ID: 934638142

View in Genome Browser
Species Human (GRCh38)
Location 2:96009728-96009750
Sequence CTGTCTAAGGAAAGGTATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934638142_934638149 11 Left 934638142 2:96009728-96009750 CCCAGATACCTTTCCTTAGACAG No data
Right 934638149 2:96009762-96009784 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363
934638142_934638151 18 Left 934638142 2:96009728-96009750 CCCAGATACCTTTCCTTAGACAG No data
Right 934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG 0: 2
1: 1
2: 0
3: 4
4: 63
934638142_934638150 12 Left 934638142 2:96009728-96009750 CCCAGATACCTTTCCTTAGACAG No data
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934638142 Original CRISPR CTGTCTAAGGAAAGGTATCT GGG (reversed) Intergenic
No off target data available for this crispr