ID: 934638143

View in Genome Browser
Species Human (GRCh38)
Location 2:96009729-96009751
Sequence CCTGTCTAAGGAAAGGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934638143_934638149 10 Left 934638143 2:96009729-96009751 CCAGATACCTTTCCTTAGACAGG No data
Right 934638149 2:96009762-96009784 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363
934638143_934638150 11 Left 934638143 2:96009729-96009751 CCAGATACCTTTCCTTAGACAGG No data
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638143_934638152 30 Left 934638143 2:96009729-96009751 CCAGATACCTTTCCTTAGACAGG No data
Right 934638152 2:96009782-96009804 CGGGCCATGGCACGCCACTGAGG 0: 2
1: 0
2: 1
3: 8
4: 159
934638143_934638151 17 Left 934638143 2:96009729-96009751 CCAGATACCTTTCCTTAGACAGG No data
Right 934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG 0: 2
1: 1
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934638143 Original CRISPR CCTGTCTAAGGAAAGGTATC TGG (reversed) Intergenic
No off target data available for this crispr