ID: 934638152

View in Genome Browser
Species Human (GRCh38)
Location 2:96009782-96009804
Sequence CGGGCCATGGCACGCCACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 2, 1: 0, 2: 1, 3: 8, 4: 159}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934638147_934638152 18 Left 934638147 2:96009741-96009763 CCTTAGACAGGTGGCCAGAGAAA No data
Right 934638152 2:96009782-96009804 CGGGCCATGGCACGCCACTGAGG 0: 2
1: 0
2: 1
3: 8
4: 159
934638143_934638152 30 Left 934638143 2:96009729-96009751 CCAGATACCTTTCCTTAGACAGG No data
Right 934638152 2:96009782-96009804 CGGGCCATGGCACGCCACTGAGG 0: 2
1: 0
2: 1
3: 8
4: 159
934638146_934638152 23 Left 934638146 2:96009736-96009758 CCTTTCCTTAGACAGGTGGCCAG No data
Right 934638152 2:96009782-96009804 CGGGCCATGGCACGCCACTGAGG 0: 2
1: 0
2: 1
3: 8
4: 159
934638148_934638152 4 Left 934638148 2:96009755-96009777 CCAGAGAAAAACTTCTCAAATAG 0: 3
1: 1
2: 1
3: 31
4: 271
Right 934638152 2:96009782-96009804 CGGGCCATGGCACGCCACTGAGG 0: 2
1: 0
2: 1
3: 8
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934638152 Original CRISPR CGGGCCATGGCACGCCACTG AGG Intergenic
902595384 1:17506145-17506167 CGGGCCATTGCACTCCAGTCTGG - Intergenic
902618222 1:17635404-17635426 CCGGCAATGGGAAGCCACTGGGG - Intronic
906105386 1:43288799-43288821 CGGGAGATGGGAAGCCACTGGGG + Intergenic
908257186 1:62312654-62312676 CAGGGCATGGGATGCCACTGTGG - Intronic
910358773 1:86394370-86394392 CGCGCCACTGCACTCCACTGCGG + Intronic
910988055 1:93025875-93025897 TGGGCAATGGAAAGCCACTGAGG + Intergenic
911615142 1:100002658-100002680 TGTGCCATGGCACTCCAGTGTGG - Intronic
912234531 1:107835240-107835262 GGGGCCATGGCAAGGCACTGAGG - Intronic
913962915 1:143353562-143353584 CGGAGCATAGCACGCCCCTGTGG + Intergenic
914057270 1:144179147-144179169 CGGAGCATAGCACGCCCCTGTGG + Intergenic
914121876 1:144787219-144787241 CGGAGCATAGCACGCCCCTGTGG - Intergenic
916652974 1:166847899-166847921 AGGCACATGGTACGCCACTGAGG - Intronic
917342469 1:173993974-173993996 CGCGCCATTGCACTCCACTCTGG + Intronic
918306054 1:183247266-183247288 CGCGCCATTGCACTCCAGTGTGG + Intergenic
920510044 1:206544376-206544398 AGGGCAATGGGAAGCCACTGAGG - Intronic
921166848 1:212514012-212514034 CTGGCTCTGGCACGCCCCTGGGG - Intergenic
922427583 1:225513943-225513965 CGCGCCATGGCACTCCAGTCTGG + Intronic
922603333 1:226873131-226873153 CGGGCCATGGCACTCCAGCCTGG + Intronic
922798806 1:228354562-228354584 CAGGCCCTGGCAGGCCTCTGCGG + Intronic
922816134 1:228450718-228450740 CGGGCAATGGCACGCAGGTGTGG + Intergenic
924606867 1:245542620-245542642 GGGGCCGTGGTACGCCACAGGGG + Intronic
924650702 1:245924593-245924615 GGAGCCATGGGACACCACTGAGG + Intronic
1062822067 10:541972-541994 CGTGCCAGGACACGCCCCTGGGG + Intronic
1063212391 10:3892879-3892901 AGGGCCCTGACAGGCCACTGAGG - Intergenic
1065150490 10:22817727-22817749 CGCGCCATTGCACTCCACTGTGG - Intergenic
1066604374 10:37145450-37145472 CGGGCCATTGCACTCCAGTCTGG + Intronic
1069167176 10:65176645-65176667 CGTGCCATTGCACTCCACTGTGG - Intergenic
1069667877 10:70176011-70176033 CGGGCCATGGCTGGTCACGGTGG + Intergenic
1072710485 10:97713255-97713277 CGGGCCCTGGCAGGAGACTGCGG + Intronic
1073397105 10:103226944-103226966 CGTGCCATGGCACTCCAGTCTGG + Intergenic
1074560355 10:114529981-114530003 CGTGCCATTGCACTCCATTGTGG + Intronic
1075479555 10:122768224-122768246 CAGGCCATGGCAGCCCACTTCGG + Intergenic
1076904967 10:133357099-133357121 GGGGCCACGGCAGGCCACAGAGG + Intronic
1084403131 11:68956304-68956326 GAGCCCCTGGCACGCCACTGGGG + Intergenic
1088032364 11:105266911-105266933 CGGGCCATTGCACTCCAATCTGG - Intergenic
1089906935 11:122049533-122049555 CGCGCCATTGCACTCCAGTGTGG + Intergenic
1092030067 12:5276519-5276541 CGGGCCCTGGCACTGCCCTGGGG + Intergenic
1093459120 12:19392549-19392571 CGTGCCATTGCACTCCACTCTGG - Intergenic
1095094231 12:38136954-38136976 CGGGCCATTGCACTCCACTCTGG + Intergenic
1095376204 12:41531533-41531555 GGGGCCATGGCAGGCCAGGGTGG + Intronic
1095414385 12:41960074-41960096 CGGGCCATGGCACTCCAGCCTGG + Intergenic
1095960573 12:47832260-47832282 CAGGCCATGGCAGGCGCCTGTGG + Intronic
1096151148 12:49313721-49313743 CGCGCCATTGCACTCCACTCTGG - Intergenic
1097230026 12:57505203-57505225 CGTGCCATTGCACTCCAGTGTGG - Intronic
1102107048 12:110334629-110334651 CGCGCCATGGCACTCCAATCTGG - Intronic
1103385435 12:120528758-120528780 CGGACCATTGCACTCCAGTGTGG + Intronic
1104594678 12:130113043-130113065 CAGGCCATGCCAGGCCACTCGGG - Intergenic
1105480265 13:20768921-20768943 AGGGTCATGGCATGCCACAGGGG + Intronic
1106600233 13:31181164-31181186 CGGGCCATTGCACTCCAATTTGG + Intergenic
1108554037 13:51575379-51575401 CGGGCCATTGCACTCCAGCGTGG + Intergenic
1109123591 13:58489000-58489022 CGGGCTAGGGCACGCCAGTGTGG + Intergenic
1111333827 13:86794103-86794125 CGCGCCATGGCACTCCAGCGTGG + Intergenic
1112171528 13:96977378-96977400 GGGGCCATGGAAGGCCACGGTGG + Intergenic
1112982079 13:105397150-105397172 CGGGCCACTGCACTCCACTCTGG + Intergenic
1113566556 13:111322922-111322944 AGGGCCAGGGCCAGCCACTGTGG - Intronic
1113861628 13:113490879-113490901 AGGGCCTTGGCTCGCCCCTGCGG + Exonic
1114458449 14:22872180-22872202 CGGGCCATGGAGCCCCCCTGGGG + Exonic
1115668366 14:35579562-35579584 CGCGCCATTGCACTCCAGTGTGG + Intronic
1119248417 14:73132307-73132329 CGGGCCATTGCACCCCAATCTGG + Intergenic
1119709683 14:76812710-76812732 CCGGCCAGGGCTCGCCTCTGCGG - Intronic
1122067149 14:99181709-99181731 CGGGGTATGACACGTCACTGGGG + Intronic
1122446588 14:101774016-101774038 AGGGTCATGGGAAGCCACTGGGG + Intronic
1125098460 15:35881676-35881698 AGTGCCATGGCAATCCACTGAGG + Intergenic
1125443919 15:39732573-39732595 CGTGCCATTGCACTCCAGTGTGG + Intronic
1126608520 15:50504936-50504958 CGTGCCATTGCACTCCAGTGTGG + Exonic
1126989420 15:54355398-54355420 CGCGCCATGGCACTCCACCCTGG - Intronic
1128103989 15:65029522-65029544 CGGGCCAGTGCTCGCCACTGGGG + Exonic
1128342205 15:66830442-66830464 CAGGCCGTGGCAGGGCACTGGGG - Intergenic
1132741613 16:1416203-1416225 CGTGCCATTGCACTCCACTCTGG - Intergenic
1135177010 16:20239230-20239252 CTGGCCATGGTACGCCATGGTGG + Intergenic
1141099871 16:81189362-81189384 CAGGCCACGGGAGGCCACTGGGG - Intergenic
1141605620 16:85151857-85151879 TGGGGCCTGGCAGGCCACTGAGG - Intergenic
1142022971 16:87795537-87795559 CGGGCCCTGGCTCGCCACTGGGG + Intergenic
1148205531 17:45777454-45777476 GGGGCCATGGGAAGGCACTGGGG - Intergenic
1151750474 17:76034434-76034456 CGTGCCATTGCACTCCAGTGTGG + Intergenic
1152744755 17:82033569-82033591 CGGGCCATGGCCAGGCCCTGTGG - Exonic
1157439036 18:47696322-47696344 GGGGGCATGGCATGCCACAGAGG - Intergenic
1158436953 18:57440633-57440655 CGGGCCGTGTCCCGCCGCTGCGG - Intronic
1159215197 18:65383686-65383708 CGGGGCATGGCAGGCCAGGGTGG - Intergenic
1161004388 19:1927405-1927427 CGCGCCATTGCACTCCAGTGTGG - Intergenic
1162101596 19:8342569-8342591 GGGGCCACGGCAGGCCAGTGAGG + Intronic
1163400261 19:17087884-17087906 CGCGCCATTGCACTCCACCGTGG + Intronic
1163603291 19:18261229-18261251 CTGGCCATCTCAGGCCACTGGGG - Intronic
1164564231 19:29314623-29314645 TGGGCCCTGGGAGGCCACTGGGG - Intergenic
1164683671 19:30152750-30152772 CAGGCCCTGTCACGGCACTGAGG + Intergenic
1166203446 19:41253485-41253507 AGGGCCATGGGAAACCACTGCGG + Intronic
1167971685 19:53191797-53191819 CGTGCCATTGCACGCCAGTCTGG + Intronic
927111079 2:19864137-19864159 CGCGCCATTGCACTCCAGTGTGG - Intergenic
927855643 2:26526041-26526063 CAGGCCACTGCACTCCACTGTGG + Intronic
929711929 2:44274799-44274821 CGAGCCATGGCACTCCACCCTGG - Intergenic
931605399 2:64047611-64047633 CGCGCCATTGCACTCCACTCTGG + Intergenic
934277906 2:91588834-91588856 CGGAGCATCGCACGCCCCTGTGG + Intergenic
934638152 2:96009782-96009804 CGGGCCATGGCACGCCACTGAGG + Intergenic
934795499 2:97095628-97095650 CGGGCCATGGCACGCCACTGAGG - Intergenic
935121108 2:100184458-100184480 TGGGCCCTGGCATGGCACTGAGG + Intergenic
935308645 2:101760957-101760979 CGCGCCATTGCACTCCAGTGTGG + Intronic
935646677 2:105342126-105342148 CGCGCCATCGCACGCCACCCTGG + Intronic
939980662 2:148776902-148776924 CGTGCCATTGCACTCCAGTGTGG - Intronic
943644769 2:190398229-190398251 CGCGCCACGGCACTCCACTCTGG + Intergenic
944628695 2:201599117-201599139 GGGGACATGACACACCACTGAGG - Intronic
944675050 2:202028413-202028435 CGGGCCATTGCACTCCAGTCTGG + Intergenic
944808267 2:203303649-203303671 CGCGCCATTGCACTCCAGTGTGG + Intronic
947711066 2:232316127-232316149 CGAGCCCTGGCATGCCACTGCGG + Intronic
1177757466 21:25364657-25364679 CGGGCCACGGCACTCCAGCGTGG - Intergenic
1182506290 22:30785521-30785543 CGCGCCATTGCACTCCAGTGTGG + Intronic
1183066769 22:35368727-35368749 CAGGCCATTGCACTCCAGTGTGG + Intergenic
950026577 3:9824452-9824474 CGCGCCATTGCACTCCAGTGTGG - Intronic
951196180 3:19826398-19826420 CGGGCCATTGCACTCCAGTCTGG - Intergenic
952882556 3:37993995-37994017 CGGGCCATGCCACCCCTCTCAGG - Intronic
953356901 3:42263785-42263807 CGCGCCATGGCACTCGGCTGGGG - Intronic
954545181 3:51428223-51428245 CGGGCTATGGCACTCCAGTCTGG - Intronic
954808994 3:53236446-53236468 CTGGCCATGGTACCCCACAGGGG - Intronic
955188100 3:56733938-56733960 CGGGCCATTGCACTCCAGTCTGG + Intronic
955294897 3:57726186-57726208 CGTGCCATTGCACTCCACTTTGG - Intergenic
955364681 3:58300769-58300791 CGGGCCATTGCACTCCAGTCTGG + Intergenic
957758359 3:84522537-84522559 GGGGGCATGGCAGGCCACCGTGG - Intergenic
961247774 3:125471298-125471320 CGCGCCATTGCACTCCAGTGTGG + Intronic
963445093 3:145395463-145395485 TGGGCCATGGCAGGCCAGGGTGG - Intergenic
966795964 3:183713847-183713869 CGTGCCACTGCACGCCAGTGTGG - Intronic
968286288 3:197510780-197510802 GGTGCCATGGCAGGGCACTGTGG - Exonic
968661619 4:1801064-1801086 CTGGCCCTGGCACGCCTCTCTGG + Intronic
970574285 4:17412269-17412291 GGGGACATGGCAGGCCACGGTGG + Intergenic
970689851 4:18610606-18610628 CGGGCCATGGCACTCCAACCTGG - Intergenic
972146306 4:36031084-36031106 CGTGCCATTGCACTCCAGTGTGG + Intronic
980128606 4:128797668-128797690 AGGGCCATGGCATGCCCTTGAGG - Intergenic
981125984 4:141106748-141106770 CGTGCCATTGCACTCCAGTGTGG + Intronic
983721363 4:170856524-170856546 CGTGCCATTGCACTCCACCGTGG + Intergenic
984342356 4:178473200-178473222 CGGGCCACTGCACTCCAGTGTGG - Intergenic
986830198 5:11568430-11568452 TGGGCCTTGCCACACCACTGAGG + Intronic
990220751 5:53585696-53585718 CGCGCCATTGCACTCCAGTGTGG + Intronic
992093605 5:73340398-73340420 GGGGGCATGGCAGGCCACGGTGG - Intergenic
994871251 5:105352116-105352138 CGGGGCATGGCAGGCCAGGGTGG + Intergenic
996771261 5:127088411-127088433 CGGGCCAGGGCAGAGCACTGTGG - Intergenic
997625247 5:135326919-135326941 CGGGCCCTGGCCAGCCTCTGTGG - Intronic
1002519606 5:179784209-179784231 CGCGCCATTGCACTCCAATGTGG + Intronic
1007588518 6:43007386-43007408 GGGGAAAAGGCACGCCACTGAGG - Intronic
1013459100 6:110358265-110358287 CGGGCCATGGCGCTACACTCGGG + Exonic
1020805958 7:12790694-12790716 CGCGCCATTGCACTCCACCGTGG - Intergenic
1024574506 7:50753095-50753117 CGGGCCATGGCACTAGACTTGGG - Intronic
1027029122 7:74875243-74875265 TGGGCCCTGGGTCGCCACTGGGG - Intergenic
1028724472 7:94071408-94071430 AGGGGCATGGCAGGCCACGGTGG + Intergenic
1029281478 7:99438631-99438653 CGGGCCAAGACACGCCAGAGGGG - Intronic
1029928337 7:104342753-104342775 GGGGCCATAGCAGGGCACTGGGG - Intronic
1030328749 7:108250380-108250402 CGTGCCATGGCACTCCAGTCTGG + Intronic
1032403074 7:131637348-131637370 AGGGCCATGGCCTGCCAGTGAGG - Intergenic
1036824506 8:11965699-11965721 CGGGCGATGGCACACCAAGGTGG + Intergenic
1037962755 8:23111258-23111280 CGCGCCATTGCACTCCAATGTGG - Intronic
1044094278 8:88043325-88043347 CGGGCCATTGCACTCCACCCTGG - Intronic
1044187090 8:89266408-89266430 CGTGCCATTGCACTCCAGTGTGG + Intergenic
1045105915 8:98892493-98892515 CTGGCCATGGCTGACCACTGTGG + Intronic
1045716155 8:105047923-105047945 CGCGCCATGGCACTCCACCCTGG + Intronic
1047746778 8:127850961-127850983 CGTGCCATAGCACTCCACTTTGG + Intergenic
1048402163 8:134082236-134082258 GGTGCCATGGCACACAACTGTGG - Intergenic
1049424156 8:142530634-142530656 CGGGGCCTGGCAGGCCAGTGTGG - Intronic
1051115128 9:13685816-13685838 CGGGGGAGGGCATGCCACTGTGG + Intergenic
1052867171 9:33471217-33471239 CGCGCCATTGCACTCCAGTGTGG + Intronic
1055085205 9:72306587-72306609 TGTGCCATTGCACTCCACTGTGG + Intergenic
1057376228 9:94525623-94525645 CACGCCATTGCACTCCACTGTGG + Intergenic
1057878038 9:98772585-98772607 AGGGCCCTGGCCCCCCACTGTGG + Intronic
1058852319 9:109024864-109024886 AAGGCCATGGGAAGCCACTGTGG + Intronic
1060603053 9:124890684-124890706 CTGGAAATGGCACACCACTGAGG + Intronic
1061268886 9:129525092-129525114 CAGGCCCTGGCACTTCACTGTGG - Intergenic
1061681525 9:132244911-132244933 CCGGCCAGGGCTGGCCACTGGGG - Intergenic
1062266968 9:135690950-135690972 CTGGCCATGGAACAACACTGAGG + Intergenic
1186132574 X:6484098-6484120 CGCGCCATTGCACGCCACCTTGG - Intergenic
1189790884 X:44603516-44603538 CGTGCCATTGCACTCCAGTGTGG + Intergenic
1198177213 X:134168447-134168469 CGGGCCATTGCACTCCAGTCTGG + Intergenic
1200123884 X:153804170-153804192 CCGGCCATGGCCCGCCGCAGGGG + Exonic
1200282468 X:154789247-154789269 AGGGCCATGGCAAGTCAATGTGG - Intronic
1201112696 Y:10811970-10811992 CGGGCTATGGCACTCCACTTGGG - Intergenic