ID: 934638140

View in Genome Browser
Species Human (GRCh38)
Location 2:96009724-96009746
Sequence CTAAGGAAAGGTATCTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 2, 1: 0, 2: 3, 3: 16, 4: 206}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934638140_934638151 22 Left 934638140 2:96009724-96009746 CCCACCCAGATACCTTTCCTTAG 0: 2
1: 0
2: 3
3: 16
4: 206
Right 934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG 0: 2
1: 1
2: 0
3: 4
4: 63
934638140_934638149 15 Left 934638140 2:96009724-96009746 CCCACCCAGATACCTTTCCTTAG 0: 2
1: 0
2: 3
3: 16
4: 206
Right 934638149 2:96009762-96009784 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363
934638140_934638150 16 Left 934638140 2:96009724-96009746 CCCACCCAGATACCTTTCCTTAG 0: 2
1: 0
2: 3
3: 16
4: 206
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934638140 Original CRISPR CTAAGGAAAGGTATCTGGGT GGG (reversed) Intergenic
900848773 1:5125510-5125532 AAAAGGAAAGATTTCTGGGTAGG - Intergenic
901357640 1:8665098-8665120 CTTAGCAAAGGACTCTGGGTAGG - Intronic
902552873 1:17229709-17229731 CTAAGCAAAGGGGTCAGGGTGGG - Intronic
903808480 1:26021750-26021772 CTAAGGAAAGAGATCAGGATGGG + Intronic
904632905 1:31856393-31856415 GTAAGAAAAGGAATCAGGGTCGG + Intergenic
907456693 1:54580935-54580957 CTAAGGAAACGTATATGGTCTGG + Intronic
907570744 1:55480990-55481012 CTTAGGAGAGGGCTCTGGGTTGG + Intergenic
908047600 1:60187433-60187455 ATAAGGAAAAGTATCTGAGAAGG + Intergenic
908266776 1:62387000-62387022 CTGATGAAATGGATCTGGGTTGG + Intergenic
908907446 1:69032394-69032416 CTTGGGAAAGGTGTGTGGGTGGG + Intergenic
909023054 1:70453176-70453198 ATAAGGTAAGGTATGTGGGACGG + Intergenic
914922337 1:151855711-151855733 CTAAGCAAAGATATTTGAGTTGG + Intergenic
914952677 1:152130821-152130843 CTAAGGAGAGAAATCTGGGCTGG + Intergenic
915028901 1:152859235-152859257 CTAAGAAAAGTGAACTGGGTGGG + Intergenic
915905667 1:159875165-159875187 CAAAGGAAAGATAAATGGGTCGG + Intronic
920673592 1:208023610-208023632 ATAAGGTAAGGCAGCTGGGTTGG + Exonic
920758031 1:208753904-208753926 CTAAGGAGAGTTTTCTGGGCTGG + Intergenic
921592144 1:217016583-217016605 CTAGGGGAAAGTATCTGGGCTGG + Intronic
922972206 1:229752157-229752179 CTCAGGAAAAGTATGTGTGTGGG + Intergenic
924018985 1:239760536-239760558 GTAAGGAAAGGTGTGTAGGTGGG - Intronic
1065251877 10:23823642-23823664 CTACGAAAAGGCATCTTGGTAGG - Intronic
1065848472 10:29766096-29766118 CCAAGGAAAAATATCTGGGAAGG - Intergenic
1066233925 10:33467334-33467356 TTAGGGAACGGTTTCTGGGTGGG + Intergenic
1068974152 10:62990087-62990109 CTCAGGAAAGCAAACTGGGTGGG - Intergenic
1071887470 10:89966662-89966684 GTAAGGCAAGGTATGTGGGAAGG - Intergenic
1075501039 10:122974399-122974421 CTAGTGAGAGGTATCTGAGTCGG - Intronic
1077113441 11:872135-872157 CTAAGGGAAACTGTCTGGGTTGG - Intronic
1077816454 11:5690507-5690529 ATAAGGAAAGGAATGTGAGTTGG + Intronic
1078496113 11:11818816-11818838 CTGAGGCAAGGTACATGGGTAGG - Intergenic
1079175626 11:18137601-18137623 CTGATGACAGGTATCTGGGGCGG - Exonic
1081232184 11:40599096-40599118 CTAAGTAAAGATCTATGGGTGGG - Intronic
1085973464 11:81622922-81622944 TTAAGAAATGGTATCTGGCTGGG - Intergenic
1086510768 11:87555450-87555472 TCAAGGAAAGGAAGCTGGGTAGG + Intergenic
1086934289 11:92727884-92727906 CCAAGGAAAAGGATCTGGGGAGG - Intronic
1088295394 11:108287935-108287957 CTAAGAAAAGGTTATTGGGTTGG - Intronic
1089671940 11:120062767-120062789 CTAAGGAGAAGCGTCTGGGTGGG - Intergenic
1094026792 12:25968149-25968171 CTAAGAAATGGTACCTGGCTGGG - Intronic
1094248337 12:28329226-28329248 CTAAAGCAAGGTGTTTGGGTTGG + Intronic
1095205853 12:39440322-39440344 CTGAGTCAAGCTATCTGGGTTGG + Intronic
1096377831 12:51128847-51128869 CAAATGACAGGTATCTGGGATGG + Intronic
1097785634 12:63755824-63755846 CTAGGGAAAGGTATGAAGGTGGG - Intergenic
1098153937 12:67577494-67577516 CTAATGAAAGATATATGTGTAGG - Intergenic
1102882376 12:116495490-116495512 CTAAGTAAAGGAATGTGGCTAGG - Intergenic
1102896302 12:116601082-116601104 ATAAAGAAAGGTTTCTGGATGGG - Intergenic
1104559119 12:129828228-129828250 CTAAGGAAAATTCTCTGGCTCGG - Intronic
1106768155 13:32936602-32936624 CTAAGGAAAAGTTTCAGGGAGGG - Intergenic
1107752510 13:43584049-43584071 CTATGGAAAGGTAGCAGGGCAGG - Intronic
1110239232 13:73248334-73248356 CTGAGGAAAGTGATCTGGGATGG + Intergenic
1114265843 14:21071981-21072003 CAAAGGCAAGGTATGGGGGTAGG + Intronic
1115320997 14:32078138-32078160 CTAAAGAAAAGTATCGGGGTGGG + Intronic
1115517081 14:34196181-34196203 CTAAGAAGAGGTATGTGGGAAGG + Intronic
1115817502 14:37178694-37178716 CTTAGTAAAGGGATCTGGGTGGG - Intergenic
1116509503 14:45726437-45726459 CTCTGGGAAGGTCTCTGGGTGGG + Intergenic
1119078919 14:71673822-71673844 CTAAGGCAGGGTATGTGGGTAGG - Intronic
1121750415 14:96349822-96349844 CTCAGGAGAGCCATCTGGGTGGG + Intronic
1125807777 15:42509018-42509040 CTTTGGAGAGGTATCTCGGTTGG + Intronic
1127998866 15:64172286-64172308 ATAAGGTGAGGCATCTGGGTTGG - Intronic
1129045544 15:72730792-72730814 CTAAGGAAAGGTATCAAGGTGGG - Intronic
1129143915 15:73631091-73631113 CTAAAGCAAGGTTTCTGGATAGG - Intronic
1130755693 15:86760678-86760700 CAAAGGAAAGAAATCTAGGTGGG - Intronic
1133362972 16:5188531-5188553 ATAAGGAAAGGAATGTGAGTTGG + Intergenic
1133726315 16:8540861-8540883 CTAATGAGAGGTATCAGGGCAGG + Intergenic
1133819533 16:9224222-9224244 ATAAGGAAAGGAATGTGAGTTGG - Intergenic
1133845465 16:9449289-9449311 CTAGGGAAGGGTACCAGGGTTGG + Intergenic
1133908333 16:10041749-10041771 TCAAGGATGGGTATCTGGGTTGG - Intronic
1135979387 16:27135485-27135507 ATAAGGAAAGGAATGTGAGTTGG - Intergenic
1138057492 16:53850504-53850526 CTAAGGATAGGGATCTGAGCAGG + Intronic
1138319292 16:56098264-56098286 CCAAGGAAAGGGAGATGGGTGGG + Intergenic
1140822961 16:78680111-78680133 ATAAGAAAAGGTATCTAGGCTGG + Intronic
1141277122 16:82598418-82598440 CCTAGGAAAGGTATGTGGATTGG + Intergenic
1141426010 16:83945095-83945117 CTAAGGAAAGGCAATTCGGTGGG - Intronic
1144113935 17:12067116-12067138 CTAAGAATAGGTATGTGGGTGGG - Intronic
1144325110 17:14171751-14171773 CTCAGAAAAGCAATCTGGGTTGG - Intronic
1144473984 17:15568630-15568652 CTCAGAAAAGCAATCTGGGTTGG - Intronic
1148080240 17:44963994-44964016 CTGGGGAAAGGACTCTGGGTTGG - Intronic
1149691170 17:58578121-58578143 CTAAGGAATGGGATGGGGGTGGG - Intronic
1151193046 17:72412631-72412653 GTAAGGAAAGGAATGTGGGCCGG - Intergenic
1159820939 18:73142856-73142878 CTTAGGAGAGGTATCAGGGCTGG + Intergenic
1162266693 19:9581467-9581489 GTAAGGAAAGGTATGTGAGCTGG + Intronic
1162722088 19:12668618-12668640 CTAGGGAAAGGTAAGTGGGTGGG + Exonic
1164082302 19:21868986-21869008 CTAAGGAGAGGTATGTGGGATGG + Intergenic
1164189896 19:22904309-22904331 CTAAGGAGAGGTATGTGGGAAGG + Intergenic
1164615374 19:29664344-29664366 CTCAGGAGAGGACTCTGGGTTGG + Intergenic
1166655401 19:44607569-44607591 ATAAGGAAAGGAATGTGAGTTGG - Intergenic
1167304649 19:48700624-48700646 CTAAGAAATGGTAGCTGGCTGGG - Intronic
925377776 2:3400512-3400534 CTGAGGAAAGGCACCTGGGAAGG - Intronic
926073470 2:9920876-9920898 CTGAGGAGAGGAATCTGTGTAGG + Intronic
926557322 2:14374405-14374427 CTCAGGAGAGTTAGCTGGGTGGG + Intergenic
927443873 2:23140920-23140942 TTCAGGAAAGGCTTCTGGGTTGG + Intergenic
927887022 2:26724922-26724944 CTAAGGACGGGTCTCTGGGGTGG + Intronic
929553808 2:42911273-42911295 GGAAGGAAGGGTATTTGGGTAGG + Intergenic
929885356 2:45873076-45873098 CTAAAGAAGTATATCTGGGTAGG - Intronic
934575968 2:95401867-95401889 CTGAGGAAAGGTGTCTGGGTGGG - Intergenic
934638140 2:96009724-96009746 CTAAGGAAAGGTATCTGGGTGGG - Intergenic
934795512 2:97095686-97095708 CTAAGGAAAGGTATCTGGGTGGG + Intergenic
937702294 2:124877668-124877690 CAAAGGAAAGTTATTTGGGTGGG + Intronic
938313364 2:130309604-130309626 CCTAGGAAGGGTATTTGGGTGGG - Intergenic
942997340 2:182278975-182278997 CCAATGTAAGGTATCTGAGTTGG - Intronic
943410973 2:187547462-187547484 CTAATGACAAGTATCTGGGAGGG + Intronic
943707063 2:191046896-191046918 CTAATGAAGTGTATCTTGGTGGG + Intronic
943876566 2:193073699-193073721 GTAGGGAAAGATACCTGGGTGGG - Intergenic
944232903 2:197413715-197413737 CCAAGAAAATGTATATGGGTAGG + Intronic
944917373 2:204374854-204374876 TTCAAGAAAGGGATCTGGGTTGG - Intergenic
945802560 2:214451283-214451305 CTAAGGAAGGATAAGTGGGTCGG + Intronic
946316216 2:218914862-218914884 CTTAGGAAAGCCATCTAGGTAGG - Intergenic
1169252615 20:4072050-4072072 CCAAGGAGAGGAATCTGGGCAGG + Intronic
1169662642 20:7997483-7997505 ATAAGGAAAGGAATGTGAGTTGG - Intronic
1172738472 20:37147089-37147111 CTAAGGAAAGGAACCTGGGTAGG - Intronic
1173078963 20:39847848-39847870 CTAAAGAAAGGACTCTGGCTTGG - Intergenic
1177057157 21:16320156-16320178 CTCAGGAAAGGAGTCTGGATTGG + Intergenic
1177455537 21:21332721-21332743 GTCAGGCAATGTATCTGGGTTGG - Intronic
1181139665 22:20795249-20795271 ATAAGGAAAGGAATATGAGTTGG - Intronic
1181678258 22:24472103-24472125 ACAAGGAAAGGGCTCTGGGTAGG - Intergenic
1181767851 22:25104582-25104604 CAAAAGAAGGGTATCTGGGTGGG - Intronic
1182112508 22:27733608-27733630 CCAAGGTAGGGTGTCTGGGTAGG - Intergenic
1182647792 22:31824461-31824483 CTAAGGCTAGGAATCTGGGTTGG + Intronic
1184289766 22:43492459-43492481 CTAAGGAATGGCCTCTGGGTGGG - Intronic
950397791 3:12747205-12747227 TTAATGAAAGGTCTCTGGGCTGG - Intronic
951054657 3:18133684-18133706 CTAAGGAGAAGTATCTAGATAGG + Intronic
951519155 3:23595091-23595113 TTAAGGAAAAGAATCTTGGTTGG - Intergenic
951701588 3:25502476-25502498 GTTAGGAAAGATATCTGGGTGGG - Intronic
952144303 3:30514988-30515010 CTCAGGAAAGGTTGCTTGGTGGG - Intergenic
952983348 3:38756163-38756185 CTGGTGAAAGGGATCTGGGTGGG - Intronic
953307760 3:41845262-41845284 CCATTGAAAGATATCTGGGTCGG - Intronic
956538736 3:70309655-70309677 TTAAGAAAAAGTATATGGGTTGG - Intergenic
960633397 3:119756503-119756525 TTAAGGACAGGTATGTGGATTGG + Intronic
960851088 3:122055334-122055356 TTAAAGAAAGTTAGCTGGGTAGG + Intergenic
960886844 3:122404808-122404830 CTAAGGGAAGGGATCTTGGCTGG + Intronic
961492891 3:127267455-127267477 CAATGGCAAGGTTTCTGGGTGGG + Intergenic
962194836 3:133352696-133352718 CTAGGGCAAGGTATATGGGAGGG + Intronic
963117241 3:141740849-141740871 CTAAGGAAAGGGAACTAAGTGGG - Intronic
963504336 3:146164864-146164886 ATCAGGAAAGGTAACTGGGAAGG + Intergenic
963748861 3:149153323-149153345 TTAAGAATAGGAATCTGGGTTGG + Intronic
965590227 3:170356124-170356146 CTAAGGAAGGGAACTTGGGTGGG + Intergenic
965778732 3:172261003-172261025 CTAATGCAAGGAATGTGGGTGGG - Intronic
966427711 3:179798220-179798242 GTAAGGAAACATAACTGGGTAGG - Exonic
967120417 3:186377941-186377963 CTGAGGCAAGGCCTCTGGGTGGG - Intergenic
967550007 3:190781851-190781873 TTAATGTAAGGTATCTGTGTTGG + Intergenic
968938399 4:3625279-3625301 TGAAGGAAAGATGTCTGGGTTGG + Intergenic
969009897 4:4053439-4053461 CTATTGAAAGGCTTCTGGGTAGG - Intergenic
971345982 4:25812265-25812287 GTGAGGAGAGGTATCTGAGTGGG - Intronic
973755561 4:54070091-54070113 CTAAGCAAAGGTATGGAGGTAGG + Intronic
973871558 4:55171571-55171593 CTAAGGAAAGAAATGGGGGTCGG + Intergenic
974018427 4:56671293-56671315 CTAAGGAAAGGCATGTGATTGGG - Intronic
974398033 4:61365475-61365497 CAAGGGAAAGGTATCTGCCTTGG + Intronic
975082287 4:70295854-70295876 CTAAGGCAAGGTCACAGGGTGGG + Intergenic
976879080 4:89896457-89896479 CAAAGAAAAAATATCTGGGTGGG + Intronic
980932221 4:139192891-139192913 CTGAGCAAAGGCATATGGGTGGG - Intergenic
981408939 4:144405013-144405035 CTAAGGAAATGTATGTGGAGGGG + Intergenic
981976477 4:150735980-150736002 CTAAGCAAAGCTTTCAGGGTGGG + Intronic
982743945 4:159086918-159086940 CTAAGCAAAGGTCTGTGGGCAGG - Intergenic
982995463 4:162338361-162338383 ATAAGGAAAGGAATGTGAGTTGG + Intergenic
983003891 4:162458130-162458152 GTAAGAAAAGGTTTCTGGGTAGG + Intergenic
984189654 4:176590335-176590357 ATAAGGAAAACTCTCTGGGTGGG + Intergenic
984392321 4:179151946-179151968 CTGATAAAAGGTATCTGGGCAGG - Intergenic
984621871 4:181962517-181962539 TTAAGGAAAGGAATTTGGTTTGG + Intergenic
984661874 4:182383155-182383177 CTAAGAAAAGACATCAGGGTAGG + Intronic
984885219 4:184443806-184443828 CTAGGGAAAGCTTTCTGGGATGG - Intronic
985270879 4:188193759-188193781 CTAAGGAAAGGTTTCTCAGGAGG + Intergenic
986346611 5:6841522-6841544 CTAATGAGAGGTATTTGGATCGG - Intergenic
987760846 5:22161400-22161422 CTAAAGAAAAATATCTGGCTGGG + Intronic
988392884 5:30658681-30658703 CAAATGAAAGATACCTGGGTTGG - Intergenic
989325678 5:40191195-40191217 GTAAGGAAAGGAATCTGGTTGGG - Intergenic
989529548 5:42491788-42491810 CTAAGGCAAGATTTGTGGGTGGG + Intronic
989541739 5:42626431-42626453 ATAGGGTAAGGTATGTGGGTTGG + Intronic
991895623 5:71394853-71394875 CTAAAGAAAAATATCTGGCTGGG + Intergenic
1000120112 5:158189304-158189326 CCATGGAGATGTATCTGGGTGGG - Intergenic
1000487014 5:161859374-161859396 CTAATGCAAGGCAGCTGGGTTGG + Intronic
1000644348 5:163742771-163742793 CTAATGAAAGATAACTAGGTTGG + Intergenic
1003724776 6:8748582-8748604 CTGAGGAAAGGCATGTGGGCTGG + Intergenic
1005434437 6:25793184-25793206 CCAAGGAAAGTAATCTGGGATGG - Intronic
1006259729 6:32857779-32857801 CAAAAGAAAGTTATGTGGGTGGG + Intronic
1006557421 6:34879737-34879759 CTGAGGAAAGGAATCAGGGAGGG + Intronic
1007273760 6:40658526-40658548 CTAAGGACAGGAAGCTGGGAGGG - Intergenic
1008747466 6:54690196-54690218 TCACGGAAAGGTTTCTGGGTTGG + Intergenic
1009927269 6:70135135-70135157 ATAAGGCAAGGTATGTGGGAAGG + Intronic
1010766450 6:79781302-79781324 CTAAGGAGAGGGAGCAGGGTAGG + Intergenic
1012160101 6:95873723-95873745 CCATGGAAAGGTAGCTGTGTGGG + Intergenic
1013019386 6:106197503-106197525 CTAATGGGAGGTATTTGGGTTGG + Intronic
1013103965 6:107010820-107010842 TTAAGGAAAGGGAACTGGATAGG - Intergenic
1014767769 6:125426629-125426651 TCATGGAAAGGTATCTGGGCTGG - Intergenic
1015370233 6:132442610-132442632 AAAACGAAAGGTATCTGGATGGG - Intergenic
1021393275 7:20120686-20120708 ATAAGGAAATGGATCTTGGTGGG - Intergenic
1022922770 7:35033243-35033265 GTCAGGAAAGGTCTCTGGGGAGG - Intronic
1023659642 7:42459021-42459043 CTGAGAAAAGGTAACTGGGCAGG + Intergenic
1023727437 7:43158715-43158737 CCAGGGAGAGGTAGCTGGGTGGG - Intronic
1025922108 7:65923046-65923068 CATAGGAAAGGTAACTGAGTTGG + Intronic
1026441578 7:70449368-70449390 CTCAGGAAAGGATTGTGGGTTGG + Intronic
1030629911 7:111884553-111884575 CAAAAGAAAGGTATCTTTGTGGG + Intronic
1032288215 7:130560031-130560053 CAAAGGAAAGGCATTTGGATTGG + Intronic
1032741618 7:134745374-134745396 AAAAGGAAAAATATCTGGGTGGG + Intronic
1033382029 7:140830818-140830840 ATAGGGAAAGGTATGTGGGAAGG - Intronic
1039288205 8:36065706-36065728 CTAACGGGAAGTATCTGGGTTGG - Intergenic
1040466435 8:47699849-47699871 GTAAGAAAAGTTATCTGGGCTGG - Intronic
1043848008 8:85183324-85183346 CTAAGGAGAGATATGTGGGTAGG + Intronic
1048934673 8:139344935-139344957 GGAAGGAAAGATATCTGGGGAGG - Intergenic
1048982100 8:139708087-139708109 CCCAGTAAAGGTATCTGGGCTGG - Intergenic
1050154015 9:2646579-2646601 CTTTGGAATGGTATCTGTGTAGG + Intronic
1050983970 9:12058584-12058606 GTAAGGAAAGGGATCAGTGTTGG + Intergenic
1051434605 9:17017702-17017724 CTAAAGAAAAGTCTCTGCGTTGG + Intergenic
1051710791 9:19928372-19928394 GGAAGGAGAGGTTTCTGGGTAGG + Intergenic
1054452816 9:65412529-65412551 TGAAGGAAAGATGTCTGGGTTGG - Intergenic
1055151690 9:73008343-73008365 CTAGGGAAAAGGATCTGAGTAGG + Intronic
1056858696 9:90159327-90159349 ATGAGGAAAAGTATCTGTGTAGG + Intergenic
1057435369 9:95035402-95035424 CTAAGTAAAGGTATCTAAGGTGG + Intronic
1057503583 9:95615162-95615184 TAGAGGAAAGGTATCTTGGTTGG - Intergenic
1057851581 9:98570692-98570714 CTGAGGACAGGATTCTGGGTGGG + Intronic
1058217420 9:102252635-102252657 ATAAGGACAGGGATCTGGGAGGG + Intergenic
1060551736 9:124488808-124488830 CTTAGGAAAGGGAACTAGGTGGG - Intronic
1061417413 9:130454596-130454618 AGAAGGGAAGGTATGTGGGTGGG - Intronic
1061639711 9:131942979-131943001 GTAAGTAAAGAGATCTGGGTGGG + Intronic
1187026852 X:15444856-15444878 CTGAGGAAAAGAATCTGGCTGGG + Intronic
1187958364 X:24543265-24543287 CTAAGGAAAGATAACTGTGAAGG - Intergenic
1189564047 X:42221226-42221248 CTGAGGAAAGTTAAATGGGTTGG - Intergenic
1190559558 X:51673451-51673473 GTAAGGGAACGTTTCTGGGTTGG + Intergenic
1190564733 X:51719870-51719892 GTAAGGGAACGTTTCTGGGTTGG - Intergenic
1191081611 X:56517169-56517191 TTAAGGAAAGGTAGCAGGGAGGG + Intergenic
1195043629 X:101036467-101036489 CTCAGGAATGGAATCTGGGAAGG + Intronic
1196119734 X:112036891-112036913 CTAAGCAAGGGTTTCTGTGTAGG - Intronic
1197106535 X:122723196-122723218 CTCAGGAAAGAAGTCTGGGTTGG - Intergenic
1198048392 X:132925234-132925256 ATAAGGAAAGGTATGTGGGGAGG - Intronic
1198728278 X:139700271-139700293 CTAAGAAAAGAAATCTGGCTTGG - Intronic
1199399589 X:147382011-147382033 CTCAGGAAAGTTATCTGTCTTGG + Intergenic
1199570238 X:149260305-149260327 CTAAGGTAAGGTATAAGAGTAGG - Intergenic
1199822315 X:151461737-151461759 CTAAGCTAAGGTTTCTGGCTTGG + Intergenic
1200277491 X:154748396-154748418 CAAAGGGAAGGTAGCGGGGTAGG + Intronic
1200301550 X:154981541-154981563 ATAAGGAAGGGTATGTGGGAAGG + Intronic