ID: 934638148

View in Genome Browser
Species Human (GRCh38)
Location 2:96009755-96009777
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 3, 1: 1, 2: 1, 3: 31, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934638148_934638154 16 Left 934638148 2:96009755-96009777 CCAGAGAAAAACTTCTCAAATAG 0: 3
1: 1
2: 1
3: 31
4: 271
Right 934638154 2:96009794-96009816 CGCCACTGAGGACCTTCCAGCGG 0: 2
1: 1
2: 32
3: 286
4: 582
934638148_934638152 4 Left 934638148 2:96009755-96009777 CCAGAGAAAAACTTCTCAAATAG 0: 3
1: 1
2: 1
3: 31
4: 271
Right 934638152 2:96009782-96009804 CGGGCCATGGCACGCCACTGAGG 0: 2
1: 0
2: 1
3: 8
4: 159
934638148_934638151 -9 Left 934638148 2:96009755-96009777 CCAGAGAAAAACTTCTCAAATAG 0: 3
1: 1
2: 1
3: 31
4: 271
Right 934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG 0: 2
1: 1
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934638148 Original CRISPR CTATTTGAGAAGTTTTTCTC TGG (reversed) Intergenic
905086029 1:35377914-35377936 CAATTTGGAAAGTTCTTCTCTGG - Intronic
906949772 1:50324805-50324827 CAATTTGAGAATTGTTGCTCTGG - Intergenic
907377732 1:54057655-54057677 CTATTTGAGACATATTTCTCTGG - Intronic
908398867 1:63751470-63751492 TTATTTGAGAAGTTATTCCACGG - Intergenic
908820453 1:68080691-68080713 CTATTTTAGAAGGATTTCTTAGG - Intergenic
909577462 1:77190575-77190597 TTCTTTGAGAATTTTTACTCAGG - Intronic
909680550 1:78286872-78286894 CTATATGAGTAATTTATCTCAGG + Intergenic
910661073 1:89673402-89673424 ATCTTTGAGATGGTTTTCTCAGG + Intronic
911316657 1:96363896-96363918 AGATTTGACAAGTTTTTTTCTGG - Intergenic
911372166 1:97006763-97006785 CTACTTGAGAAGTTGTTATCAGG - Intergenic
911628192 1:100151110-100151132 TTTTTTGAGGAGTTTCTCTCTGG - Intronic
912134862 1:106648755-106648777 CAAAGTGAGAAGTTTTTCTTTGG + Intergenic
913684445 1:121218132-121218154 CTACTTGAGAAGTATTTAACAGG + Intronic
914036284 1:144005747-144005769 CTACTTGAGAAGTATTTAACAGG + Intergenic
914153172 1:145062198-145062220 CTACTTGAGAAGTATTTAACAGG - Intronic
915266022 1:154718478-154718500 CTATTTATCAAGTTTTTCTGAGG - Intronic
918205686 1:182307148-182307170 CTATTTAAGAAGTGTTTTCCAGG - Intergenic
919214331 1:194533301-194533323 CTTTTTGTGAAGCATTTCTCAGG + Intergenic
920471753 1:206236645-206236667 CTACTTGAGAAGTATTTAACAGG + Intronic
921282838 1:213584398-213584420 CTATTTGAGGGGATTTTCTCTGG - Intergenic
921929127 1:220740209-220740231 CTTTTAGTGAAGATTTTCTCTGG + Intergenic
921967573 1:221106825-221106847 CTATTAGAGAACTTACTCTCTGG + Intergenic
922208468 1:223469159-223469181 CTATTTCAGACATTTTTATCTGG + Intergenic
922277543 1:224093058-224093080 CTATTTTAGAATAATTTCTCAGG - Intergenic
923380183 1:233409901-233409923 CTATTTTGGTTGTTTTTCTCTGG + Intergenic
1065683095 10:28257386-28257408 ATATCTGAGAAGGTTTTCTTTGG - Intronic
1066020176 10:31290688-31290710 CTATTTGAGAAGGAGTTCTTTGG + Intergenic
1066279824 10:33905717-33905739 TTATTTAAGAAGTATTTGTCAGG + Intergenic
1067670380 10:48315126-48315148 CCTTTTCAGAAGTTTTTTTCTGG + Intronic
1067964313 10:50891752-50891774 TTATGTGATAACTTTTTCTCAGG - Intergenic
1068282073 10:54886285-54886307 CAATTTAAGAAGTGTTTCTCTGG - Intronic
1068326574 10:55496556-55496578 TTATTTGTAAAGTCTTTCTCTGG - Intronic
1068329701 10:55547060-55547082 CCATTAGAGGAGTTTTGCTCAGG + Intronic
1069034680 10:63634007-63634029 TTATTTGGGAAATATTTCTCAGG - Intergenic
1071534418 10:86416070-86416092 TTATTTGAGGAGTTTTTTCCTGG - Intergenic
1072636647 10:97182653-97182675 CTATATGTGAACTTTTCCTCTGG - Intronic
1074440984 10:113477205-113477227 CTACCTGGAAAGTTTTTCTCTGG + Intergenic
1075979340 10:126723410-126723432 GTATTTGAGTAGAATTTCTCCGG - Intergenic
1076550365 10:131273919-131273941 CAATTTGGGAAGCTTTTCACGGG - Intronic
1078853360 11:15184688-15184710 CTATTTAAGAAATGTTTCACTGG - Intronic
1079530693 11:21448609-21448631 CAATTTGATAAGTTTTTATGTGG + Intronic
1079791029 11:24739408-24739430 GTATTTGAAAAGTGTGTCTCTGG + Intronic
1080546794 11:33327645-33327667 ATATTTGGCAAGTTATTCTCGGG + Intronic
1082225775 11:49705271-49705293 CTAATTTAGAAGTTTTACTCTGG - Intergenic
1082655584 11:55852743-55852765 CTATTTGAGAAGTTATTCTCTGG - Intergenic
1083528400 11:63394713-63394735 CTATTTGAGATGAATTTCACAGG + Intronic
1085845791 11:80063044-80063066 CTATTTGCAAAGTTTTTGTAAGG + Intergenic
1086615661 11:88815872-88815894 TGATTTGTGACGTTTTTCTCTGG - Intronic
1086623317 11:88914460-88914482 CTAATTTAGAAGTTTTACTCTGG + Intronic
1086834864 11:91608286-91608308 CTCTTAGAAAAATTTTTCTCTGG - Intergenic
1087285153 11:96257100-96257122 CATTTTGAGAGGTTTTTCTGTGG + Intronic
1087971979 11:104495324-104495346 CTCTTTAAGAGGTTTTTCTAAGG + Intergenic
1089929354 11:122294133-122294155 GTATTTAAAAAGTTTTTCTAGGG - Intergenic
1092736374 12:11586879-11586901 CTATTTGAATATTTTCTCTCTGG + Intergenic
1094438931 12:30453425-30453447 ATATTAGAGACGTTTTGCTCTGG + Intergenic
1094676701 12:32627557-32627579 CTAAGTGTGAAGATTTTCTCTGG + Intronic
1094771437 12:33665268-33665290 CTATGATAGAAGTTTCTCTCAGG - Intergenic
1095915167 12:47471003-47471025 CCATTTAAAAATTTTTTCTCAGG - Intergenic
1097380301 12:58887332-58887354 CCATTTGAGAAATTTTTCAAAGG + Intronic
1097938682 12:65279562-65279584 CTATTTTTGAAGTTTTACACTGG + Intronic
1098456111 12:70675642-70675664 GTATTTGAGTACTTTTTTTCTGG + Intronic
1098703073 12:73653350-73653372 CTCATTGAGAACTTTTTCTAAGG + Intergenic
1098720122 12:73887094-73887116 CTTTTTTCCAAGTTTTTCTCTGG - Intergenic
1098971266 12:76859337-76859359 CTATTTGTGGTGTTTTTATCTGG + Intronic
1099037070 12:77601851-77601873 GGATTTGAGAGCTTTTTCTCAGG + Intergenic
1099745483 12:86697588-86697610 CTGTTTCAGATGTTTTTCTTTGG + Intronic
1100212895 12:92416599-92416621 CTATGTGAGAAGATTCTCTGAGG - Intergenic
1100994290 12:100285827-100285849 TTATTTGAGAGGTATTTCTGAGG + Intronic
1106320735 13:28635969-28635991 CTTTTAGAGAAGTTCTTCTAGGG + Intergenic
1107361755 13:39625788-39625810 CTATTTAAGAAGTGTTTCATGGG - Intergenic
1107466803 13:40658563-40658585 CTAGTTGTGGACTTTTTCTCTGG - Intronic
1108019911 13:46116903-46116925 CTTTTTGAGAAGATTTTGTGTGG - Intergenic
1109489002 13:63069945-63069967 GTATTTGAAATGGTTTTCTCAGG - Intergenic
1109828617 13:67756138-67756160 CTCTTTGAGTTGTTTCTCTCTGG + Intergenic
1110220461 13:73067431-73067453 CTTTTTCAGAACTTTTTCTCTGG - Intronic
1111029826 13:82581325-82581347 CTATTAGAGAAAATTTTCACTGG - Intergenic
1112002385 13:95222773-95222795 CTGTTTGAGAATTATTTCTCTGG - Intronic
1112297306 13:98199207-98199229 CTATTTAAGAACCTTTTTTCAGG + Intronic
1112992531 13:105531718-105531740 CTATTTGAAACGTCGTTCTCAGG + Intergenic
1113050661 13:106207878-106207900 GGATTTTACAAGTTTTTCTCAGG + Intergenic
1114749016 14:25182840-25182862 CTATTACAGAAGTGTTTCTGGGG + Intergenic
1114785705 14:25595833-25595855 CTTCTAGAGAAGTTGTTCTCAGG + Intergenic
1115101946 14:29712321-29712343 CTACATGATCAGTTTTTCTCTGG + Intronic
1116206377 14:41872189-41872211 CTAATTGAGAAGTTTTTGACAGG - Intronic
1117626909 14:57649851-57649873 ATATTTCAAAAGTTTTTCTGGGG + Intronic
1117636409 14:57749021-57749043 CTGTTGGATAAGTTTTTCTCTGG - Intronic
1117714706 14:58568716-58568738 AAATTTGAGAAGTATTTCACTGG - Intergenic
1118132791 14:62986314-62986336 CCCTTTGAGAGGTTTTTCTGAGG + Intronic
1118186839 14:63545307-63545329 CTATGTGAGAAATTGTTCTCTGG + Intergenic
1119566744 14:75635562-75635584 CTATTTTAAAAGGTTTTATCAGG + Intronic
1125780939 15:42266944-42266966 TTATTTGAGAGTTATTTCTCTGG + Intronic
1128624329 15:69183952-69183974 CTATTTGGGATGTTCTTCACTGG - Intronic
1129797298 15:78387800-78387822 ACATTTGAGAAGAGTTTCTCTGG - Intergenic
1130732428 15:86511152-86511174 CCATTTGACAAGTTTGTTTCAGG - Intronic
1136644698 16:31602075-31602097 ACATTTGTAAAGTTTTTCTCCGG + Intergenic
1136660473 16:31755199-31755221 ACATTTGTAAAGTTTTTCTCCGG - Intronic
1137806975 16:51316266-51316288 CTATTGGAGAACTTTGTCTTAGG + Intergenic
1138665105 16:58560349-58560371 CTATTTTAGGAGTGTTTCTCAGG - Exonic
1138823121 16:60285756-60285778 TTATTTGTGAAGATTTTCTCAGG - Intergenic
1139058142 16:63212863-63212885 CTCTTTTACAAGTTTTTCTGTGG - Intergenic
1139815959 16:69672167-69672189 CTATGTGGCAAGTTTTCCTCTGG + Intronic
1143799499 17:9366930-9366952 ATATTTGAGATGGTTCTCTCTGG - Intronic
1149411803 17:56416191-56416213 CCATTTGAGAATTTTTGCTTTGG - Intronic
1150892641 17:69171136-69171158 ATGTTTGATAAGTTTTTGTCGGG - Intronic
1150999633 17:70359817-70359839 CTATTTATGAATGTTTTCTCTGG + Intergenic
1203172700 17_GL000205v2_random:164198-164220 ATATTTGAAAAGTTATTTTCAGG - Intergenic
1153061071 18:995602-995624 CTATTTGGTAGGTTTTTCTCAGG - Intergenic
1153098426 18:1436395-1436417 CTGTATGAGAATTTTTTCACTGG - Intergenic
1156685429 18:39639635-39639657 CTATTTCATAATATTTTCTCTGG + Intergenic
1157901845 18:51525694-51525716 CATTTTAAGAAGATTTTCTCTGG - Intergenic
1158824873 18:61206759-61206781 ATATTGGAGATTTTTTTCTCAGG + Intergenic
1159551785 18:69903003-69903025 ATTTTTGAGAACTTTATCTCAGG - Intronic
1161066312 19:2240127-2240149 GTATTTGAGAACTCTTCCTCTGG + Intronic
925658183 2:6172398-6172420 CTTTTTGATAAGTTGTTCTCTGG - Intergenic
926688036 2:15713501-15713523 CCATTTGTGAATTTTTTCTTTGG + Intronic
927452272 2:23219303-23219325 CATTTTGAGAACATTTTCTCTGG - Intergenic
928269674 2:29844959-29844981 CTCTTTGAGAAGCTTATCACTGG + Intronic
928485923 2:31731332-31731354 GTGTTTGAGTAATTTTTCTCTGG - Intergenic
929056323 2:37880025-37880047 CTGTTTGAGATGCTTTTGTCCGG - Intergenic
931236279 2:60415431-60415453 CTATTTAAAAATTATTTCTCAGG + Intergenic
932991358 2:76791913-76791935 CTAGTTAAGAATTTTTTGTCTGG - Intronic
933645972 2:84812968-84812990 CTATTTGGGGAGAGTTTCTCAGG - Intronic
934575977 2:95401898-95401920 CTATTTGAGAAGTTTTTCTCTGG - Intergenic
934638148 2:96009755-96009777 CTATTTGAGAAGTTTTTCTCTGG - Intergenic
934795503 2:97095655-97095677 CTATTTGAGAAGTTTTTCTCTGG + Intergenic
935456324 2:103271295-103271317 CAATTTGAGAAATGTTTCCCAGG - Intergenic
937171106 2:119869883-119869905 CTTTTTGGTAAGTTTTCCTCTGG - Intronic
939355700 2:141099226-141099248 CTATTTTAAGAGTTTTTTTCAGG - Intronic
941300711 2:163797256-163797278 ATATTTGAACAGTTTTTCACAGG + Intergenic
942912499 2:181262616-181262638 CTATTTTATAATTTTTTCTATGG - Intergenic
942951890 2:181730612-181730634 CTATTTGAAAAGTTTTTTCCAGG - Intergenic
943810873 2:192187856-192187878 TTATGTGAGAAGTTTTTCATGGG + Intronic
945612752 2:212025693-212025715 CAGTTTGAGTATTTTTTCTCAGG - Intronic
946194284 2:218023862-218023884 CTGTTTCAGAAGCTTCTCTCTGG - Intergenic
946775549 2:223136444-223136466 CTAGTTGAGAAGAATTTCTTTGG - Intronic
947043028 2:225945859-225945881 ATATTTGAGAAACTTTTCTAAGG + Intergenic
948964323 2:241364842-241364864 TTACTAGAGAAGTTTCTCTCAGG - Intronic
1170432674 20:16290842-16290864 GCATTTGAGAAGTTTTGATCTGG - Intronic
1170655144 20:18279645-18279667 CTATTTTTGAAGTTCTTTTCAGG - Intergenic
1173945528 20:46947258-46947280 ATATTTTAGATGTTATTCTCTGG + Intronic
1174930394 20:54807353-54807375 CTTTTTTAAAAGTTTTTCTCTGG - Intergenic
1175039222 20:56030325-56030347 CCATTTGTGAAGTTTTTATTTGG - Intergenic
1175727231 20:61327282-61327304 ATATTTAAAAAGTTTTGCTCAGG - Intronic
1176328694 21:5525980-5526002 ATATTTGAAAAGTTATTTTCAGG - Intergenic
1176399063 21:6294971-6294993 ATATTTGAAAAGTTATTTTCAGG + Intergenic
1176438094 21:6694133-6694155 ATATTTGAAAAGTTATTTTCAGG - Intergenic
1176462356 21:7021203-7021225 ATATTTGAAAAGTTATTTTCAGG - Intergenic
1176485917 21:7402981-7403003 ATATTTGAAAAGTTATTTTCAGG - Intergenic
1177350420 21:19932206-19932228 CTATTGGACAAGCTATTCTCAGG + Intergenic
1177382133 21:20358419-20358441 CTATTTCAGAAATTTTACTATGG - Intergenic
1177735732 21:25086405-25086427 CTATTTGCAAAGTATTTATCAGG + Intergenic
1182193632 22:28491010-28491032 TTATTTGAGAAGTTTTTTGGGGG + Intronic
1185146605 22:49140520-49140542 ATATTTCAGAATTTTCTCTCAGG + Intergenic
949667126 3:6352592-6352614 GGATGTGGGAAGTTTTTCTCTGG + Intergenic
950070738 3:10150176-10150198 CCATTAGAGAAGTATTTATCAGG + Exonic
951642293 3:24849624-24849646 GTATTTGAGAAGCTTCTCTCAGG - Intergenic
951773780 3:26286235-26286257 ATATAGGAGAAGTTTTTCTTTGG + Intergenic
952851134 3:37730451-37730473 GCATTTGAGAAATTATTCTCTGG + Intronic
957424352 3:80018740-80018762 CTATTTCTCAAGTTTTTTTCTGG + Intergenic
957501379 3:81062130-81062152 CCATTTAAGAAACTTTTCTCTGG + Intergenic
957607814 3:82426382-82426404 CTCTTTAAGAAATTTTTGTCTGG + Intergenic
958854912 3:99373282-99373304 CCAGTTGAGAAGATTTTCTCAGG + Intergenic
959528108 3:107399965-107399987 GTATTTTAGAATATTTTCTCTGG - Intergenic
959691164 3:109199852-109199874 CTATCTTAAAAGTTGTTCTCCGG + Intergenic
959820369 3:110728425-110728447 CTATTTTAGAAGGTTCTATCAGG + Intergenic
960269035 3:115654332-115654354 TTATCTGAAAAGTTCTTCTCTGG + Intronic
960883293 3:122367788-122367810 ATATTAGAGATGTTTTTCTCAGG + Intronic
960980820 3:123223947-123223969 CTCATTGAGAAGTTATCCTCTGG - Intronic
963003285 3:140703407-140703429 CTCTTTGAGAAGACTTTCACTGG - Intergenic
963533819 3:146503222-146503244 CTATATGAGGAGTTTCTCTGTGG + Intergenic
963900033 3:150725201-150725223 GTATCTGAGGAGGTTTTCTCAGG + Intergenic
963941937 3:151104384-151104406 CTGTTTGAGAAGTTTTTTAAAGG - Intronic
965511713 3:169575134-169575156 CTATTCGAGAGGTTTTTGTGAGG - Intronic
965676193 3:171199428-171199450 CTCTTTGAGAACTTTCTTTCAGG - Intronic
966401933 3:179556587-179556609 CTATTTGAAAAGACTATCTCTGG + Intergenic
966684679 3:182681111-182681133 CTATTTATCAAGTTTTTCCCTGG - Intergenic
967652519 3:192004224-192004246 ATATTTGAAAAGTTTTGGTCCGG + Intergenic
967753076 3:193136870-193136892 CTATTCGAAGACTTTTTCTCTGG + Intergenic
970001059 4:11366629-11366651 CTATTTCACAAGTTTTTGCCAGG + Intergenic
970345104 4:15145658-15145680 CTATCTGGGATGTTTTTCTCTGG - Intergenic
970956105 4:21813478-21813500 GTTTCTGAAAAGTTTTTCTCTGG - Intronic
971572825 4:28235271-28235293 CTATTTTATAACTGTTTCTCAGG - Intergenic
972194743 4:36640087-36640109 TTCTTTGAGAAGATTTTCACAGG - Intergenic
972806613 4:42534663-42534685 CTTTTTGTGATGTATTTCTCAGG - Intronic
974241461 4:59254133-59254155 TTATTTAAGAAGCTTTTCTGAGG - Intergenic
974279258 4:59770332-59770354 CTACATGAGAAATTTTTTTCTGG + Intergenic
974360133 4:60866691-60866713 CTATTTGAAATGTTATTCTCTGG - Intergenic
975188689 4:71434280-71434302 CTACTTTTGAAATTTTTCTCAGG + Intronic
975266047 4:72369252-72369274 CTAGTTGAAAAGTTGTTCTTGGG - Intronic
975571972 4:75827007-75827029 CTAAATGAGAAATTTTTCTATGG + Intergenic
978055966 4:104267204-104267226 ATATTGGGGAAGTTTCTCTCAGG - Intergenic
978100435 4:104833353-104833375 GTATTTAAGAAATATTTCTCAGG + Intergenic
978327508 4:107576024-107576046 CAATGTGAGAAGCATTTCTCTGG + Intergenic
983110668 4:163745558-163745580 CTATTTGAGAACTGCTTCTCAGG - Intronic
983231066 4:165129289-165129311 ATATTTGAGCAGGTTTGCTCTGG + Intronic
985426382 4:189835279-189835301 CAATTTCAGATGTTTTTCACTGG - Intergenic
987255250 5:16143729-16143751 ATATTTGAGAAATTTTTGTCTGG + Intronic
987614069 5:20249787-20249809 CTTTCTGAGAATTTTTTGTCTGG + Intronic
988306176 5:29497501-29497523 CTTTTTGTGAAGTATTTTTCAGG + Intergenic
988973802 5:36495390-36495412 GAAGTTGAGAAGTTTGTCTCAGG + Intergenic
989262042 5:39429382-39429404 CAATTTGAGAACTATTGCTCTGG - Intronic
989324319 5:40173224-40173246 TTATTTGATAAGTTTTTATTGGG + Intergenic
990600108 5:57349750-57349772 CAATTTGAGAAGTCTTAATCGGG + Intergenic
990928105 5:61052722-61052744 TAATTTGATAAGTTTTTTTCTGG + Intronic
992438627 5:76779065-76779087 CATTTAGAGTAGTTTTTCTCTGG - Intergenic
993599988 5:89910172-89910194 CTGTCAGGGAAGTTTTTCTCTGG - Intergenic
993889845 5:93460453-93460475 CTCATTGACAAGTTTTTATCTGG - Intergenic
994335733 5:98563602-98563624 CTATTTGCAAAGTCTTTTTCAGG + Intergenic
995195276 5:109359746-109359768 CTGTTAGAGAAATTTTTTTCTGG - Intronic
996152697 5:120059141-120059163 GAATTTGAGAAGTTTTTGTGGGG + Intergenic
996543039 5:124649329-124649351 CTACTTGAGCTGTTTTTCTTTGG - Intronic
998025727 5:138814465-138814487 CTATTAAACAAGTTCTTCTCAGG - Intronic
998943159 5:147307318-147307340 CTCTTTAAGAAATTTTTGTCTGG + Intronic
998980819 5:147700097-147700119 CTACTTGAGAACTTTATCTGGGG - Intronic
998984660 5:147743016-147743038 CTATTTGGAAAGTTTCTCACAGG - Intronic
999946307 5:156599546-156599568 CAATTTTAAAAATTTTTCTCTGG + Intronic
1000104767 5:158048962-158048984 CACTTTGAGAAGGTTTTCTCAGG + Intergenic
1000915718 5:167078843-167078865 GTGTTGGAGAAGCTTTTCTCAGG - Intergenic
1000959478 5:167583027-167583049 ATGTTTGCCAAGTTTTTCTCTGG + Intronic
1002046919 5:176546876-176546898 CTTTTTGAGAAGTGTTTCTGAGG - Intronic
1003383319 6:5644863-5644885 TTATTAGAGCAGTTGTTCTCTGG + Intronic
1004826350 6:19425524-19425546 CTATCTGAGGAGTATTTCTTAGG + Intergenic
1005054939 6:21720585-21720607 CTATTTGAGAGTTTTTCCTTGGG - Intergenic
1005960223 6:30688513-30688535 CTACTTGAGACTTTATTCTCTGG - Exonic
1006135773 6:31895904-31895926 CTATTTGTAAAGTTTTTCCTGGG - Intronic
1006249587 6:32770519-32770541 CTGTTGGAGAAGTTTTCCTGTGG - Intergenic
1006713996 6:36102228-36102250 CTGTTTGAGAAGGCTGTCTCAGG + Intronic
1007939563 6:45766917-45766939 CTATATGTGGTGTTTTTCTCTGG - Intergenic
1008309104 6:49942964-49942986 CTATTTAATGAGTTTTTTTCTGG + Intergenic
1008494061 6:52115130-52115152 TTTTTTGAGAAGTTTTACTACGG + Intergenic
1008699811 6:54085412-54085434 CTATTTCAAAAGTTTTTGTGAGG + Intronic
1008992045 6:57614442-57614464 CTATTGGAAAATTATTTCTCAGG + Intronic
1009180660 6:60513487-60513509 CTATTGGAAAATTATTTCTCAGG + Intergenic
1009473674 6:64060947-64060969 CTATTGGAGATGTGTTGCTCTGG + Intronic
1009529217 6:64788477-64788499 AATTTTGAAAAGTTTTTCTCTGG - Intronic
1011058157 6:83229725-83229747 CTATTTGTTAAGTTTTTGCCCGG - Intronic
1011071644 6:83392055-83392077 CTATATTAGATGGTTTTCTCAGG - Intronic
1012922875 6:105236933-105236955 CTTTTTGAGAAGAATTTCCCAGG - Intergenic
1013791151 6:113838349-113838371 CTATTTAAGAAATTTTGCTTAGG + Intergenic
1014970853 6:127813384-127813406 CTTTTTGAGGATTTTTTCACAGG + Exonic
1015838496 6:137449507-137449529 CTATTTGAAGAGTTTTTCTTTGG + Intergenic
1016132588 6:140494583-140494605 TTATTTGAGCGCTTTTTCTCTGG + Intergenic
1016363188 6:143289747-143289769 ATGTTTGAGAATTTTTTCTCTGG - Intronic
1016559179 6:145375614-145375636 CAGTTTGAGAAGTTTAACTCAGG - Intergenic
1019675278 7:2307867-2307889 CTTTTTGTGATGCTTTTCTCAGG + Intronic
1020947862 7:14638080-14638102 AGAATTGAGATGTTTTTCTCTGG - Intronic
1021435891 7:20615037-20615059 CTATTTGAGAGGTATTTTTAAGG - Intergenic
1022268146 7:28779199-28779221 TTATTTGAGAAGTTCTTTCCTGG + Intronic
1024832465 7:53477409-53477431 CTATCTGAAAAGATTTTCTTTGG + Intergenic
1026090566 7:67296882-67296904 CTTTCTGAGAGGTTTTTCTAAGG + Intergenic
1026219721 7:68383375-68383397 ATATATGAGCAGTTGTTCTCAGG - Intergenic
1027120162 7:75512254-75512276 CTTTCTGAGAGGTTTTTCTAAGG + Intergenic
1027563719 7:79764862-79764884 ATATTTGATAAGTTTTTTCCAGG - Intergenic
1027804095 7:82793710-82793732 ATATTTGATAAGATTTTCTCAGG + Intronic
1030827613 7:114179886-114179908 AGATTTGAGAATTTTTTTTCTGG + Intronic
1031057744 7:117011743-117011765 CTAAGTCAGAAGTTCTTCTCGGG - Intronic
1032452461 7:132045039-132045061 CTATTTCCCAAGTTTTTGTCTGG + Intergenic
1032973793 7:137197540-137197562 CTATTTGAATAGTTATTCCCGGG + Intergenic
1033169607 7:139071950-139071972 CTATAGGAGGTGTTTTTCTCAGG + Intronic
1033724327 7:144096528-144096550 CTGTTTCATAAGTTTATCTCAGG - Intergenic
1036484143 8:9164429-9164451 TGATTTGAGAAGTTTGTCTAGGG + Intronic
1036660646 8:10706261-10706283 AAATTTCAGAAGTGTTTCTCAGG + Intronic
1036993999 8:13633072-13633094 ATATTTGTGAACATTTTCTCTGG + Intergenic
1038331410 8:26612338-26612360 CTATTTTAAACGGTTTTCTCTGG - Intronic
1038962726 8:32539267-32539289 CTATTTTAGAAGATTAACTCTGG + Intronic
1039138882 8:34360129-34360151 CTTCTTGTGAAGTATTTCTCAGG + Intergenic
1039326855 8:36495103-36495125 ATAATTGAAATGTTTTTCTCTGG - Intergenic
1039785117 8:40827833-40827855 CTAGTTGTTAAGTTTTTCTTAGG + Intronic
1040883140 8:52230343-52230365 ATATTTGAGAACCTTTTCTAGGG + Intronic
1041225010 8:55689479-55689501 CTCTTGGAGAAGTTTGTCCCAGG - Intergenic
1042012651 8:64265159-64265181 ATATTTTAGAAGTCTTTTTCTGG - Intergenic
1042728900 8:71909687-71909709 CTTTATGATAAGTATTTCTCTGG + Intronic
1044393976 8:91687640-91687662 CTATTTGAGGTGTTTTTTTGTGG - Intergenic
1044506716 8:93028875-93028897 CTTTTTGAAAAATTGTTCTCAGG + Intergenic
1045939579 8:107724014-107724036 CCATTGCAGGAGTTTTTCTCTGG + Intergenic
1046317630 8:112527897-112527919 CTATTTGTGAAGTTCTGCTAAGG + Intronic
1048104867 8:131396983-131397005 CAATTTTAGGAGGTTTTCTCTGG + Intergenic
1048501651 8:134981535-134981557 CTAGATTGGAAGTTTTTCTCTGG - Intergenic
1050563952 9:6863254-6863276 GTTTTTGAGATGTTTTTCTTTGG + Intronic
1052363529 9:27586156-27586178 CTCTGTGAGAAGTTTTTATCTGG - Intergenic
1052715150 9:32106949-32106971 CTCTTTGAGAACATTTTCTGAGG + Intergenic
1054883486 9:70170658-70170680 CTATTTTAGAAGCTTTCCTTAGG - Intronic
1055631625 9:78230609-78230631 CTCTGTGAGAAGGTATTCTCTGG - Intergenic
1056123330 9:83511113-83511135 CTCTTTGAGAAGTTTTTCCCTGG + Intronic
1056318602 9:85415666-85415688 CTAATTGGGAACTCTTTCTCTGG + Intergenic
1058335674 9:103825408-103825430 CTTTTTGAGAAGTGTATCTTAGG + Intergenic
1059463674 9:114451683-114451705 CTCTTTGTGAAGTGGTTCTCAGG - Intronic
1186155965 X:6727064-6727086 ATATTTGAAAATTTTTTCTTGGG + Intergenic
1186730513 X:12404562-12404584 CTTTTGGGAAAGTTTTTCTCAGG + Intronic
1187096753 X:16156785-16156807 GTATTTGAGAAGTGTGTGTCTGG - Intergenic
1188945887 X:36301336-36301358 TTATTTGACAAGTTTTCCACAGG - Intronic
1190250060 X:48716509-48716531 CTCTTTGAGAGGGTTCTCTCAGG - Intergenic
1190736691 X:53260156-53260178 CTGTTTGAGAAGTGGTGCTCAGG + Intronic
1193270365 X:79522238-79522260 CTATTTGAGGAGTTTTTTTTTGG - Intergenic
1195230000 X:102837120-102837142 CTCTTTTAGAAGTTTATCTTCGG - Intergenic
1196075089 X:111567581-111567603 AAATTTTAGAAGTTTTTCTGTGG - Intergenic
1197012710 X:121586755-121586777 CTCTTTGAAAAGATTTACTCTGG + Intergenic
1197227232 X:123966164-123966186 CTATTTTAAAAGTTTTTGGCTGG + Intronic
1197316767 X:124976045-124976067 CTATACCAGAAGTTTTCCTCTGG - Intergenic
1197788819 X:130229178-130229200 TTATTTGTGAGGTTTTTCTTTGG - Intronic
1197861422 X:130974988-130975010 CTATTTGGGAACTTTGTCTAGGG - Intergenic
1199270763 X:145880209-145880231 CTATTTTATATTTTTTTCTCTGG - Intergenic
1199568225 X:149240245-149240267 ATAGTTGAGAAGTGCTTCTCTGG + Intergenic
1199682208 X:150234123-150234145 TTATTTGAGATGTATGTCTCTGG + Intergenic
1199797998 X:151220701-151220723 CTATTTCTGATTTTTTTCTCGGG + Intergenic
1201549341 Y:15203327-15203349 ATATTTGAAAATTTTTTCTTAGG + Intergenic
1201926215 Y:19290767-19290789 CTTTTTTAGGAGTTATTCTCTGG + Intergenic