ID: 934638142 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:96009728-96009750 |
| Sequence | CTGTCTAAGGAAAGGTATCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 934638142_934638149 | 11 | Left | 934638142 | 2:96009728-96009750 | CCCAGATACCTTTCCTTAGACAG | No data | ||
| Right | 934638149 | 2:96009762-96009784 | AAAACTTCTCAAATAGAAGTCGG | 0: 3 1: 0 2: 1 3: 35 4: 363 |
||||
| 934638142_934638151 | 18 | Left | 934638142 | 2:96009728-96009750 | CCCAGATACCTTTCCTTAGACAG | No data | ||
| Right | 934638151 | 2:96009769-96009791 | CTCAAATAGAAGTCGGGCCATGG | 0: 2 1: 1 2: 0 3: 4 4: 63 |
||||
| 934638142_934638150 | 12 | Left | 934638142 | 2:96009728-96009750 | CCCAGATACCTTTCCTTAGACAG | No data | ||
| Right | 934638150 | 2:96009763-96009785 | AAACTTCTCAAATAGAAGTCGGG | 0: 3 1: 0 2: 0 3: 19 4: 288 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 934638142 | Original CRISPR | CTGTCTAAGGAAAGGTATCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||