ID: 934638150

View in Genome Browser
Species Human (GRCh38)
Location 2:96009763-96009785
Sequence AAACTTCTCAAATAGAAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 3, 1: 0, 2: 0, 3: 19, 4: 288}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934638147_934638150 -1 Left 934638147 2:96009741-96009763 CCTTAGACAGGTGGCCAGAGAAA No data
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638141_934638150 15 Left 934638141 2:96009725-96009747 CCACCCAGATACCTTTCCTTAGA 0: 2
1: 0
2: 3
3: 16
4: 154
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638138_934638150 24 Left 934638138 2:96009716-96009738 CCGCACCACCCACCCAGATACCT 0: 2
1: 1
2: 8
3: 55
4: 554
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638139_934638150 19 Left 934638139 2:96009721-96009743 CCACCCACCCAGATACCTTTCCT 0: 2
1: 1
2: 1
3: 42
4: 486
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638142_934638150 12 Left 934638142 2:96009728-96009750 CCCAGATACCTTTCCTTAGACAG No data
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638137_934638150 25 Left 934638137 2:96009715-96009737 CCCGCACCACCCACCCAGATACC 0: 2
1: 0
2: 1
3: 31
4: 376
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638146_934638150 4 Left 934638146 2:96009736-96009758 CCTTTCCTTAGACAGGTGGCCAG No data
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638140_934638150 16 Left 934638140 2:96009724-96009746 CCCACCCAGATACCTTTCCTTAG 0: 2
1: 0
2: 3
3: 16
4: 206
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288
934638143_934638150 11 Left 934638143 2:96009729-96009751 CCAGATACCTTTCCTTAGACAGG No data
Right 934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG 0: 3
1: 0
2: 0
3: 19
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934638150 Original CRISPR AAACTTCTCAAATAGAAGTC GGG Intergenic
904659608 1:32074638-32074660 AAACTTCAGAAATGGCAGTCCGG + Intronic
908938632 1:69405821-69405843 AAAATTCTGAAATATAATTCTGG + Intergenic
910147969 1:84105092-84105114 AAATTTCTTAAATACAATTCAGG + Intronic
912219254 1:107653358-107653380 AAACTTCTGAAATAGAACAAGGG + Intronic
914623740 1:149438097-149438119 AACCTTCTGAAATGGAAGTGTGG + Intergenic
915586057 1:156844580-156844602 AAACTTCGCATATCGAAGACGGG + Exonic
916987741 1:170209290-170209312 ACACTTTACAAAAAGAAGTCTGG + Intergenic
917048102 1:170885971-170885993 ATACCTCCCAGATAGAAGTCAGG - Intergenic
917655301 1:177119941-177119963 AAGCTTCCCATATAGAAGCCAGG + Intronic
917821440 1:178768041-178768063 AAACATCTTAAAAAGAAATCAGG - Intronic
918256038 1:182748307-182748329 AAAGTTATCACATAGAAGTTGGG - Intergenic
919375539 1:196789478-196789500 AAACTTGTGAAATAAAAGACAGG + Intronic
919385223 1:196914006-196914028 AAACTTGTAAAATAAAAGACAGG + Intronic
920602239 1:207339403-207339425 AAACTTACCAGATAGAAGACGGG - Exonic
1064938846 10:20710635-20710657 AAACTTATCATGTGGAAGTCAGG - Intergenic
1064957853 10:20931348-20931370 AAACTGCTAACATAGAAGACTGG + Intronic
1065836117 10:29660014-29660036 AAACTACTCAAAAAGAAAACAGG + Intronic
1066518068 10:36185862-36185884 AAACCTGTCAAGTTGAAGTCTGG + Intergenic
1066811933 10:39350395-39350417 AAACTGCTCAAATAAAAGAAAGG + Intergenic
1066825034 10:39559675-39559697 AAACTGCTCAATTAAAAGACAGG - Intergenic
1069375465 10:67788541-67788563 AAACTGTTCAAGTTGAAGTCTGG + Intergenic
1071213071 10:83366741-83366763 AAGCTGCTCTAATAGAAGTCTGG - Intergenic
1074813715 10:117129199-117129221 GTACTTCTCAAATATTAGTCTGG + Intronic
1075412714 10:122240767-122240789 AAACTTCTCAAAAAGAATCAGGG - Intronic
1077109262 11:854878-854900 AAACTCCTCAAAGAGAGGCCTGG - Intronic
1078611608 11:12824550-12824572 CAAGTTTTCAAAAAGAAGTCCGG + Intronic
1079287716 11:19153989-19154011 AATCTTCTAAAATGTAAGTCGGG + Intronic
1079603227 11:22336837-22336859 AAACTTCTTAAGTACAATTCAGG - Intergenic
1080498028 11:32840506-32840528 AAACTGCTGAAATCAAAGTCTGG - Intronic
1080808752 11:35681700-35681722 TCACTTCTCAATTAGAACTCAGG + Intronic
1082305653 11:50570828-50570850 AAACTTCTGAAAAAGAAGAATGG + Intergenic
1082571509 11:54745941-54745963 AAACTGCTCAATTAGAAGAAAGG + Intergenic
1084279558 11:68078883-68078905 AAACTTCTGAAATTCAATTCAGG + Intronic
1084974710 11:72790411-72790433 AAGCTTCCCTAATGGAAGTCTGG - Intronic
1086837706 11:91645791-91645813 AAAGGTATCAAATAGCAGTCAGG + Intergenic
1087491104 11:98828251-98828273 AAAATCTGCAAATAGAAGTCAGG - Intergenic
1088522708 11:110716422-110716444 AAATATTTCAAATAGAATTCTGG + Intergenic
1090876573 11:130794187-130794209 AAACTTCTCAAAAATTAATCTGG - Intergenic
1091130587 11:133143739-133143761 TAACCTCTCAACTAGAAGCCAGG + Intronic
1094876488 12:34650555-34650577 AAACTGCTCAATAAGAAGACTGG - Intergenic
1095974315 12:47928916-47928938 AAACCTCTGCAATAGAAGTCTGG + Intronic
1096775158 12:53959310-53959332 GAACTTGACAAATAGAAGCCAGG + Intergenic
1097161652 12:57050360-57050382 ATATTTCCCAAAGAGAAGTCAGG + Intronic
1102352280 12:112202684-112202706 AAGCTTCTCAAATACAAGGATGG + Intronic
1102913229 12:116734872-116734894 AAAATTCTCAGATAAAACTCTGG - Intronic
1103607987 12:122101873-122101895 AAACTTCTTGAAGAGAAGGCCGG - Intronic
1103790239 12:123465170-123465192 AAGGTTCTGAAAGAGAAGTCTGG + Intronic
1105998963 13:25701276-25701298 AAACTGCTCAAATAGAACCCAGG - Intronic
1106173099 13:27305972-27305994 ATACTTCACAAATAGAACTAAGG - Intergenic
1107094442 13:36519501-36519523 TACCTTCTCAAATAGAATTCTGG - Intergenic
1107361757 13:39625796-39625818 ACACTTCTTAAATAGAAATGAGG + Intergenic
1108870947 13:54985469-54985491 ACATTTCTCAAATATAATTCGGG + Intergenic
1109504172 13:63277696-63277718 AAAATTCTCAACTAGAAAACTGG + Intergenic
1109650732 13:65322134-65322156 AAACTACTGAAAAAGAATTCAGG - Intergenic
1110941622 13:81358067-81358089 AATGTTCTCAAATAGAGATCAGG + Intergenic
1111140165 13:84106826-84106848 ATACTTCACAAATAAATGTCTGG - Intergenic
1112544698 13:100354855-100354877 AAACTTCTTAGAAAGAACTCAGG + Intronic
1113283464 13:108817172-108817194 AACATTCTAAAATAGAATTCTGG - Intronic
1113998595 14:16120389-16120411 AAACTGCTCAAACAAAAGTAAGG - Intergenic
1114381458 14:22209250-22209272 AAAATTCTCACATAAAAGTAGGG + Intergenic
1114999131 14:28400732-28400754 AAACTACTGTAATGGAAGTCAGG - Intergenic
1115406015 14:33017498-33017520 AAATTAATCGAATAGAAGTCTGG + Intronic
1117217289 14:53564686-53564708 AAACTTCTTACATAGCAGTTGGG + Intergenic
1118546816 14:66899652-66899674 AATATTAGCAAATAGAAGTCAGG - Intronic
1118793879 14:69121954-69121976 AAACTTTTCACATTGCAGTCTGG - Intronic
1121172546 14:91867227-91867249 GAACTTCTCAAAAAGAAAACTGG - Intronic
1124089087 15:26580702-26580724 ACACTTCGCAAATAGAACTCTGG - Intronic
1125701824 15:41693133-41693155 AAAATCCTCCAATAGAAGCCGGG - Intronic
1126606518 15:50482863-50482885 ATACTTCTCAAACACAATTCAGG + Intronic
1126965470 15:54048150-54048172 AAACTTCTTAAATATAAGCATGG + Intronic
1127022305 15:54761468-54761490 AAATTTATCTAATAGAATTCTGG - Intergenic
1129769152 15:78192662-78192684 AAACTTCTCCACTAGAAATGAGG + Intronic
1131575100 15:93581286-93581308 AAACTTCTAAAACAGAAATAAGG - Intergenic
1131801188 15:96070984-96071006 AAACTTCTCAGCTGGAATTCTGG - Intergenic
1137996838 16:53225188-53225210 AGACTTGCCAAATAGAAGACAGG + Intronic
1139098890 16:63741689-63741711 AAACTTCTAGAATAAAAGACAGG + Intergenic
1140903464 16:79391533-79391555 AGACTTCTCAAATAGGAGGTTGG + Intergenic
1141210456 16:81974509-81974531 AAACATCTTAAAAAGAAATCAGG + Intergenic
1142595508 17:1027831-1027853 AGCCTTCTGCAATAGAAGTCTGG - Intronic
1144462228 17:15467448-15467470 AAACTTCTCAGGTAACAGTCTGG - Exonic
1144647226 17:16983407-16983429 AAATTGCTCAAACAGAAATCTGG + Intergenic
1144659580 17:17059556-17059578 AGACTTCAGAAATGGAAGTCAGG - Intronic
1145188334 17:20815757-20815779 TAACCTATCAATTAGAAGTCAGG + Intergenic
1145720984 17:27072562-27072584 AAAATTCTCACTTAGAAGTGAGG + Intergenic
1146191074 17:30766797-30766819 AAACTTTTCTCATAGGAGTCTGG + Intergenic
1146212337 17:30952320-30952342 AAAGTTCTGAAGCAGAAGTCGGG - Intronic
1147802862 17:43106498-43106520 AAACTTCTCAACCAGAAGAAAGG - Exonic
1150078571 17:62215914-62215936 TAACCTATCAATTAGAAGTCAGG - Intergenic
1154534530 18:15387056-15387078 AAACTTCTCAATCAAAAGTAAGG - Intergenic
1155277635 18:24204112-24204134 AAGCTTCTCCAAAAGCAGTCTGG - Intronic
1156070676 18:33203640-33203662 AATCTTTTCAAACATAAGTCAGG + Intronic
1156817011 18:41323780-41323802 AAATTTCACAAAGAGAAGTAAGG - Intergenic
1156847026 18:41677766-41677788 AAACTCCTCTAAAAGAAGTGAGG - Intergenic
1157848271 18:51024279-51024301 ATCCTTTTAAAATAGAAGTCAGG - Intronic
1159097420 18:63919990-63920012 ATACTCCTTAAATAGAAGTGTGG + Intronic
1159138840 18:64368776-64368798 AAACTACTGTAATGGAAGTCAGG - Intergenic
1159518290 18:69486655-69486677 AAACTTTACACAGAGAAGTCTGG + Intronic
1161132677 19:2600769-2600791 AAACTGCTAAGATAGAAGCCAGG - Intronic
1164333812 19:24287636-24287658 AAACTTCTCAAATAAAAGAAAGG - Intergenic
1164333886 19:24289003-24289025 AAACTTCTCAAGGAGAAGAAAGG - Intergenic
1164334158 19:24293799-24293821 AAACTACTCAATTAGAAGAAAGG - Intergenic
1164345718 19:27254177-27254199 AAACTGCTCTAATAAAAGGCAGG - Intergenic
1164359839 19:27493222-27493244 AAACTTCTCAATGAAAAGTATGG - Intergenic
1164362940 19:27537856-27537878 AAACTTCTCAATGAGAAGAAAGG - Intergenic
1164364770 19:27565381-27565403 AAACTACTCAATTAAAAGACAGG - Intergenic
1164368494 19:27616740-27616762 AAACGGCTCAAACAGAAGACAGG - Intergenic
1165186532 19:34027223-34027245 TAATTTCTCAGATAGGAGTCAGG - Intergenic
925239074 2:2306412-2306434 AAGGTTTTCAAATAGGAGTCTGG + Intronic
925500140 2:4494066-4494088 AAAATTTTAAAATAGAAGTAGGG + Intergenic
925783743 2:7407984-7408006 AAACTTCTCCAGTACAAGGCAGG + Intergenic
927680278 2:25134501-25134523 AAACTTCTCAGACTGAAGTTGGG + Intronic
932973026 2:76568884-76568906 AAACTTCTAAAATAGAAGAACGG + Intergenic
934125358 2:88883231-88883253 AAACTGCACAAATAGCAGTAGGG + Intergenic
934575979 2:95401906-95401928 AAACTTCTCAAATAGAAGTCGGG + Intergenic
934638150 2:96009763-96009785 AAACTTCTCAAATAGAAGTCGGG + Intergenic
934795501 2:97095647-97095669 AAACTTCTCAAATAGAAGTCGGG - Intergenic
935282787 2:101533678-101533700 AAACTTCTAGTAAAGAAGTCAGG + Intergenic
935484939 2:103641647-103641669 AAAGGTCTCAAATAAAAGTCAGG + Intergenic
936256743 2:110922269-110922291 AAATTTCACAAATAGAAAACAGG + Intronic
937732709 2:125253993-125254015 AATCCTTTAAAATAGAAGTCAGG + Intergenic
938184492 2:129217345-129217367 ATACTTCTCACATACAAGTAGGG - Intergenic
939076890 2:137613727-137613749 AGACTCCTCAAATACAATTCTGG - Intronic
943007741 2:182407115-182407137 AAACGTCTTAAATATAAGTTTGG + Intronic
943174241 2:184448981-184449003 AAACTACTTAAAAAGAAGTTAGG - Intergenic
943385134 2:187194345-187194367 AAAAGTCCCAAATAGAAGTAAGG - Intergenic
943694574 2:190911341-190911363 AAGCTTTTAAAATAGAAGGCTGG + Intronic
945567472 2:211419225-211419247 AAACTTGCCACAGAGAAGTCAGG - Intronic
947068924 2:226264126-226264148 AAAATTCTCAAAGAGAATTGAGG + Intergenic
947176402 2:227371782-227371804 ATAATTCTCAAATATAAGTTTGG - Intronic
947509364 2:230736672-230736694 ATACTTCTCAAATCGTGGTCAGG + Intronic
1170393063 20:15895814-15895836 AAAGTTCTCAACTAGAATCCAGG - Intronic
1170544845 20:17427062-17427084 TCACTTCTCAAATAGGAGGCAGG - Intronic
1171744702 20:28957758-28957780 AAACTGCTCAAATAAAAGAAAGG - Intergenic
1171821056 20:29839989-29840011 AAACTTCTCAATGAGAAGATAGG - Intergenic
1174397300 20:50255125-50255147 AAACTTCACAAATACTACTCAGG - Intergenic
1174652291 20:52137229-52137251 AAACTTCTCAGATAGAGAGCAGG - Intronic
1174769742 20:53287926-53287948 AATCTTCTCCAATAAATGTCAGG - Intronic
1176258088 20:64163788-64163810 AACCTTCCCAAAGAGAACTCAGG - Intronic
1176318587 21:5280927-5280949 AAACTGCTCAATCAGAAGACGGG + Intergenic
1176319884 21:5303034-5303056 AAACTTCTCAATGAAAAGTAAGG - Intergenic
1176476563 21:7220264-7220286 AAACTGCTCAATCAGAAGACGGG + Intergenic
1176477316 21:7234072-7234094 AAACTTCTCAATGAAAAGTAAGG - Intergenic
1177939281 21:27389171-27389193 GAACTACACAAATAGAAATCTGG + Intergenic
1179498027 21:41786952-41786974 AAACATCGCAAACAGCAGTCAGG + Intergenic
1180510106 22:16074535-16074557 AAACTGCTCAATTAAAAGTAAGG + Intergenic
1182623410 22:31630112-31630134 AAACTTCCCAAGTAGGAGACGGG + Intronic
1182905602 22:33933343-33933365 GAGTTTCTCAAATAGAAGGCAGG + Intergenic
1183991648 22:41601011-41601033 AAAATTATAAAATAGAAATCTGG + Exonic
949908053 3:8875180-8875202 CAACTTAACAAACAGAAGTCTGG + Intronic
949972551 3:9422089-9422111 AAACTTCTGAAAAAGAAACCAGG + Intronic
950278792 3:11687355-11687377 AAACTACTGAAATAGAAATATGG - Intronic
950962680 3:17122068-17122090 AAACATGTCAGCTAGAAGTCAGG + Intergenic
951253486 3:20421609-20421631 AAACTTTCCAAATAAAAGTGTGG - Intergenic
952025232 3:29072487-29072509 TAACTCCTAAAATAGAAGTTAGG - Intergenic
952045001 3:29308212-29308234 AAACTTCTCATAGAGAGTTCAGG + Intronic
952716995 3:36489835-36489857 AAACTTCTGTAATAGAGGGCTGG + Intronic
952810525 3:37398517-37398539 ATCCTTCTAAAACAGAAGTCAGG + Intronic
953142760 3:40244842-40244864 AAACTTCTCAAAGAGGAAACTGG - Intronic
953890152 3:46745252-46745274 AAACTTCTGACACAGAAGTCAGG - Intronic
957571574 3:81953431-81953453 AAGCTTTTAAAATAGAATTCTGG - Intergenic
958205808 3:90389571-90389593 AAACTTCTCAATCAAAAGACAGG + Intergenic
958407423 3:93766615-93766637 AAACATATCAAAAAGAAGTTTGG + Intergenic
958452406 3:94290393-94290415 AAACTTCTCAAATTCCAGTTTGG + Intergenic
961235985 3:125368055-125368077 AATCTTTTCAAATATAAGTATGG + Intronic
962249372 3:133826064-133826086 CAACTTCTGAAAAAGAGGTCTGG + Exonic
963291647 3:143496325-143496347 AAACTTCCAAATGAGAAGTCTGG - Intronic
963876822 3:150485186-150485208 AAACTTCTCAAATCTGAGGCAGG + Intergenic
964016222 3:151950434-151950456 AAACCTATTAAACAGAAGTCTGG - Intergenic
964922635 3:161915876-161915898 AAAGTTCTAAAAAAGAAGACCGG + Intergenic
964996308 3:162886114-162886136 TCACTTCTTAAATAGAAATCAGG - Intergenic
965107188 3:164371834-164371856 AGACTTCTAAATTGGAAGTCAGG + Intergenic
965256018 3:166412199-166412221 AAACTTTTAAAATAGTAGCCAGG - Intergenic
965464429 3:169010385-169010407 AAGCTTTTGAAATAAAAGTCTGG + Intergenic
965950153 3:174298976-174298998 AAAATGCTCAAATAGAATTTTGG + Intergenic
966502098 3:180654333-180654355 AAACTTCTCAAAGAAAACACAGG + Intronic
967598817 3:191359906-191359928 AAACCACTCAAATATAAATCAGG + Intronic
970304142 4:14713850-14713872 AAACTTCTAAAATATAATACAGG + Intergenic
970738369 4:19201156-19201178 CAACTGCTAAAATAGAAGGCAGG + Intergenic
972108374 4:35523478-35523500 AAACTTATAAAATAGACTTCAGG + Intergenic
973550264 4:52027569-52027591 AACCTTCTAAAAGAGAATTCTGG - Intronic
976274623 4:83263649-83263671 AAATCTCCCAAATAAAAGTCAGG + Intronic
976290159 4:83409675-83409697 AATATTCTCAAATAAAAATCTGG + Intronic
977259574 4:94782626-94782648 AAATTTTTCAAATTGAATTCTGG - Intronic
979497604 4:121401474-121401496 AAACTCCTAAAATAGAAGGCTGG - Intergenic
980416953 4:132502018-132502040 CCACTTCTCAAATAGTACTCAGG - Intergenic
981267897 4:142808330-142808352 AAACTTCTCAAATTGAAAGCCGG + Intronic
981428914 4:144637910-144637932 AATCTTATCAGATAGAAGTTTGG + Intergenic
982447257 4:155507364-155507386 AGACTGCTTAAACAGAAGTCAGG + Intergenic
982804788 4:159749492-159749514 AAACTTCTCAAATAAAACATAGG - Intergenic
983465572 4:168084040-168084062 AACCTTTTCACATAGAAATCTGG + Intergenic
983968328 4:173842026-173842048 AACATTCTCAAATAGGGGTCAGG - Intergenic
983970984 4:173874099-173874121 AAACTTCCCAAAAATAAGTTAGG - Intergenic
984044187 4:174777259-174777281 AAACTTCTGAGCTAGAATTCTGG + Intronic
984249607 4:177316293-177316315 AAACTTGTCAAATAAAAACCAGG + Intronic
984471162 4:180176347-180176369 AAACTACTCAAATAGAATCATGG + Intergenic
984624627 4:181992011-181992033 AAAATTCTCAAATGGAGATCTGG + Intergenic
985989213 5:3541431-3541453 TAACTTTTCAAAAAGAAATCAGG + Intergenic
986698836 5:10384190-10384212 AAACTTCTAAAATAAAATACAGG + Intronic
986967593 5:13293862-13293884 AAACTTCTCAAAGAAAACCCAGG - Intergenic
987054901 5:14181989-14182011 TAATTTCTTAAATACAAGTCAGG - Intronic
989748809 5:44866051-44866073 AAACTTGTCAAATAGAACTTGGG - Intergenic
989857957 5:46322733-46322755 AAACTTCTCAAACAAAAGAAAGG + Intergenic
989979843 5:50630467-50630489 AAAGTTCTCAATTAGTGGTCAGG - Intergenic
993528765 5:89000144-89000166 AAAATTATCAAATACAAGTGTGG + Intergenic
994791962 5:104239117-104239139 AAACTACTTCAAGAGAAGTCTGG - Intergenic
995148950 5:108819851-108819873 AAACTCCTCAAATAGACTTCTGG - Intronic
995169332 5:109089227-109089249 AAAATTCTCAAAGAGAAAGCTGG - Intronic
995423887 5:111997720-111997742 AAATTTCACAAATAGAACTAAGG - Intergenic
997711052 5:136005316-136005338 AAACTTCTGAAAAAGTACTCAGG - Intergenic
998507697 5:142685364-142685386 AACCTTTTGATATAGAAGTCAGG - Intronic
998795503 5:145813808-145813830 AACCTTCTTATACAGAAGTCTGG + Intronic
999590983 5:153145519-153145541 AAACTTTTCATATAAAAGACTGG + Intergenic
1000026597 5:157364059-157364081 AAACTTATCAATTAGCTGTCTGG - Intronic
1002863409 6:1100151-1100173 AAAATTCTAAAATAAAAGTGAGG + Intergenic
1003776656 6:9373869-9373891 AGACTTCTAATTTAGAAGTCTGG - Intergenic
1004318970 6:14617561-14617583 AAAGATCTGAAATAGAAGACAGG - Intergenic
1004995466 6:21187409-21187431 AAAATTCTCATTTAGAAGTTGGG + Intronic
1005278094 6:24241869-24241891 AATATTCTCAAAAAGAAATCAGG + Intronic
1005736655 6:28754061-28754083 AATATTATCAAATAGAATTCAGG + Intergenic
1008701494 6:54105969-54105991 AACCTTTTAAAACAGAAGTCAGG - Intronic
1009563856 6:65284230-65284252 TATCTTCTCAAAAAGAAGTCTGG + Intronic
1010552621 6:77241652-77241674 AAATTTCTCATATATAAGTGAGG + Intergenic
1010830245 6:80518415-80518437 CAACTACTAAAATAGAAGTCAGG - Intergenic
1010960005 6:82135115-82135137 AAACTAATAAAATAGAAGGCAGG - Intergenic
1011013373 6:82726992-82727014 AATCTTTTAAAATATAAGTCAGG - Intergenic
1011415178 6:87111436-87111458 AAACATCTCAGAAAGAAATCTGG - Intergenic
1012004506 6:93695615-93695637 AAAGTTCCCACATAGAAGTCAGG + Intergenic
1012314091 6:97763532-97763554 AAACTTCTACAAAACAAGTCTGG - Intergenic
1012580335 6:100861184-100861206 TAAATTCTGAAATAGAAGTATGG - Intronic
1015037733 6:128677699-128677721 AAACATGTCAAATACAAGACCGG + Intergenic
1015784078 6:136902475-136902497 AAACTTGACAAATAAATGTCTGG + Intronic
1016698214 6:147022792-147022814 CAACTTCTAAAATAGGAGTCAGG - Intergenic
1017646732 6:156546179-156546201 AAAGTTAGCAAATACAAGTCTGG - Intergenic
1018139657 6:160817592-160817614 CATCTTCTCAAAAATAAGTCTGG + Intergenic
1021867394 7:24971620-24971642 TGACTTCTCAAATGGAAATCAGG + Intronic
1022145558 7:27535612-27535634 AAACCTCTCTAATACAAGTAGGG + Intronic
1022237780 7:28478373-28478395 AAACTTCTCAATAAGAAAACAGG + Intronic
1023344649 7:39259325-39259347 AAACTTCTCAATACAAAGTCAGG - Intronic
1025309383 7:57910441-57910463 AAACTTCTCAAACAAAAGGAAGG + Intergenic
1025309726 7:57917275-57917297 AAACTACTCAATGAGAAGTAAGG - Intergenic
1025313050 7:57976081-57976103 AAACTTCTCAATCAAAAGTAAGG + Intergenic
1025313753 7:57989495-57989517 AAACTGCCCAATTAGAAGTAAGG + Intergenic
1025576705 7:62653176-62653198 AAACTTCTCAAAGAAAAGAAAGG + Intergenic
1025580996 7:62717171-62717193 AAACTTCTGAAAGAAAAGTAAGG - Intergenic
1026460690 7:70612694-70612716 TAACCTCTCAAATAAAAGTGAGG - Intronic
1027808650 7:82863506-82863528 TAACTTTTCAAATGGAATTCAGG - Intronic
1028452433 7:91000605-91000627 AAAGTTCTCAAAGAGCAGCCTGG - Intronic
1028701579 7:93786984-93787006 GAACTGGGCAAATAGAAGTCAGG - Intronic
1028721009 7:94031529-94031551 AAACTACTTAAATAGACCTCAGG - Intergenic
1028921678 7:96316765-96316787 GCAGTTCTCAAATAAAAGTCTGG + Intronic
1031042050 7:116848986-116849008 AAGCTGCTGAAATAGAAGTAGGG + Intronic
1032157866 7:129484400-129484422 AAAATTCTCAAATACAATTATGG - Intronic
1032597069 7:133252658-133252680 AAACTTCGCACATAGACATCCGG + Intergenic
1037012534 8:13861584-13861606 AAATTTCCCAAACATAAGTCGGG - Intergenic
1037500034 8:19476698-19476720 GCACTTCTTACATAGAAGTCTGG - Intronic
1038549586 8:28454862-28454884 AAAATTCTCAAAAAGACTTCAGG - Intronic
1038783910 8:30593290-30593312 AAAATTATGATATAGAAGTCCGG - Intronic
1039924227 8:41914734-41914756 AAACAACTCAATTAGAAATCGGG - Intergenic
1040273897 8:45990207-45990229 AAACTTCTCAATCAGAAGAAAGG - Intergenic
1040549071 8:48424533-48424555 AAAATTATCAAGTAGGAGTCTGG - Intergenic
1040968172 8:53105154-53105176 AAGCTTCTCAAATGGGAGACTGG + Intergenic
1040982702 8:53260734-53260756 ATCCTTCACAAATAGAAGTTTGG + Intergenic
1041800456 8:61792330-61792352 AAACTTCTAAGAGTGAAGTCAGG + Intergenic
1045203560 8:100012943-100012965 AAAGTTCTCATATAGAAATCAGG + Intronic
1046286416 8:112098687-112098709 AAACTTGTAGAATAGAAGCCAGG + Intergenic
1046332591 8:112739604-112739626 AAATTTCTCACATATAAGACAGG + Intronic
1051109270 9:13617040-13617062 AAACATCTCAAAAAGAAAACCGG - Intergenic
1051248402 9:15135327-15135349 AACCTTCACAAACAGAATTCAGG - Intergenic
1051653720 9:19356717-19356739 AAACTTTTCAAATACAAGGTTGG - Intronic
1053582665 9:39423487-39423509 AAACACCTCAATTAAAAGTCAGG - Intergenic
1053686334 9:40528832-40528854 AAACTTCTCAATCAAAAGTAAGG - Intergenic
1053711601 9:40815967-40815989 AAACTGCTCAATTAGAAGAAAGG - Intergenic
1053846846 9:42248334-42248356 AAACACCTCAATTAAAAGTCAGG - Intergenic
1053936428 9:43159880-43159902 AAACTTCTCAATCAAAAGTAAGG - Intergenic
1054104244 9:60982230-60982252 AAACACCTCAATTAAAAGTCAGG - Intergenic
1054277432 9:63096825-63096847 AAACTTCTCAATCAAAAGTAAGG + Intergenic
1054397404 9:64668104-64668126 AAACTTCTCAATCAAAAGTAAGG - Intergenic
1054422065 9:64947843-64947865 AAACTGCTCAATTAGAAGAAAGG - Intergenic
1054432044 9:65173297-65173319 AAACTTCTCAATCAAAAGTAAGG - Intergenic
1054498342 9:65848379-65848401 AAACTTCTCAATCAAAAGTAAGG + Intergenic
1054582100 9:66924620-66924642 AAACACCTCAATTAAAAGTCAGG + Intronic
1055255589 9:74366597-74366619 AGACTTATCAAGTAGAAGCCAGG - Intergenic
1055471298 9:76613993-76614015 TAACTTCTCAAAGGGAAGCCGGG - Exonic
1057362633 9:94389171-94389193 AAAATTCTCAAGTAGAAGCAAGG - Intronic
1057660704 9:96998922-96998944 AAAATTCTCAAGTAGAAGCAAGG + Intronic
1059382662 9:113939160-113939182 GAACTACTCTAATTGAAGTCAGG - Intronic
1059465786 9:114467947-114467969 TAACTTCCGAAATAGAAATCTGG - Intronic
1060458550 9:123825441-123825463 AAAATTTTCAAATGAAAGTCAGG + Intronic
1060644124 9:125263469-125263491 AAACTCCTGAAATAGAAATAAGG + Intronic
1060719186 9:125963430-125963452 AAAATTCCCAAACAGAACTCAGG + Intronic
1203411997 Un_KI270579v1:22950-22972 AAACTGCTCAATCAGAAGACGGG + Intergenic
1203562053 Un_KI270744v1:65462-65484 GAACCTCTTAAATAGAAATCTGG - Intergenic
1203684565 Un_KI270757v1:33063-33085 AAACTGCTCAAATAAAAGAAAGG - Intergenic
1187612188 X:20954980-20955002 GGACTTCTCAAAGAGAGGTCTGG + Intergenic
1191205460 X:57828529-57828551 AAAATTCTGAAATATAATTCTGG - Intergenic
1191301187 X:58934932-58934954 AAACTGCTCAAACAAAAGGCGGG - Intergenic
1191358139 X:59695856-59695878 AAACTGCTCAAACAAAAGGCGGG - Intergenic
1191415433 X:60462762-60462784 AAACTGCTCAAACAAAAGGCGGG - Intergenic
1191480393 X:61332127-61332149 AAACTGCTCAAACAAAAGGCGGG - Intergenic
1191511082 X:61742681-61742703 AAACTGCTCAAACAAAAGGCGGG - Intergenic
1191562342 X:62478218-62478240 AAACTGCTCAAACAAAAGGCGGG + Intergenic
1191572961 X:62656442-62656464 AAACTGCTCAAATAAAAGAAAGG - Intergenic
1192506927 X:71692171-71692193 AAACATTTCATTTAGAAGTCTGG - Intergenic
1192512957 X:71736443-71736465 AAACATTTCATTTAGAAGTCTGG + Intergenic
1192513740 X:71745066-71745088 AAACATTTCATTTAGAAGTCTGG - Intergenic
1192519770 X:71789375-71789397 AAACATTTCATTTAGAAGTCTGG + Intergenic
1192917488 X:75668040-75668062 AGACTTCTGAACTAGAAGTCTGG + Intergenic
1193483422 X:82056454-82056476 AAACTTAGCAACTAGAAGTGGGG + Intergenic
1194615613 X:96099134-96099156 AAACTTTTCAAATTGAAGCACGG + Intergenic
1200015993 X:153164270-153164292 AGACTTCTCAAATAGATCTGAGG + Intergenic