ID: 934638141

View in Genome Browser
Species Human (GRCh38)
Location 2:96009725-96009747
Sequence TCTAAGGAAAGGTATCTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 2, 1: 0, 2: 3, 3: 16, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934638141_934638150 15 Left 934638141 2:96009725-96009747 CCACCCAGATACCTTTCCTTAGA 0: 2
1: 0
2: 3
3: 16
4: 154
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638141_934638149 14 Left 934638141 2:96009725-96009747 CCACCCAGATACCTTTCCTTAGA 0: 2
1: 0
2: 3
3: 16
4: 154
Right 934638149 2:96009762-96009784 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363
934638141_934638151 21 Left 934638141 2:96009725-96009747 CCACCCAGATACCTTTCCTTAGA 0: 2
1: 0
2: 3
3: 16
4: 154
Right 934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG 0: 2
1: 1
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934638141 Original CRISPR TCTAAGGAAAGGTATCTGGG TGG (reversed) Intergenic
901251073 1:7780827-7780849 TCAAAGCAAAGGTCTCTGGTTGG - Exonic
902211472 1:14907792-14907814 TCTCAGGAAAGGCAAGTGGGAGG + Intronic
903122443 1:21225183-21225205 TCTACGGACAGGCATCTGGAAGG + Intronic
903341246 1:22655853-22655875 TCTGAGGAAAGGTTTCCTGGAGG + Intronic
905078549 1:35296192-35296214 TCTCAGGAAATGTAGTTGGGTGG + Intronic
908367908 1:63445500-63445522 TCCAAAGAAAAGTATCTTGGAGG + Intronic
910548925 1:88454220-88454242 TCTAAGAAAATGAATCTGTGAGG + Intergenic
915911796 1:159920060-159920082 TCTAAGGAAAGAACTGTGGGAGG - Intronic
917819387 1:178746781-178746803 TCTACGGAAACGTATGTGAGAGG - Intronic
921064365 1:211612141-211612163 TCTAACGAAAGGGATTGGGGAGG + Intergenic
922972205 1:229752156-229752178 TCTCAGGAAAAGTATGTGTGTGG + Intergenic
923027788 1:230219662-230219684 TCTCAAGAAAGGTAAGTGGGTGG - Intronic
924018986 1:239760537-239760559 TGTAAGGAAAGGTGTGTAGGTGG - Intronic
924462408 1:244271021-244271043 TATGAGGAAATGTATCTGTGTGG - Intergenic
924788622 1:247222253-247222275 TCTATTTAAAGGTATCTAGGAGG - Intergenic
1062799740 10:370191-370213 TCTAAGGAAAACTATTTGGGTGG + Intronic
1062871148 10:905800-905822 TAGAAGGAAAGTTTTCTGGGAGG - Intronic
1069221717 10:65891882-65891904 TCTAAGAAAAGGTAGCTCAGGGG - Intergenic
1073350413 10:102815631-102815653 TGGAAGGAAAGGCATCTGAGGGG - Exonic
1077823705 11:5780329-5780351 TTTAAGTATATGTATCTGGGGGG - Intronic
1078953969 11:16168600-16168622 GCTAAGGAAAAGCACCTGGGAGG + Intronic
1079527516 11:21408284-21408306 TCCCAGGCAAGGTATCTGGTAGG - Intronic
1081232185 11:40599097-40599119 TCTAAGTAAAGATCTATGGGTGG - Intronic
1081346837 11:41997976-41997998 TCTAAGGGAAGATGTCAGGGTGG + Intergenic
1083491000 11:63015039-63015061 TCTATGGAACGATATGTGGGAGG + Intronic
1084772470 11:71352726-71352748 TCTTAGGAGAGGTGGCTGGGAGG - Intergenic
1085973465 11:81622923-81622945 TTTAAGAAATGGTATCTGGCTGG - Intergenic
1086530113 11:87774855-87774877 TGTAAGGAAAGGAAACTGTGAGG + Intergenic
1087203632 11:95371240-95371262 CCTGTGGAAATGTATCTGGGGGG + Intergenic
1089865668 11:121629082-121629104 TCTGAGGAAAAGGATCTGGGAGG - Intronic
1091001918 11:131916966-131916988 TATCAGGAAAGGCATCAGGGAGG - Intronic
1091637499 12:2208579-2208601 CCTAAGGAAGGATGTCTGGGTGG + Intronic
1093906303 12:24696117-24696139 TCTAGGGAAATGTGTGTGGGGGG + Intergenic
1094026793 12:25968150-25968172 TCTAAGAAATGGTACCTGGCTGG - Intronic
1094158861 12:27368591-27368613 TCTGAAGAAAGGTGTCTAGGAGG + Intronic
1097785635 12:63755825-63755847 TCTAGGGAAAGGTATGAAGGTGG - Intergenic
1100483782 12:95005087-95005109 TTTATGGACAGGTAACTGGGTGG - Intergenic
1103559639 12:121786642-121786664 AGTCAGGAAAGGTCTCTGGGAGG - Intronic
1106768156 13:32936603-32936625 TCTAAGGAAAAGTTTCAGGGAGG - Intergenic
1109162112 13:58988495-58988517 TCTTAGGGGAGGTATCTGGTGGG + Intergenic
1110429011 13:75401402-75401424 ACTAAGGATAGTTATGTGGGTGG - Intronic
1110897258 13:80770300-80770322 GCTCAGGAAAGGCTTCTGGGTGG - Intergenic
1112833887 13:103489818-103489840 TCTAAGCAAACGTATTTGTGAGG + Intergenic
1114571274 14:23670734-23670756 TCTATGGGAAGGTGTCTGGGAGG + Intergenic
1114972785 14:28055102-28055124 TCTAAAGAAAGGAATTTGGTTGG + Intergenic
1115320996 14:32078137-32078159 ACTAAAGAAAAGTATCGGGGTGG + Intronic
1115795934 14:36935687-36935709 TCTAAGCAAAGGAACCTAGGGGG + Intronic
1115817503 14:37178695-37178717 GCTTAGTAAAGGGATCTGGGTGG - Intergenic
1116113265 14:40613846-40613868 TCCAAGGAAAGTTATAAGGGGGG + Intergenic
1116509502 14:45726436-45726458 TCTCTGGGAAGGTCTCTGGGTGG + Intergenic
1119610964 14:76061870-76061892 TCAAAGGAAATGTATATTGGAGG - Intronic
1120023174 14:79553037-79553059 ACTTAGGAAAGGAATGTGGGGGG + Intronic
1202892319 14_KI270722v1_random:170007-170029 TTTAAGGAAAGCTATTTGGAAGG + Intergenic
1129045545 15:72730793-72730815 TCTAAGGAAAGGTATCAAGGTGG - Intronic
1137974830 16:53022483-53022505 TTCAAAGAAAGGTATCTGGGTGG + Intergenic
1138319290 16:56098263-56098285 TCCAAGGAAAGGGAGATGGGTGG + Intergenic
1140454894 16:75099300-75099322 TCAAAGCAAAGATATCTGGGAGG - Intronic
1143924717 17:10359421-10359443 TCTAGGGCAAGGTATGGGGGAGG - Intronic
1144113936 17:12067117-12067139 ACTAAGAATAGGTATGTGGGTGG - Intronic
1148336716 17:46846961-46846983 TTGCAGGAAAGGTATTTGGGAGG - Intronic
1150103885 17:62447620-62447642 GCTAAGGAATGTTAACTGGGAGG - Intronic
1151181117 17:72329400-72329422 TCCAAGCTAAGGAATCTGGGAGG + Intergenic
1157357804 18:46951630-46951652 TCTGAGAAAAGATATATGGGAGG + Intronic
1158206768 18:55001726-55001748 TCTCAGGAAAGGTATGAGGCAGG - Intergenic
1159355793 18:67336524-67336546 TTTCAGGAAGGGTATCTGGAAGG - Intergenic
1162722087 19:12668617-12668639 GCTAGGGAAAGGTAAGTGGGTGG + Exonic
1166513117 19:43424285-43424307 TTTAAGGAAAGTTATCTGCCAGG - Intergenic
927507429 2:23623507-23623529 TTTAGGAAAATGTATCTGGGAGG + Intronic
928443807 2:31315436-31315458 TCTAAGGAAAGGCTTCTGAAAGG - Intergenic
929093943 2:38246427-38246449 TCTCAGGAAAGATATCTGTTAGG - Intergenic
930717205 2:54604280-54604302 TATAAGGGAAGGTTTCTGGCAGG - Intronic
931203472 2:60123862-60123884 ACTAAGGAAAGGCATCAGGAAGG + Intergenic
934575969 2:95401868-95401890 TCTGAGGAAAGGTGTCTGGGTGG - Intergenic
934638141 2:96009725-96009747 TCTAAGGAAAGGTATCTGGGTGG - Intergenic
934795511 2:97095685-97095707 TCTAAGGAAAGGTATCTGGGTGG + Intergenic
934859685 2:97754154-97754176 TCTAAGGGTAGGTATTTGAGTGG - Intergenic
935827760 2:106968615-106968637 TCTGAGGAAAGGCATTTAGGTGG - Intergenic
937702293 2:124877667-124877689 TCAAAGGAAAGTTATTTGGGTGG + Intronic
940281016 2:151989722-151989744 TCTGAGGAGAGGTATCTGGTAGG - Intronic
942255426 2:174092372-174092394 TTTAGGGCCAGGTATCTGGGTGG + Intronic
943410972 2:187547461-187547483 TCTAATGACAAGTATCTGGGAGG + Intronic
944353943 2:198762910-198762932 TGTAAGTAAAGGTATCTGTTAGG + Intergenic
948936638 2:241169487-241169509 TCAATGGACAGGGATCTGGGAGG + Intronic
1171023407 20:21607604-21607626 TTTGAGGAGAGGTGTCTGGGAGG + Intergenic
1173919210 20:46731318-46731340 TCTATGGAAAGTCATGTGGGTGG - Intronic
1174098528 20:48108640-48108662 TATAAGGAAAGGAAACAGGGTGG - Intergenic
1175205407 20:57307480-57307502 TGTAAGAAAAGGGATCTGAGTGG + Intergenic
1180090352 21:45531042-45531064 TCTGAGGAAAGGTATCCACGGGG + Intronic
1181767852 22:25104583-25104605 TCAAAAGAAGGGTATCTGGGTGG - Intronic
1184289767 22:43492460-43492482 GCTAAGGAATGGCCTCTGGGTGG - Intronic
1184671307 22:46013539-46013561 TCCCAGGAAAGGTCGCTGGGGGG + Intergenic
1185081840 22:48713814-48713836 TCCCAGGAAAGGCATCTGTGCGG + Intronic
951600106 3:24364690-24364712 TCTAGGGAAAGGGCTCTTGGGGG + Intronic
951689373 3:25379897-25379919 CCCAAGGAAAGTTATCTGAGGGG - Intronic
951701589 3:25502477-25502499 AGTTAGGAAAGATATCTGGGTGG - Intronic
953356773 3:42263049-42263071 TCCAAGGGTTGGTATCTGGGTGG + Intronic
953818611 3:46183993-46184015 TGTAAGAAAAGGGACCTGGGAGG + Intronic
955572048 3:60318401-60318423 TGCAAAGAAAGGCATCTGGGGGG + Intronic
956899511 3:73700470-73700492 TGTCAGGCAAGGTACCTGGGGGG + Intergenic
957639051 3:82826802-82826824 TATAAAGAAAGATATCTGAGAGG + Intergenic
960990940 3:123310739-123310761 CCTAAGGCAAGGCATCTGAGGGG + Intronic
962194835 3:133352695-133352717 CCTAGGGCAAGGTATATGGGAGG + Intronic
969088292 4:4672973-4672995 TCTAAGGAAAGGACTCAGAGAGG - Intergenic
969168322 4:5337388-5337410 TTTGAGAAAAGGTATATGGGAGG - Intronic
972862754 4:43191169-43191191 TCTCAGGAAAGTCCTCTGGGAGG + Intergenic
975315465 4:72947031-72947053 TCTTAGGAAAGGTATCAGGTTGG + Intergenic
975700565 4:77062179-77062201 TATCAGGAAAAGTATCTGGCGGG - Intronic
979971351 4:127139732-127139754 TCCAAGGACAGGGGTCTGGGGGG + Intergenic
981408938 4:144405012-144405034 GCTAAGGAAATGTATGTGGAGGG + Intergenic
984189653 4:176590334-176590356 TATAAGGAAAACTCTCTGGGTGG + Intergenic
987929228 5:24382207-24382229 TCCGAGGAAAGGTATCTCAGTGG + Intergenic
988630161 5:32920801-32920823 TCTGGGGATAGGTATTTGGGGGG - Intergenic
989325679 5:40191196-40191218 CGTAAGGAAAGGAATCTGGTTGG - Intergenic
990402471 5:55452660-55452682 TTTTAGGAAAGGTTTCTTGGAGG - Intronic
991187931 5:63832307-63832329 TCTGATGAAAGGTTTCTGGAGGG + Intergenic
992479099 5:77132800-77132822 TCTAAGGAAAGGTCTATGGGAGG + Intergenic
993330468 5:86594008-86594030 TAGAAGGATAGGTTTCTGGGGGG + Intergenic
995968644 5:117940472-117940494 TTTAAGGAAACAAATCTGGGAGG - Intergenic
996164452 5:120208147-120208169 CTTAAGGAAAGGTAACTTGGAGG + Intergenic
1001146775 5:169191909-169191931 GCAAAGGGAAGGTACCTGGGAGG - Intronic
1002086311 5:176777756-176777778 GCCAGGGAATGGTATCTGGGTGG + Intergenic
1003338411 6:5196575-5196597 TCTGAGGAGAGGCATCTGGATGG - Intronic
1005065150 6:21810741-21810763 TCTAAGTAGAGCTCTCTGGGAGG - Intergenic
1006321319 6:33321275-33321297 TCCAAGGAGAGGTGTGTGGGAGG + Exonic
1006557420 6:34879736-34879758 GCTGAGGAAAGGAATCAGGGAGG + Intronic
1007167504 6:39839321-39839343 TCTAAGTAAACAGATCTGGGGGG - Intronic
1007273761 6:40658527-40658549 CCTAAGGACAGGAAGCTGGGAGG - Intergenic
1010962670 6:82164335-82164357 TCTAAGAAAGGGTATATGGTAGG + Intergenic
1011315612 6:86027512-86027534 TCAAAGGAAAGTTAATTGGGGGG - Intergenic
1012491054 6:99782788-99782810 TCTAAGGTACCGTATCTGAGGGG - Intergenic
1014218839 6:118779922-118779944 TCTAAGCTAAGGAATCTGGGTGG - Intergenic
1019919923 7:4157067-4157089 TCGAATGAAGGGTATCTGAGAGG + Intronic
1021575069 7:22099225-22099247 TCTAAGCAAAGGCATTTGTGTGG - Intergenic
1021862768 7:24923399-24923421 TCTGAGGAAGGGAATCTGGTTGG - Intronic
1027470850 7:78572587-78572609 TCCAGGGATAGGAATCTGGGGGG - Intronic
1030629910 7:111884552-111884574 TCAAAAGAAAGGTATCTTTGTGG + Intronic
1030799044 7:113826888-113826910 TCTAAGAAAAGGGAGCTCGGGGG + Intergenic
1031632550 7:124062197-124062219 CCTAAGGAAGGGTGTGTGGGAGG + Intergenic
1032270632 7:130401597-130401619 GCTATGGAAAGTTTTCTGGGAGG + Intronic
1032336759 7:131032270-131032292 TGTAAAGAAAGTTATCTGAGTGG + Intergenic
1032462965 7:132125652-132125674 TCTCAGGACAGGTGACTGGGAGG - Exonic
1034703207 7:153115202-153115224 TCTAAGGAAAGAAATCTGGTAGG - Intergenic
1035310688 7:157966117-157966139 ACTAAGAAAAGTTATCTCGGTGG + Intronic
1037982528 8:23264593-23264615 ACTAGGGAAAGGGAGCTGGGGGG - Intergenic
1039916144 8:41861741-41861763 CCCATGGACAGGTATCTGGGAGG + Intronic
1039953729 8:42191505-42191527 TCTGAGCAGAGGTATCTGGCCGG - Intronic
1048003779 8:130401647-130401669 TATAAGGAAAGTTGTCTGGGTGG - Intronic
1048347233 8:133585408-133585430 TATAAGGTAGGGTCTCTGGGAGG - Intergenic
1048791125 8:138104628-138104650 TCTAAGGGAAGATATCTGCAAGG + Intergenic
1049442622 8:142616218-142616240 TCTAATTAAAGGTAAGTGGGCGG + Intergenic
1051529163 9:18080270-18080292 TATAAGGTAAGGTATTTGGATGG + Intergenic
1051647566 9:19283889-19283911 TCTCAAGAAATGCATCTGGGCGG - Intronic
1052065199 9:24009959-24009981 TATAAAGAAAAGCATCTGGGGGG - Intergenic
1052574270 9:30271793-30271815 TCTAAGGAAAGGAATCAAGGAGG + Intergenic
1053026539 9:34734160-34734182 TCTAAGGAAAGACATCTTGAAGG + Intergenic
1053533101 9:38900944-38900966 TCTAAGCATTGGTATCTAGGGGG + Intergenic
1054205327 9:62125373-62125395 TCTAAGCATTGGTATCTAGGGGG + Intergenic
1054633034 9:67462997-67463019 TCTAAGCATTGGTATCTAGGGGG - Intergenic
1056024989 9:82484728-82484750 TGTAAGGAAAGGTATCTGCTTGG - Intergenic
1057151115 9:92796938-92796960 TCTAAGCATTGGTATCTAGGGGG - Intergenic
1057851580 9:98570691-98570713 TCTGAGGACAGGATTCTGGGTGG + Intronic
1058217419 9:102252634-102252656 AATAAGGACAGGGATCTGGGAGG + Intergenic
1060250982 9:121986600-121986622 TCTCAGGACAGATTTCTGGGTGG + Intronic
1203489522 Un_GL000224v1:90263-90285 TTTAAGGAAAGCTATTTGGAAGG + Intergenic
1203502143 Un_KI270741v1:32151-32173 TTTAAGGAAAGCTATTTGGAAGG + Intergenic
1187771614 X:22704883-22704905 TCTAAGAAAAGGCGTGTGGGTGG + Intergenic
1189886705 X:45553885-45553907 TGTAATGAAAGGCAACTGGGAGG - Intergenic
1190539707 X:51464343-51464365 TCTAAGGAAAGGGATGGAGGGGG - Intergenic
1191081610 X:56517168-56517190 GTTAAGGAAAGGTAGCAGGGAGG + Intergenic
1195504199 X:105638110-105638132 GCTAAGGAAAGGAATATGAGAGG - Intronic
1196207542 X:112957828-112957850 GCAAAGGAAAGGTGTGTGGGTGG - Intergenic
1196652252 X:118180007-118180029 GCTAGGGAAAGGTCTCTGAGCGG - Intergenic
1198108371 X:133481919-133481941 TCTAAGGAAAAGTACATGAGAGG - Intergenic
1199701511 X:150380689-150380711 TCTTATGAATGGTATATGGGAGG + Intronic
1201631235 Y:16073786-16073808 TCTAAGTCAAGGTCTCTGTGGGG - Intergenic