGGGAGGGAGG - Intergenic
920500056 1:206480188-206480210 AGGAAGGGGAGATGGGTGGGGGG + Intronic
920787142 1:209052038-209052060 AGGAAAGGAAGCTGGGGAGGGGG - Intergenic
921096708 1:211893056-211893078 ATGTAAAGTATCTTGGTGGGGGG - Intergenic
921722512 1:218489048-218489070 AGGAAAGGTATCTTGTTTGAAGG - Intergenic
923133617 1:231098462-231098484 AACAAAGGTATCTGGGTGGTGGG - Intergenic
924763094 1:247007545-247007567 GTGAAAGGTTCCTGGGTGGGAGG - Intronic
1062799741 10:370195-370217 AGGAAAACTATTTGGGTGGCAGG + Intronic
1062871147 10:905796-905818 AGGAAAGTTTTCTGGGAGGTTGG - Intronic
1064399842 10:15012321-15012343 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
1064969469 10:21049654-21049676 AGGAACGGGGTCAGGGTGGGCGG - Intronic
1066233926 10:33467337-33467359 GGGAACGGTTTCTGGGTGGGTGG + Intergenic
1066379767 10:34891198-34891220 AGGCAGGGTATCTGGGCTGGAGG + Intergenic
1067281967 10:44879936-44879958 GGGAAGGGGTTCTGGGTGGGAGG - Intergenic
1067725259 10:48765704-48765726 GAGAAAGGTAACTTGGTGGGGGG - Intronic
1068623919 10:59218584-59218606 AGGAAAGGCATTTGGGAGGTTGG + Intronic
1068816723 10:61323630-61323652 AGGAAAGGAAGAAGGGTGGGGGG + Intergenic
1069780040 10:70949624-70949646 AGGAGAGGGACCTGGGAGGGGGG + Intergenic
1070524567 10:77284180-77284202 AGGAAAGGTGACTGGGTGATAGG + Intronic
1071504279 10:86223283-86223305 AGGGAAGGTGTCTGGGCAGGGGG - Intronic
1072069467 10:91902679-91902701 AGAAAATGTATCTGGCTAGGTGG + Intergenic
1073113939 10:101080330-101080352 GGGAAAGGGATAAGGGTGGGAGG + Intergenic
1073181503 10:101586290-101586312 AGGAAAGCTGTCTGGATGGAAGG - Intronic
1073248955 10:102110193-102110215 GGGCCAGGTATATGGGTGGGGGG - Intronic
1073657705 10:105435193-105435215 AGGAAAGGTATTGGTGGGGGAGG - Intergenic
1074309148 10:112307243-112307265 ATGAAAGATATCTGGATGTGAGG + Intergenic
1074645179 10:115441850-115441872 AGGAAAGGTATCAGAGAGGGGGG - Intronic
1074756424 10:116627478-116627500 AGGAAAGGGAGCTGGGGGTGGGG + Intronic
1074758086 10:116642475-116642497 AAGATAGGTGTCTGGGTGGATGG - Intronic
1074822633 10:117192468-117192490 TGGAAAGGGAGCTGGGAGGGAGG - Intergenic
1075159197 10:120008545-120008567 TTGAAAGGCATCTGGGTGGAGGG + Intergenic
1075217672 10:120552602-120552624 AGGAAAGCAATCTGGCTGGTGGG + Intronic
1075740589 10:124693645-124693667 AGGAAAGGGATAGAGGTGGGAGG + Intronic
1076271379 10:129155289-129155311 AGCAGGGGTAACTGGGTGGGGGG - Intergenic
1076326317 10:129626264-129626286 AGGAGAGGCATGCGGGTGGGTGG - Intronic
1076540441 10:131211128-131211150 TGGGATGGTATCTGGGTGGTGGG + Intronic
1076644348 10:131942148-131942170 TGCACAGGTAACTGGGTGGGAGG - Intronic
1077023624 11:430456-430478 AGGAAAGGGATGGGGGTGGGAGG + Intronic
1077370221 11:2178220-2178242 AGGAAGGGCATCCGGGTGGGCGG + Intergenic
1077990501 11:7406317-7406339 AGGAAGGGTGTGTGGGTGGCAGG - Intronic
1078150836 11:8758449-8758471 AGCAAAGGGATCAGGGTGGGTGG - Intronic
1078421164 11:11214140-11214162 AGGGAAGGAATGTGGGAGGGAGG + Intergenic
1078536384 11:12178453-12178475 ATGTAAGGTATGGGGGTGGGGGG + Intronic
1079175625 11:18137598-18137620 ATGACAGGTATCTGGGGCGGCGG - Exonic
1079604415 11:22346559-22346581 AGGAAAGGCCTTAGGGTGGGGGG + Intronic
1079912501 11:26328767-26328789 AAGACAGGTATATGGGTAGGGGG + Intronic
1080161604 11:29183185-29183207 AGGAAAGATATATGGGTAAGAGG + Intergenic
1080329006 11:31113980-31114002 ACCAAAAGTATGTGGGTGGGTGG - Intronic
1080386000 11:31811599-31811621 AGTGAAGGTTTCTGGGTTGGGGG + Intronic
1082843507 11:57709083-57709105 ATGAAAGGCATCTGGGAGGCTGG + Intronic
1083321269 11:61848517-61848539 AGGAGAGGTATCTGTGTAGCAGG - Intronic
1083742087 11:64716467-64716489 GGGAATGTTATCTGGGTGGAGGG + Intronic
1084260827 11:67977529-67977551 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
1084807787 11:71591015-71591037 AGGAAGGGTATCAGAGGGGGAGG + Intronic
1084811823 11:71616588-71616610 AGGAAGGGTATCAGAGGGGGAGG + Intergenic
1084848268 11:71917982-71918004 GGGGAAGGTTTCTGGCTGGGAGG - Intronic
1085142562 11:74160583-74160605 AGGGAAGGTAGCAGGGAGGGAGG + Intronic
1086510769 11:87555453-87555475 AGGAAAGGAAGCTGGGTAGGTGG + Intergenic
1087675779 11:101159362-101159384 AGGAAAGGTAAGGGGGAGGGAGG - Intergenic
1088097013 11:106113166-106113188 GGAAAAGTTATCTGGGTGAGTGG - Intergenic
1088723338 11:112613458-112613480 AGCCAAGGTATCTGGGATGGAGG + Intergenic
1089157625 11:116414394-116414416 AAGAAAGGGAGCTGAGTGGGAGG - Intergenic
1089200820 11:116723825-116723847 AGGAGAGGATGCTGGGTGGGAGG - Intergenic
1089682320 11:120125560-120125582 AGGAAGGGTGGGTGGGTGGGTGG + Intronic
1089766919 11:120774746-120774768 GGGAAAGATATCAGGGTGGCTGG + Intronic
1090288057 11:125517284-125517306 AAGAAAGGCAGCTGGGGGGGTGG - Intergenic
1090729230 11:129555392-129555414 AGCAAAGCTATCAGGGTGGCAGG + Intergenic
1091637501 12:2208583-2208605 AGGAAGGATGTCTGGGTGGTGGG + Intronic
1091653906 12:2330271-2330293 AGGAAATGTATCGGTGTGGGAGG + Intronic
1091710109 12:2733917-2733939 AGGCAAGGGGTCGGGGTGGGGGG - Intergenic
1092074811 12:5664259-5664281 TGGATAGGTAGATGGGTGGGTGG - Intronic
1092122736 12:6056149-6056171 AGGATAGGTATCTAGTAGGGCGG + Intronic
1092298202 12:7219336-7219358 AGGAAGGGTAGTGGGGTGGGTGG - Intergenic
1092432081 12:8418080-8418102 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
1094088816 12:26625190-26625212 GGGAAAGGTAGTGGGGTGGGCGG + Intronic
1095733943 12:45535972-45535994 TGGAAGGGTGGCTGGGTGGGTGG - Intergenic
1096506805 12:52098800-52098822 AGGAAGGGTATCAGAGGGGGAGG + Intergenic
1096508727 12:52115042-52115064 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
1096787444 12:54025515-54025537 ATGAAAGGTAATTGGGGGGGGGG + Intronic
1096811589 12:54173767-54173789 AGGGGAGCTGTCTGGGTGGGGGG - Intronic
1097596509 12:61639388-61639410 ACAAAAGGTAGGTGGGTGGGGGG - Intergenic
1097874745 12:64632610-64632632 ATGGAAGGTGGCTGGGTGGGAGG + Intronic
1098031923 12:66264294-66264316 AGTAAAAGTGTCTGGGAGGGAGG - Intergenic
1101345591 12:103883191-103883213 AGGGAAGGGAGGTGGGTGGGAGG + Intergenic
1102235759 12:111293573-111293595 AGGAAGGGAAGGTGGGTGGGAGG + Intronic
1102321303 12:111937229-111937251 AGCAGAGGTATCAGGCTGGGAGG + Exonic
1102640160 12:114360365-114360387 AGGATAGATGTATGGGTGGGTGG + Intronic
1102895610 12:116595810-116595832 AGGATAGGTGGCTGGGTGGGTGG + Intergenic
1104092468 12:125527496-125527518 TGGAAAGGTAAATGGGTGGATGG - Intronic
1104634063 12:130426827-130426849 AGGAAAGGCATCAGGGGGCGGGG + Intronic
1104960475 12:132486409-132486431 AGGAAAGGGACCTGGGCTGGTGG + Intergenic
1106325577 13:28685376-28685398 AGGAATGGGATCTGGGCTGGTGG + Intergenic
1106419184 13:29571559-29571581 TGGAAAGGCCTCTGGGTGAGCGG - Intronic
1106678023 13:31982305-31982327 AGGGAAGGGATGCGGGTGGGCGG - Intergenic
1107230418 13:38103635-38103657 AGGAAAGAGATCTGGATGGCTGG - Intergenic
1107264424 13:38536049-38536071 AAGGAAGGTAGGTGGGTGGGTGG - Intergenic
1110088379 13:71411838-71411860 GGGAAGGGTGTATGGGTGGGAGG - Intergenic
1110840142 13:80132843-80132865 AGGACAAGTATGTGGGTGTGAGG - Intergenic
1110992409 13:82058993-82059015 TGGAAAGGTAGGTAGGTGGGTGG + Intergenic
1112727439 13:102320586-102320608 AGGAAAGGGATCTGGTTTGCTGG + Intronic
1112791883 13:103011923-103011945 AAGAAAGATAGGTGGGTGGGTGG - Intergenic
1112885758 13:104168913-104168935 GGGAACGGTGTGTGGGTGGGAGG + Intergenic
1113741311 13:112714143-112714165 AGGAAAGGAAGCCGGGTGGGAGG - Intronic
1113857901 13:113458816-113458838 AGGGATGGTCTCTGGGTGGAAGG - Intronic
1114282975 14:21211665-21211687 GGGAAGGGTATTTGTGTGGGAGG - Intronic
1115471022 14:33768781-33768803 ATGAAAGGAATATTGGTGGGGGG - Intronic
1116113268 14:40613850-40613872 AGGAAAGTTATAAGGGGGGGAGG + Intergenic
1116417265 14:44693971-44693993 AGGAAAGGTATTTGGGTTTTTGG - Intergenic
1116852511 14:49922553-49922575 AAAAAAATTATCTGGGTGGGGGG + Intergenic
1116883608 14:50196559-50196581 AGGAAAGGTAGCTGGAGTGGGGG - Intronic
1117000122 14:51363797-51363819 GGGAGAGGTATCTGGGCTGGGGG + Intergenic
1117039090 14:51753514-51753536 AGGAAGGGTATCAGAGGGGGAGG + Intergenic
1117625997 14:57638715-57638737 AGGAAAGGCAGGTGGGTGGCGGG + Intronic
1118598636 14:67455306-67455328 AGGAAAGGCCTTGGGGTGGGAGG - Intronic
1118893110 14:69925180-69925202 AGGTAGGGGAGCTGGGTGGGAGG + Intronic
1119089314 14:71765828-71765850 AGGAAAGGAATGAGGGAGGGAGG - Intergenic
1119181695 14:72609699-72609721 AGGACAGCTAACGGGGTGGGAGG + Intergenic
1119583683 14:75811789-75811811 AGGTTATGTATCTGGGTGGATGG + Intronic
1119614022 14:76086506-76086528 AGGAAAGGCCTCTGGGTGTCTGG + Intergenic
1120008117 14:79382979-79383001 ATGAGAGGTGTGTGGGTGGGTGG + Intronic
1120023176 14:79553041-79553063 AGGAAAGGAATGTGGGGGGTGGG + Intronic
1120255310 14:82111283-82111305 AGAAAAGGGATTTGGGTTGGGGG + Intergenic
1120642973 14:87037836-87037858 AGGAAGGGTCTCTGTGTGGATGG + Intergenic
1122128715 14:99592968-99592990 AGAAAGGGTGGCTGGGTGGGGGG + Intronic
1122205862 14:100147662-100147684 AGGAAAGGCATCCTGGGGGGGGG - Intronic
1122519574 14:102333980-102334002 AGGAGAGGGATGTGGGTGGCAGG - Intronic
1122692437 14:103537674-103537696 GGGCAGGGTTTCTGGGTGGGTGG + Intergenic
1122923602 14:104890051-104890073 TGGATAGGTTGCTGGGTGGGTGG + Intronic
1123587196 15:21771230-21771252 TGGATAGGTAGATGGGTGGGTGG + Intergenic
1123623834 15:22213795-22213817 TGGATAGGTAGATGGGTGGGTGG + Intergenic
1123633035 15:22275142-22275164 AGGATAGGTGAGTGGGTGGGTGG - Intergenic
1124656833 15:31515866-31515888 TGGACAGGTGTATGGGTGGGTGG - Intronic
1125409359 15:39389323-39389345 ACGAAAATTAGCTGGGTGGGTGG - Intergenic
1126622793 15:50656728-50656750 AGAGAAGGTCTCTGGGTGGTAGG - Intronic
1126652245 15:50936527-50936549 AGGAAAGGGAACTGGGTGGTGGG - Intronic
1127937759 15:63659402-63659424 AAGAAAAGTAGCTGGGTGGGTGG - Intronic
1128362737 15:66973852-66973874 GGGAAAGGAGTCGGGGTGGGGGG + Intergenic
1128648221 15:69392508-69392530 AGGAATGTTAGATGGGTGGGCGG - Intronic
1128685300 15:69679953-69679975 CGGAAAGGTAACGGTGTGGGAGG + Intergenic
1130102398 15:80903883-80903905 AGGAAAGGTTTTTCTGTGGGTGG + Intronic
1130573414 15:85069490-85069512 AGGAAAGATGTCTGGGGTGGGGG - Intronic
1131175923 15:90209787-90209809 AGGAAAGCCTTCTGGGTGGAGGG + Intronic
1131320954 15:91390628-91390650 AGGACAGGTATTTAGGTTGGTGG + Intergenic
1131360156 15:91783692-91783714 GGCAAAGGTTTCAGGGTGGGAGG - Intergenic
1131523799 15:93136786-93136808 GGGAAAGGTGTCAGGGAGGGTGG + Intergenic
1132701221 16:1222923-1222945 AGGGAAGGTGGCTGGGTGAGAGG + Intronic
1132994082 16:2814011-2814033 AGGGATGGGAGCTGGGTGGGTGG - Intergenic
1133454573 16:5930931-5930953 AGGATGGGTAGGTGGGTGGGTGG + Intergenic
1133602696 16:7355418-7355440 AGGTATTGTCTCTGGGTGGGAGG - Intronic
1133739490 16:8640655-8640677 AGGGAAGGAAGATGGGTGGGTGG + Intronic
1133888144 16:9851142-9851164 AGGAGAGGTGACAGGGTGGGAGG + Intronic
1134475120 16:14566833-14566855 AGTACAGGTTGCTGGGTGGGTGG + Intronic
1135933163 16:26756819-26756841 TGGATAGATATGTGGGTGGGTGG + Intergenic
1136607980 16:31349305-31349327 TGGAAGGGTAGATGGGTGGGTGG - Intergenic
1137577993 16:49616322-49616344 AGGAAGGGTAGCAGGGAGGGAGG + Intronic
1138198021 16:55068501-55068523 AAGGAAGGTATCTGTGTGGGGGG - Intergenic
1140045582 16:71438533-71438555 AGGTAAGGGATATTGGTGGGCGG + Intergenic
1141619041 16:85227025-85227047 ATGAAAGGAAAATGGGTGGGTGG - Intergenic
1141658087 16:85426683-85426705 AGGATGGGTAGATGGGTGGGTGG + Intergenic
1142025895 16:87813426-87813448 AGGAAAGATATCAAGGTGGGAGG - Intergenic
1142431877 16:90033202-90033224 AGGAAAAGTCTCTGGGTGTCAGG - Intronic
1142821949 17:2476272-2476294 AGGAAAGTAATCTGAGTTGGAGG + Intronic
1143125664 17:4639740-4639762 AGGAGACGTATCGGGGTGCGGGG + Intronic
1143402811 17:6657083-6657105 AGGAGACGTATCGGGGTGGGGGG - Intergenic
1143613218 17:8032814-8032836 AGAAAGGGTATGTGGGAGGGAGG - Intergenic
1144325109 17:14171748-14171770 AGAAAAGCAATCTGGGTTGGAGG - Intronic
1144473983 17:15568627-15568649 AGAAAAGCAATCTGGGTTGGAGG - Intronic
1144678859 17:17179563-17179585 AGGACTGCTATCTGGGTGGGTGG + Intronic
1146673215 17:34756244-34756266 AGGATAGGGATGTGGGTGTGGGG - Intergenic
1146924608 17:36735694-36735716 TAAAAAGTTATCTGGGTGGGTGG + Intergenic
1147133841 17:38424193-38424215 AGGAAAAGTATCTGGAGGGTGGG - Intergenic
1147686488 17:42289267-42289289 AGGAAAGCTATCTGTGGGAGGGG + Intronic
1147688648 17:42301840-42301862 AGGGAAGGCATCTGAGTAGGAGG - Intronic
1148441013 17:47711611-47711633 AGGAAATGTAGGTGGGTGGGTGG - Exonic
1148756238 17:49974447-49974469 AGGAAAAATCGCTGGGTGGGTGG - Exonic
1148799872 17:50217178-50217200 ATGAAATGTAGTTGGGTGGGGGG - Intergenic
1149029167 17:52064490-52064512 AGGAAAGAAATCTGGCTGGTTGG - Intronic
1151165135 17:72196963-72196985 AGGAGAGGGATCTGGGTTAGAGG + Intergenic
1152034154 17:77861707-77861729 AGGAAGGGCATATGGATGGGTGG + Intergenic
1152508265 17:80767585-80767607 AGTAAAGATATCTGGGTGCGGGG - Intronic
1153016583 18:587837-587859 GGGAAAGGTATGTGGGTAGAGGG - Intergenic
1153834958 18:8955575-8955597 AGGAAAGGTATCTGATTGAACGG - Intergenic
1154342431 18:13515002-13515024 ATGGAAGGTATTTAGGTGGGTGG + Intronic
1157393727 18:47324814-47324836 AGGACAGGGTTGTGGGTGGGTGG - Intergenic
1157817894 18:50743631-50743653 AGAAAATGTCTCTGGGTGGCAGG - Intergenic
1157988940 18:52472285-52472307 AGGGAAGGAAGCTGGGTTGGTGG - Intronic
1158310473 18:56152516-56152538 GGGAAGGGAATCAGGGTGGGGGG - Intergenic
1158505431 18:58043438-58043460 AGAAACGGTAGCTGGGTGGTGGG + Intergenic
1158910390 18:62055484-62055506 AAGGAGGGTTTCTGGGTGGGAGG + Intronic
1159137604 18:64354960-64354982 AGAAAAGGTACATGGCTGGGTGG + Intergenic
1159820940 18:73142859-73142881 AGGAGAGGTATCAGGGCTGGAGG + Intergenic
1160918220 19:1507633-1507655 AGCGAAGGCACCTGGGTGGGAGG + Exonic
1161077775 19:2294627-2294649 AGGAGGGGCCTCTGGGTGGGGGG + Intronic
1161325923 19:3664184-3664206 AGGAAAGGGATGTGGGTGCCAGG + Intronic
1162377000 19:10310674-10310696 GGGCAAGCTAGCTGGGTGGGTGG + Intronic
1162821595 19:13226609-13226631 AGGACAGGGATCTGGAGGGGTGG + Intronic
1163169018 19:15517860-15517882 AGGAAAGGAATGTGGATGGAGGG + Intronic
1164904974 19:31959871-31959893 GGGAAAGGTGGCTGGGGGGGGGG + Intergenic
1165648383 19:37464990-37465012 AAGAAAGGTAAGTGGATGGGAGG - Intronic
1165724596 19:38103973-38103995 ATGAGAAGTAGCTGGGTGGGTGG + Intronic
1166224717 19:41387805-41387827 AAAAAAGGTAGCTGGGTGTGGGG + Intronic
1166312616 19:41971254-41971276 TGGAAAGGTAGGTGGGTGAGGGG - Intronic
1166749850 19:45159518-45159540 AGGCCAGGGATTTGGGTGGGGGG + Intronic
1167565682 19:50255187-50255209 AGGACAGATGTGTGGGTGGGTGG - Intronic
1167608782 19:50496203-50496225 AAGAAAGGAATGGGGGTGGGGGG + Intergenic
1168633082 19:57972437-57972459 AGCCAAGGGATCTGGGAGGGCGG - Intronic
1202705409 1_KI270713v1_random:19849-19871 AGGAAACGAAGTTGGGTGGGAGG + Intergenic
925978320 2:9156506-9156528 TGGAAAGGTAGATAGGTGGGTGG + Intergenic
928166419 2:28975859-28975881 AGGAAAGGCATAGGGGTGTGAGG - Intronic
928375237 2:30768409-30768431 AAGACAGGTGACTGGGTGGGAGG + Intronic
928567412 2:32567318-32567340 AGGAAAGGTATGTGGATATGGGG - Intronic
929259174 2:39845429-39845451 AGGAGAGTTGTCTAGGTGGGTGG + Intergenic
929612148 2:43278951-43278973 AGGAAAGGTCTCTGGATCAGCGG - Intronic
929716588 2:44317024-44317046 AGGGAGGGTGTGTGGGTGGGAGG + Intronic
930090056 2:47525489-47525511 TGGAGAGTTCTCTGGGTGGGAGG + Intronic
931092563 2:58901462-58901484 AGGAGAGGTAGCTGGGTGAGAGG + Intergenic
932353735 2:71051562-71051584 AGGAAGGGTATCAGAGGGGGAGG + Intergenic
933930219 2:87142981-87143003 AAAAAAATTATCTGGGTGGGCGG + Intergenic
934001552 2:87718768-87718790 AAAAAAATTATCTGGGTGGGCGG + Intergenic
934061190 2:88295794-88295816 AGGAGAGGTCTCTAGGTGGAGGG + Intergenic
934575967 2:95401864-95401886 AGGAAAGGTGTCTGGGTGGGTGG - Intergenic
934586466 2:95502394-95502416 AGGAAAGGTAGCTGTGTATGTGG - Intergenic
934591086 2:95550702-95550724 AGGAAGGGTATCAGAGGGGGAGG + Intergenic
934638139 2:96009721-96009743 AGGAAAGGTATCTGGGTGGGTGG - Intergenic
934795513 2:97095689-97095711 AGGAAAGGTATCTGGGTGGGTGG + Intergenic
937223337 2:120354256-120354278 AGGATAGGAATGGGGGTGGGAGG + Intergenic
937327162 2:120996964-120996986 AGAAAAAATATCTGGCTGGGAGG + Intergenic
937658722 2:124406847-124406869 AGGAAAGGTATATGTGAGGTTGG - Intronic
938188730 2:129255562-129255584 TGGATGGGTATCTTGGTGGGTGG - Intergenic
938188795 2:129255904-129255926 TGAATAGGTATCTTGGTGGGTGG - Intergenic
938894624 2:135737946-135737968 AGGAAGGGTAGGGGGGTGGGAGG - Intergenic
940276404 2:151945185-151945207 AGGAAAGCTATCTGGGATAGTGG + Intronic
940555446 2:155221138-155221160 GGGAAAGGTAGTCGGGTGGGTGG + Intergenic
940661439 2:156549775-156549797 ATGCCAGGTATCTGGGAGGGAGG + Intronic
940863203 2:158790997-158791019 AAGAAAGCTAACTGGGAGGGTGG - Intergenic
940869801 2:158850203-158850225 AGGAAGGGTATCAGAGGGGGAGG + Intronic
940872486 2:158871202-158871224 AGGAAGGGTATCAGAGGGGGAGG + Intergenic
941861573 2:170286873-170286895 AGGAAGGGTAGCAGGGAGGGAGG - Intronic
943174208 2:184448713-184448735 AGGGAAGGTATATGGATGTGTGG - Intergenic
943772659 2:191735156-191735178 AGGAAGGAGATATGGGTGGGAGG + Intergenic
944555962 2:200888197-200888219 AGGGAAGGTATCTGGGTTATTGG - Intronic
944632545 2:201642512-201642534 AGGTTGGGTCTCTGGGTGGGTGG - Intronic
946060763 2:216939437-216939459 ATGAAAATTATCTGGGTGTGGGG + Intergenic
946070401 2:217029882-217029904 AGGAGAGTGATCTGGGTGGGAGG + Intergenic
946240750 2:218353815-218353837 AGTAAAGGTATTTGGGAGGCTGG - Intergenic
946278370 2:218647757-218647779 AGGGAAGGGGTCTGGGTGAGTGG - Intronic
946378737 2:219330596-219330618 AGGAGTGGGATCTGGATGGGTGG - Intronic
947515359 2:230799462-230799484 AGGAAAGGTAGATGGGGGAGCGG - Intronic
948030071 2:234810160-234810182 AGGAAAGGTTTCGGCGGGGGGGG - Intergenic
948426640 2:237891931-237891953 AGGAGAGGTATCAGGATGAGAGG - Intronic
949047368 2:241878016-241878038 AGGAGAGGGATGGGGGTGGGGGG - Intergenic
1170170798 20:13409970-13409992 TGGAAAGGTGTGTGAGTGGGAGG - Intronic
1170305937 20:14937830-14937852 AGGAAGGGTAAGGGGGTGGGAGG - Intronic
1170868810 20:20185562-20185584 AGGAAAGACAGCTGGGTGGAGGG + Intronic
1171430736 20:25081928-25081950 AGGACAGGGATCTGGCTGCGAGG - Exonic
1171958438 20:31476605-31476627 GGTGAAGGTTTCTGGGTGGGAGG - Exonic
1172899111 20:38321050-38321072 TGTAAAGGTAGGTGGGTGGGTGG + Intronic
1173270984 20:41534565-41534587 AGGAAAGATTTTTGGGGGGGCGG + Intronic
1173291041 20:41715519-41715541 AGGAAAGCTGCCTGGGTGGATGG + Intergenic
1173797096 20:45869220-45869242 ATGAAATGTTTCTGGGTGGCCGG + Intronic
1175901226 20:62360587-62360609 AGGATAGGTAGGTGGGTGGGTGG + Intronic
1176001316 20:62832641-62832663 TGGAAAAGTGTCAGGGTGGGTGG + Intronic
1176163301 20:63659522-63659544 AGGAAAGGACTGCGGGTGGGTGG + Intronic
1176444148 21:6803806-6803828 GGGAAAGGTAGTTGGGGGGGAGG - Intergenic
1177615033 21:23505685-23505707 TGGCAAGGTATCTGGGTGGTGGG + Intergenic
1178794877 21:35734659-35734681 GGGAAGGGTGTGTGGGTGGGAGG + Intronic
1179610607 21:42547763-42547785 AGGAATGGTATTTGGGGCGGGGG - Intronic
1181042624 22:20199446-20199468 TGGATAGGTATATGGGTGGAGGG - Intergenic
1181602241 22:23959524-23959546 AGGAGAGGTATCTGGGGAGAAGG - Intronic
1181606269 22:23981784-23981806 AGGAGAGGTATCTGGGGAGAAGG + Intronic
1181672211 22:24430947-24430969 AGGCCAGGCACCTGGGTGGGAGG + Intronic
1182086694 22:27565742-27565764 AGGAAGGGTGAGTGGGTGGGTGG + Intergenic
1182281017 22:29217704-29217726 AGGAAAGGGAGGTGGGTGAGTGG + Intronic
1183359805 22:37377558-37377580 AGGAAAGGGAAATGGGTGAGGGG + Intronic
1183466960 22:37984698-37984720 AGGGCAGGGAGCTGGGTGGGGGG - Intronic
1183660934 22:39220752-39220774 CGGATAGGTAGATGGGTGGGTGG + Intergenic
1183661209 22:39222545-39222567 AGGAGAAGGATCTGGCTGGGAGG - Intergenic
1183944895 22:41319873-41319895 ATGAAAATTATCTGGGTGCGTGG + Intronic
1184642271 22:45879010-45879032 AGGAAGGGCAGCTGGCTGGGAGG - Intergenic
1184658148 22:45952442-45952464 AGGAAGAGCATCTGGATGGGTGG + Intronic
1184954919 22:47879556-47879578 AGGAAAGGTTTGTGGGTTGCAGG - Intergenic
1185383596 22:50521603-50521625 AAGAAAGGTAATTGGGTGGAAGG + Exonic
949770816 3:7575540-7575562 AGGCAGCGTATCTGTGTGGGTGG + Intronic
949884864 3:8684770-8684792 AGGAAGGGTATCAGAGGGGGAGG + Intronic
950081387 3:10224712-10224734 TGGATGGGTATGTGGGTGGGAGG - Intronic
950095137 3:10324609-10324631 AGGAGAGAGATTTGGGTGGGAGG + Exonic
950932991 3:16809573-16809595 GGCAAAGGTATAGGGGTGGGTGG + Intronic
951229074 3:20155818-20155840 AAAAAAGGTATCTGTGTAGGGGG + Intergenic
953679776 3:45030512-45030534 TGAAAAGGTAGCTGGGTGGTGGG + Intronic
954580529 3:51700682-51700704 AGGGAAGGAAGCTGGGTGGGTGG - Intronic
955294846 3:57725479-57725501 TGGAAAGGTACCTGGGAAGGGGG - Intergenic
955511177 3:59681837-59681859 TGGAAAGGTGGGTGGGTGGGAGG + Intergenic
956319635 3:67982574-67982596 GGGAAGGGTGTATGGGTGGGGGG - Intergenic
956451056 3:69375167-69375189 TGGACAGGTAAGTGGGTGGGTGG - Intronic
957044098 3:75360899-75360921 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
958264553 3:91422727-91422749 AGGCAAGGATTCTGGGTAGGAGG - Intergenic
959714493 3:109417626-109417648 AGAAAGGGTCTCTGGGTGGCTGG + Intergenic
959982305 3:112529524-112529546 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
960734909 3:120768308-120768330 AGGGAAGGCATCTGGGTAGAGGG + Intronic
961275406 3:125722103-125722125 AGGAAGGGTATCAGAGGGGGAGG + Intergenic
961492892 3:127267458-127267480 TGGCAAGGTTTCTGGGTGGGTGG + Intergenic
961661350 3:128470224-128470246 AGGAAACGTGTGTGGGTGGCTGG - Intergenic
961941073 3:130637516-130637538 GGAAAAAGTAGCTGGGTGGGTGG - Intronic
962518095 3:136172368-136172390 GGTATAGGTAACTGGGTGGGGGG - Intronic
962743316 3:138379171-138379193 GGGAAGGGTGTGTGGGTGGGGGG - Intronic
962945430 3:140164920-140164942 TGGATAGGTAGATGGGTGGGTGG + Intronic
963033674 3:141005206-141005228 GGGAAGGGTAGCGGGGTGGGTGG - Intergenic
963591750 3:147269605-147269627 AGGAAAGTTATTTGGGAGGTAGG - Intergenic
964367994 3:155970088-155970110 AGGAAAGGTTTCTGGCATGGAGG + Intergenic
964620404 3:158715434-158715456 AGAAAAGGTGTCTGGGGAGGTGG + Intronic
966355259 3:179072337-179072359 AGGGAAGGTGTGTGTGTGGGTGG - Intergenic
966694077 3:182771574-182771596 TGGAAGGGTGTGTGGGTGGGAGG - Intergenic
969025039 4:4166268-4166290 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
969458734 4:7316034-7316056 AGGAAAGCTAGCTGGATGGTTGG - Intronic
969458759 4:7316190-7316212 AGGAAAGCTAGCTGGATGGGTGG - Intronic
969729772 4:8947363-8947385 AGGAAGGGTATCAGAGGGGGAGG + Intergenic
969785929 4:9456914-9456936 AGGAAGGGTATCAGAGGGGGAGG + Intergenic
970567412 4:17346171-17346193 AGGAAGGGAAACTGGGTGGCTGG - Intergenic
971041000 4:22752119-22752141 AGGAAAAGTTTCTGTGTGGTGGG - Intergenic
972418430 4:38865019-38865041 AAGAAAGAAATATGGGTGGGAGG + Intergenic
973060307 4:45715984-45716006 AAGAAAGGTAGCTGAGTGAGAGG + Intergenic
974847226 4:67365530-67365552 AGAAAAGGCAGATGGGTGGGAGG + Intergenic
975119420 4:70712430-70712452 AGTAAAGGTTGCTGGGTAGGAGG + Intronic
975675475 4:76823404-76823426 GGGAAGGGTGTGTGGGTGGGAGG - Intergenic
977000355 4:91490594-91490616 GGAAAAGGTATTGGGGTGGGAGG + Intronic
977817793 4:101435698-101435720 GGGAAAGGTATGTGTGTGGGAGG - Intronic
977855677 4:101888400-101888422 AGGAAAGTGATGTGTGTGGGAGG - Intronic
977939221 4:102840561-102840583 GGGAAAGGTGTCTGGGTGGGAGG + Intronic
979588964 4:122455736-122455758 AGGAAAGGTTTCTAAGTGAGAGG - Intronic
982791656 4:159599157-159599179 ATGAAAGCTGTCTGGGAGGGTGG - Intergenic
983073040 4:163292307-163292329 AGGAAAGTAATCTGGGTGTAAGG + Intergenic
984842729 4:184083006-184083028 ACAAAAATTATCTGGGTGGGGGG + Intergenic
985952429 5:3233165-3233187 GGGAAAGGTGTGTGGGTGGGAGG - Intergenic
986020270 5:3795136-3795158 TGGATAGGTAGATGGGTGGGTGG + Intergenic
986624696 5:9712792-9712814 ATGAAAGGAATGTGGGAGGGTGG + Intergenic
989997247 5:50850256-50850278 AGGAAGGGTAGCCGGGTTGGGGG - Intergenic
991396537 5:66209928-66209950 AGGAAAGGAAGCCGCGTGGGAGG - Intergenic
991497011 5:67236665-67236687 AGGACAGGTTGCAGGGTGGGTGG + Intergenic
992707654 5:79413588-79413610 AGGGAAGGTATGGGGGTAGGGGG - Intronic
993058956 5:83016072-83016094 GGGAAAGGTAGCTGGGAGGCTGG + Intergenic
994031822 5:95151883-95151905 AGGAAAAGTATATGTGTGGAAGG - Intronic
994744446 5:103661604-103661626 AGGAAAAGAATGAGGGTGGGTGG + Intergenic
996403300 5:123085695-123085717 AGGAAATGGATGGGGGTGGGGGG - Intergenic
997850148 5:137325111-137325133 AGGAAAGGTTTTTGGGATGGGGG + Intronic
998153738 5:139772145-139772167 TGGAAGGGCAGCTGGGTGGGAGG + Intergenic
998168851 5:139860240-139860262 AGGAAAGGTAAGTGGGGGTGGGG + Intronic
998399153 5:141839045-141839067 AGGAAACATCTCAGGGTGGGGGG + Intergenic
998887002 5:146705432-146705454 GGGTAATGAATCTGGGTGGGTGG + Intronic
998919797 5:147055629-147055651 AGGGAGAGTGTCTGGGTGGGTGG - Intronic
999150676 5:149424133-149424155 AGGAAATGTCTCTGGCTGTGGGG - Intergenic
999349981 5:150860651-150860673 AGCACAGGGATCTGGGTGGAAGG - Intronic
999663390 5:153888933-153888955 AGGCAAGGCAATTGGGTGGGAGG - Intergenic
1000082083 5:157858531-157858553 AGGGAAGGTTTGGGGGTGGGGGG - Intronic
1000808417 5:165827490-165827512 AGGAAAGGATTCTGGGAAGGTGG - Intergenic
1001098540 5:168795248-168795270 AGTAAAACTATCTGTGTGGGAGG - Intronic
1001146774 5:169191905-169191927 AGGGAAGGTACCTGGGAGGCTGG - Intronic
1001269976 5:170303519-170303541 AGGCAAGATTTCTGGGTGGTGGG + Intergenic
1001574048 5:172750264-172750286 AGGGGATGTCTCTGGGTGGGCGG - Intergenic
1001642348 5:173253286-173253308 AGGGAAGGGTTCTGGGTGTGGGG + Intergenic
1001732096 5:173968264-173968286 AGGAAAGGAATGTGGGAGAGGGG - Intergenic
1003116091 6:3284752-3284774 GGGACAGTTGTCTGGGTGGGGGG - Intronic
1003338410 6:5196571-5196593 AGGAGAGGCATCTGGATGGTCGG - Intronic
1003645032 6:7907839-7907861 AGGAAAGGAGGCTGAGTGGGCGG - Intronic
1003968650 6:11277890-11277912 AGAGAATGAATCTGGGTGGGTGG - Intronic
1004774186 6:18823894-18823916 AGGAAGAGTTTATGGGTGGGAGG + Intergenic
1004870499 6:19899408-19899430 AAGAAAGGTATATGGGTTAGAGG + Intergenic
1005375621 6:25179531-25179553 AGGAAAGGACACTGGGAGGGTGG - Intergenic
1006119431 6:31795176-31795198 GGGGAAGGCATCTGGGTGAGGGG + Exonic
1006188413 6:32192962-32192984 AGGGAAGGGACCTGGCTGGGGGG - Intronic
1006235835 6:32631273-32631295 AGGAAAGGTATCTGTATAGCCGG + Intronic
1006426058 6:33963621-33963643 ACCAAAGGAAGCTGGGTGGGAGG - Intergenic
1006428804 6:33982683-33982705 AGGAAAGGAAAGTGGGTGGCAGG + Intergenic
1006437344 6:34032917-34032939 AGTAAAGGTACCTGGCTGGGAGG - Intronic
1006588722 6:35138580-35138602 GGGAAGGGTAGTTGGGTGGGGGG + Intronic
1006730327 6:36231326-36231348 AGGGAAGGTCTGTGGGTGGGAGG - Exonic
1007744480 6:44034916-44034938 AGGTAAGAGGTCTGGGTGGGAGG - Intergenic
1007749739 6:44064566-44064588 AGGGAAGGGATCTGGCTGGGAGG + Intergenic
1008137623 6:47795168-47795190 AGGGGAGGTATCTGGGTGTAGGG + Intronic
1008990889 6:57600247-57600269 AGGCAAGGATTCTGGGTAGGAGG + Intronic
1009179411 6:60498481-60498503 AGGCAAGGATTCTGGGTAGGAGG + Intergenic
1009451958 6:63811745-63811767 AGGGAAGGGATTTGGGTTGGGGG - Intronic
1010044616 6:71426721-71426743 AGAAAAGGTGTGTGGGTGTGAGG + Intergenic
1010274777 6:73956736-73956758 GGGAAAGGTATCTTTTTGGGGGG - Intergenic
1010486693 6:76422923-76422945 AGGGAAGGTATCTCTGTAGGAGG - Intergenic
1011170490 6:84499425-84499447 AGGAAAGTTATCTGGGAGAAGGG - Intergenic
1011696036 6:89913668-89913690 GGAAAGGGTATGTGGGTGGGAGG - Intergenic
1011752720 6:90469516-90469538 GGGAAGGGTGTCTGGGCGGGAGG - Intergenic
1013455046 6:110322905-110322927 AGGAAGAGGAACTGGGTGGGAGG + Intronic
1013650179 6:112186991-112187013 AGGAAAGGTGGGTGGGTGGTGGG + Intronic
1015973875 6:138769721-138769743 ATGCAAGGGATCTAGGTGGGCGG - Intronic
1016521579 6:144952522-144952544 AGGAAAGGAAAGTGGGAGGGAGG - Intergenic
1016522768 6:144964905-144964927 ACAAAAAGTAGCTGGGTGGGAGG + Intergenic
1016771562 6:147857874-147857896 AGTAAAGGTATCTGGCTTTGGGG - Intergenic
1016801037 6:148169134-148169156 AGGAAAGATATCTGGAAGTGAGG + Intergenic
1017181465 6:151556879-151556901 GGGAAGGGTAAGTGGGTGGGAGG - Intronic
1017319250 6:153069452-153069474 AGGAAGGGTATTGGGGTGTGGGG + Intronic
1017555119 6:155555810-155555832 CTGCAAGGTGTCTGGGTGGGAGG - Intergenic
1017686243 6:156915968-156915990 AGGAAAGTGAGCTGGGGGGGTGG - Intronic
1019015776 6:168878685-168878707 GGGACAGTTACCTGGGTGGGGGG - Intergenic
1019015856 6:168878941-168878963 GGGAGAGTTAACTGGGTGGGGGG - Intergenic
1019350386 7:551633-551655 AGGAGAAGGACCTGGGTGGGAGG - Intronic
1019516057 7:1440694-1440716 AGGCAAGGGGTCTGGGTGTGAGG + Intronic
1019557805 7:1641296-1641318 AGGAAGGGTACCTGAGTGTGAGG - Intergenic
1019620063 7:1987554-1987576 AGGAAAGCCATCGGGGAGGGGGG + Intronic
1019932032 7:4230164-4230186 AGGAAGGGTGGGTGGGTGGGTGG + Intronic
1020050306 7:5076964-5076986 AAGAAAGGAGTCTGGGTGTGGGG - Intergenic
1020088289 7:5323333-5323355 AGGACAGGTGTGGGGGTGGGGGG - Intronic
1020306727 7:6841395-6841417 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
1021385657 7:20026654-20026676 AGGTAAGGATTCTGGGTGTGAGG + Intergenic
1022900637 7:34806726-34806748 AGGAAAAGTATATAGATGGGAGG + Intronic
1023462270 7:40411611-40411633 AGGAAAGGTAGCAGGGAGAGGGG + Intronic
1023819459 7:43972559-43972581 AGGGGAGGTCTCTGAGTGGGAGG + Intergenic
1024074935 7:45813458-45813480 AGGCAAGGGATCAGCGTGGGAGG - Intergenic
1024074956 7:45813540-45813562 AGGCAAGGGATCAGCGTGGGAGG - Intergenic
1025002222 7:55325964-55325986 AGGAGAGGGATCTGGGTTTGTGG - Intergenic
1025129775 7:56369241-56369263 AGGCAAGGGATCAGCGTGGGAGG + Intergenic
1025665919 7:63583157-63583179 AGGACAGGTGTGGGGGTGGGCGG - Intergenic
1026129445 7:67607954-67607976 AGGAATGGTATTGGGGAGGGAGG + Intergenic
1027883739 7:83875433-83875455 AGCAAATGGATCTGAGTGGGTGG + Intergenic
1028073314 7:86479110-86479132 AGGCAAGTTACTTGGGTGGGGGG - Intergenic
1028922083 7:96320669-96320691 AGGAAAGTACTCTGGGTGTGTGG - Intronic
1029077885 7:97950341-97950363 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
1030086771 7:105822487-105822509 AGGAAGGATATCTGGGGTGGTGG + Intronic
1031161470 7:118173750-118173772 AGGTTAGGTAGCTGGGTGGCAGG + Intergenic
1031634655 7:124087001-124087023 AGGAAACTTATCTGGGAGGCAGG + Intergenic
1032158699 7:129492856-129492878 AAGATAGGGATCTGGATGGGAGG - Intergenic
1032491062 7:132324873-132324895 TGGAAAGGTATCTGAGTGTTGGG + Intronic
1032706220 7:134423077-134423099 AGGAAGGGTCTCTGGGGGTGGGG - Intergenic
1036240116 8:7074164-7074186 AGGAAGGGTATCAGAGGGGGAGG + Intergenic
1036629011 8:10497243-10497265 AGGGAAGATCTCTGGGAGGGTGG - Intergenic
1036819886 8:11932044-11932066 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
1038498428 8:28023790-28023812 AGGATAGGGATTGGGGTGGGGGG - Intronic
1038576120 8:28704456-28704478 AGGAAAGGCATGTGTGTGAGGGG - Intronic
1038980558 8:32754740-32754762 ATGGAAGGTATGTGTGTGGGTGG + Intronic
1040051656 8:43021233-43021255 AGAAAAAATATCTGGGTAGGTGG - Exonic
1044338378 8:91017076-91017098 AGGAAAGGAATATGAGTGGGAGG + Intronic
1044557983 8:93585438-93585460 TGGAAGGGTGTGTGGGTGGGAGG + Intergenic
1048427071 8:134332735-134332757 TGGATAGGTAGATGGGTGGGTGG - Intergenic
1048934672 8:139344932-139344954 AGGAAAGATATCTGGGGAGGTGG - Intergenic
1049477042 8:142801672-142801694 TGGAAAGGTGGATGGGTGGGTGG + Intergenic
1051050088 9:12922297-12922319 AGGAAAGGCATCTGGATTGCAGG - Intergenic
1051152843 9:14103325-14103347 AGTAAACTTATCTGGGTTGGGGG + Intronic
1051710794 9:19928375-19928397 AGGAGAGGTTTCTGGGTAGGGGG + Intergenic
1053043619 9:34895293-34895315 ATGAAAGGAATGGGGGTGGGAGG - Intergenic
1054459610 9:65455664-65455686 AGGAGAGGGAGATGGGTGGGAGG - Intergenic
1054703399 9:68436881-68436903 AGGAAATACATCTGGGTGGATGG - Intronic
1055577524 9:77674989-77675011 AGGAGTGGCATCGGGGTGGGCGG + Intergenic
1056738119 9:89226906-89226928 AGGAAATTCCTCTGGGTGGGAGG - Intergenic
1056821598 9:89845938-89845960 AGGGAAGGTGTTTGGGTGGAGGG + Intergenic
1056866139 9:90228657-90228679 AGGAAGGGTATCAGAGTGGGAGG + Intergenic
1056916888 9:90754252-90754274 AGGAAGGGTATCAGAGGGGGAGG - Intergenic
1057829063 9:98393271-98393293 TGGATAGGTATGTGGGTGGGTGG - Intronic
1060069424 9:120533420-120533442 AGGAAATGTTTTTGGGTGGAGGG - Intronic
1060898900 9:127240214-127240236 AGGAAAGGGAGTGGGGTGGGGGG + Intronic
1062182487 9:135198127-135198149 AGGAAAAGCATCCCGGTGGGAGG - Intergenic
1062520718 9:136956776-136956798 AGGATGGGTAGATGGGTGGGTGG + Intronic
1062597659 9:137306389-137306411 AGGAAAAGGATGTGGGTGAGGGG + Intergenic
1203525051 Un_GL000213v1:80721-80743 GGGAAAGGTAGTTGGGGGGGAGG + Intergenic
1185497289 X:565230-565252 AGGATAGGTAGGTGGGTGGATGG + Intergenic
1185867797 X:3639094-3639116 GGGATAGGTGTGTGGGTGGGTGG + Intronic
1186155233 X:6718592-6718614 AGGAAAGGTGGAAGGGTGGGAGG + Intergenic
1186481872 X:9902212-9902234 TGGAAAAGTAAGTGGGTGGGTGG + Intronic
1186751838 X:12629323-12629345 ATGAAAGGTATGGGGGTGGGAGG + Intronic
1186985681 X:15011261-15011283 AGGGAAGGAATCAGGCTGGGTGG + Intergenic
1187869008 X:23749067-23749089 AGGAAAGATATTTGGGTAGGAGG + Intronic
1188015708 X:25105570-25105592 AGGAAAGCAATGTGGGTGTGAGG - Intergenic
1189066985 X:37820469-37820491 TAGAAATGTATATGGGTGGGGGG - Intronic
1189267021 X:39725069-39725091 GAGAAAGGTAACTGGGTGGGTGG - Intergenic
1189885404 X:45539147-45539169 GGGGAAGGTAGTTGGGTGGGGGG + Intergenic
1190005715 X:46735905-46735927 AGACAAGGTGTCTGGGTGCGGGG - Intronic
1190748138 X:53338813-53338835 AGGAAAGGGAAGTGGGAGGGAGG - Intergenic
1190798814 X:53770021-53770043 AGGAAAGGGAAGTGGGAGGGAGG - Intergenic
1192070077 X:67929407-67929429 AGGAAAGGTATTGGGGTTGAAGG + Intergenic
1192428544 X:71097370-71097392 AGAAAAGGTGTTGGGGTGGGAGG - Intronic
1193870541 X:86792523-86792545 GGGAAAGGTATGTGTGTTGGGGG - Intronic
1194936197 X:99951850-99951872 AGGAAAGGTCTCTCTGAGGGAGG + Intergenic
1196801463 X:119546999-119547021 GGGGAAGGGAACTGGGTGGGTGG - Intronic
1196898180 X:120358605-120358627 AGCAAAGGTTTCTGGGAGGCTGG + Intergenic
1196921387 X:120589119-120589141 GGGAAGTGTATGTGGGTGGGGGG + Intergenic
1197179826 X:123522381-123522403 TGGAAGGGGATATGGGTGGGTGG - Intergenic
1197269579 X:124411098-124411120 TGAAAAGGTGTTTGGGTGGGTGG - Intronic
1197823281 X:130563137-130563159 AGGAAAGGGAAGCGGGTGGGGGG + Intergenic
1199118185 X:144017683-144017705 GGGAAGGGGATGTGGGTGGGAGG - Intergenic
1199192752 X:144990597-144990619 AGAAAGGGTATCTGGGGGGATGG - Intergenic