ID: 934638147

View in Genome Browser
Species Human (GRCh38)
Location 2:96009741-96009763
Sequence TTTCTCTGGCCACCTGTCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934638147_934638150 -1 Left 934638147 2:96009741-96009763 CCTTAGACAGGTGGCCAGAGAAA No data
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638147_934638151 5 Left 934638147 2:96009741-96009763 CCTTAGACAGGTGGCCAGAGAAA No data
Right 934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG 0: 2
1: 1
2: 0
3: 4
4: 63
934638147_934638154 30 Left 934638147 2:96009741-96009763 CCTTAGACAGGTGGCCAGAGAAA No data
Right 934638154 2:96009794-96009816 CGCCACTGAGGACCTTCCAGCGG 0: 2
1: 1
2: 32
3: 286
4: 582
934638147_934638149 -2 Left 934638147 2:96009741-96009763 CCTTAGACAGGTGGCCAGAGAAA No data
Right 934638149 2:96009762-96009784 AAAACTTCTCAAATAGAAGTCGG 0: 3
1: 0
2: 1
3: 35
4: 363
934638147_934638152 18 Left 934638147 2:96009741-96009763 CCTTAGACAGGTGGCCAGAGAAA No data
Right 934638152 2:96009782-96009804 CGGGCCATGGCACGCCACTGAGG 0: 2
1: 0
2: 1
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934638147 Original CRISPR TTTCTCTGGCCACCTGTCTA AGG (reversed) Intergenic
No off target data available for this crispr