ID: 934641065

View in Genome Browser
Species Human (GRCh38)
Location 2:96027289-96027311
Sequence CTGTATGGCTCGGAGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 2, 1: 0, 2: 2, 3: 11, 4: 157}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934641059_934641065 3 Left 934641059 2:96027263-96027285 CCATCTAAGCCCCACAGGCTAGA 0: 2
1: 0
2: 1
3: 6
4: 102
Right 934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG 0: 2
1: 0
2: 2
3: 11
4: 157
934641056_934641065 19 Left 934641056 2:96027247-96027269 CCTGTGGCTGACACCTCCATCTA 0: 2
1: 0
2: 0
3: 10
4: 128
Right 934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG 0: 2
1: 0
2: 2
3: 11
4: 157
934641053_934641065 27 Left 934641053 2:96027239-96027261 CCCTAGGCCCTGTGGCTGACACC 0: 2
1: 0
2: 1
3: 28
4: 212
Right 934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG 0: 2
1: 0
2: 2
3: 11
4: 157
934641054_934641065 26 Left 934641054 2:96027240-96027262 CCTAGGCCCTGTGGCTGACACCT 0: 2
1: 2
2: 19
3: 277
4: 2052
Right 934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG 0: 2
1: 0
2: 2
3: 11
4: 157
934641060_934641065 -6 Left 934641060 2:96027272-96027294 CCCCACAGGCTAGACTGCTGTAT 0: 2
1: 0
2: 1
3: 7
4: 165
Right 934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG 0: 2
1: 0
2: 2
3: 11
4: 157
934641061_934641065 -7 Left 934641061 2:96027273-96027295 CCCACAGGCTAGACTGCTGTATG 0: 2
1: 0
2: 1
3: 7
4: 81
Right 934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG 0: 2
1: 0
2: 2
3: 11
4: 157
934641055_934641065 20 Left 934641055 2:96027246-96027268 CCCTGTGGCTGACACCTCCATCT 0: 2
1: 0
2: 1
3: 28
4: 274
Right 934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG 0: 2
1: 0
2: 2
3: 11
4: 157
934641062_934641065 -8 Left 934641062 2:96027274-96027296 CCACAGGCTAGACTGCTGTATGG 0: 2
1: 0
2: 0
3: 9
4: 152
Right 934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG 0: 2
1: 0
2: 2
3: 11
4: 157
934641058_934641065 6 Left 934641058 2:96027260-96027282 CCTCCATCTAAGCCCCACAGGCT 0: 2
1: 0
2: 2
3: 19
4: 193
Right 934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG 0: 2
1: 0
2: 2
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934641065 Original CRISPR CTGTATGGCTCGGAGCAGAG AGG Intronic
901919788 1:12527907-12527929 CTGGAGGGCCTGGAGCAGAGGGG - Intergenic
901965747 1:12864297-12864319 GTGTTTAGCTCTGAGCAGAGAGG - Intronic
902020170 1:13339959-13339981 GTGTTTAGCTCTGAGCAGAGAGG + Intergenic
903351290 1:22718138-22718160 CTGTAAGGCTCAGAACACAGTGG - Intronic
903499198 1:23792352-23792374 CTGTAGGGCAGGGGGCAGAGGGG - Intronic
905643663 1:39609733-39609755 CTGGAGGGCTCAGAGCAGAAGGG + Intergenic
919363811 1:196631377-196631399 CAGTATGTCTGGGAGTAGAGAGG + Intergenic
919513400 1:198493919-198493941 GTGTTTGGCTCTCAGCAGAGAGG + Intergenic
919888697 1:201954444-201954466 ATGTTTGGCTCGGAGAAGAGGGG - Intergenic
921483565 1:215690834-215690856 AAGTATGGCTTGGATCAGAGTGG - Intronic
922739580 1:228007666-228007688 CTGAACAGCTCGGAGCAGCGTGG + Intronic
922853216 1:228752062-228752084 CTGCATGGCACAGAGCTGAGAGG + Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923334742 1:232958412-232958434 CTGAATGTCAAGGAGCAGAGAGG - Intronic
1063449135 10:6139842-6139864 TTGTTTAGCTGGGAGCAGAGAGG - Intergenic
1065328198 10:24568915-24568937 CTGTATGGCTGAGGGCTGAGGGG + Intergenic
1070700707 10:78599792-78599814 CTGAATTGCTAGGAGAAGAGAGG - Intergenic
1070731514 10:78831737-78831759 CAGGAGGGCTGGGAGCAGAGAGG + Intergenic
1071957117 10:90771111-90771133 GTGTTTGGCTCCCAGCAGAGAGG - Intronic
1072846405 10:98836056-98836078 TTGTATGGATTGAAGCAGAGAGG - Intronic
1073251014 10:102120277-102120299 CTGTCAGGCGCGGAGCAGACAGG + Exonic
1078793248 11:14566302-14566324 CAGAGTGGCTTGGAGCAGAGGGG + Intronic
1079244696 11:18743736-18743758 CTGTACGGCTGGGAGCTCAGGGG + Intronic
1080393655 11:31871010-31871032 CTGTGTGGCCAGGAGGAGAGAGG + Intronic
1083208467 11:61167393-61167415 CTGAATGGCTCGGCACAGCGTGG - Intergenic
1083253809 11:61484528-61484550 CTGCAGGGCTCTAAGCAGAGAGG + Intronic
1083518049 11:63278920-63278942 TTGTTTGGCTCAGAGCAGTGTGG + Intronic
1084784381 11:71433762-71433784 CTGCATGGCTCTGAGCGGAGTGG - Intronic
1085283762 11:75346930-75346952 CTGCATGGCTGGGAGCAGCTTGG - Intronic
1089082527 11:115788730-115788752 CTGTATGGCAAGGAACTGAGGGG + Intergenic
1089505735 11:118961012-118961034 CTCTATGGCTCTCAGCAGAGAGG + Intergenic
1090770531 11:129915667-129915689 CTGTACTGCTTGGAGCAGTGGGG + Exonic
1096472572 12:51888745-51888767 CAGTATGGCTTGGAGCTGGGTGG - Exonic
1099721750 12:86370975-86370997 CTATATGTATAGGAGCAGAGAGG + Intronic
1100318260 12:93465526-93465548 CTTGATGGCTGTGAGCAGAGTGG - Intergenic
1102441623 12:112967999-112968021 GTGTATGCCTGGGAGCAGGGCGG + Exonic
1107654108 13:42574337-42574359 CTGCGTGGCTCGGAGGAGATGGG + Exonic
1107966490 13:45602804-45602826 GTGTGTGGCTCAGAGCAGGGTGG - Intronic
1111595397 13:90404219-90404241 CTGTACAGCTCTGAGTAGAGAGG - Intergenic
1112207818 13:97342836-97342858 CTGTATGGTTTGGGGAAGAGAGG + Intronic
1112443333 13:99441482-99441504 CTGTGTGGATGGGAGCAGTGGGG - Intergenic
1114354700 14:21894520-21894542 CTGGAGGGCCCTGAGCAGAGCGG - Intergenic
1114883757 14:26821371-26821393 CTGTATGGCAAGGAGCACAATGG + Intergenic
1118824781 14:69370187-69370209 CTGTAAGCCTGGGAGCAGTGGGG - Intergenic
1119053074 14:71389847-71389869 CTGAAGGGCTCGGAGGAGAGTGG + Intronic
1119984458 14:79121017-79121039 CTGTAATGCTCAGAGTAGAGTGG - Intronic
1122366282 14:101196811-101196833 CTGGAAGGCTGGCAGCAGAGGGG - Intergenic
1122791601 14:104186165-104186187 CAGGAGGGCTGGGAGCAGAGTGG + Intergenic
1122911035 14:104827661-104827683 CTGACTGGCTGGGAGCAGGGAGG + Intergenic
1124345562 15:28919408-28919430 CGGTTTGACCCGGAGCAGAGGGG - Intronic
1128089879 15:64912084-64912106 CTGTGTGGCTCCGAGCGGAATGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128717024 15:69916268-69916290 CTGAGTGGCTGGGAGCAGAAGGG + Intergenic
1129859770 15:78851457-78851479 ATGTATGGCCTGGAGCAGCGGGG - Intronic
1130010445 15:80149065-80149087 CTGTATTTCTGGGAGCAGAGTGG + Intergenic
1132055350 15:98647785-98647807 CCGTGTGGCTCGGCCCAGAGTGG - Intergenic
1132154629 15:99486772-99486794 CTGTTTGGCTCTGAGCTGGGTGG - Intergenic
1132925259 16:2425953-2425975 CTGCAGTGCACGGAGCAGAGTGG + Intergenic
1135614266 16:23897219-23897241 CTGTAGAGCTCTGAGCAGGGAGG + Intronic
1137831109 16:51544176-51544198 CTATATGGTTGGGGGCAGAGTGG + Intergenic
1138531132 16:57635012-57635034 CTGGATGGGAGGGAGCAGAGGGG + Intronic
1139778810 16:69334161-69334183 CTGTAAGACCCTGAGCAGAGAGG + Intronic
1142480194 17:214262-214284 CTGTGTGGCCCAGTGCAGAGAGG - Intronic
1142768683 17:2081175-2081197 CTCTAGGGCTCGGGGCAGACAGG - Intronic
1142810107 17:2392009-2392031 CTGGGTGGCACGGAGCAAAGTGG - Intronic
1144365227 17:14537390-14537412 GTGTATGGCACAGAGCAGAAAGG + Intergenic
1146476819 17:33169450-33169472 CTGTAAGGCACTGAGCCGAGTGG - Intronic
1147977913 17:44258584-44258606 CTACATGGCTCAGAGCCGAGGGG - Exonic
1149290231 17:55211116-55211138 CTGTATGGCTCCCACTAGAGGGG + Intergenic
1150951005 17:69802056-69802078 CTGTGTAGCTCTCAGCAGAGAGG - Intergenic
1151625622 17:75273673-75273695 CTGTGTTGATGGGAGCAGAGCGG - Intronic
1151878138 17:76878955-76878977 CTGTCTGGTCCGCAGCAGAGCGG + Intronic
1152823824 17:82450882-82450904 CTGGATGGGGCGGAGCCGAGCGG + Intergenic
1154170731 18:12048281-12048303 CTGTATTGCTGGCAGCAGTGGGG - Intergenic
1154357483 18:13632999-13633021 CTGTCCAGCTCAGAGCAGAGAGG + Intronic
1155030702 18:21981131-21981153 CTGGATTCCTGGGAGCAGAGGGG - Intergenic
1155108527 18:22690697-22690719 CTGGAGGGCTTGGAGCAGAGGGG - Intergenic
1156610070 18:38715178-38715200 ATGTATGGCTTGGGGCTGAGGGG - Intergenic
1160010665 18:75105331-75105353 CTGAATGGCGTGGAGCAGAGAGG + Intergenic
1161393458 19:4032947-4032969 CTGTGTGGCTCGGGGCCGTGAGG - Intronic
1163828104 19:19535082-19535104 GTGTGTGGCCCGGAGCAGAACGG + Exonic
1166567880 19:43776236-43776258 CTGAGTGCCTGGGAGCAGAGTGG + Intronic
1167886024 19:52500730-52500752 ATGTATGTCAGGGAGCAGAGGGG + Intronic
1167888052 19:52518111-52518133 ATGTATGTCAGGGAGCAGAGCGG + Intergenic
1167916407 19:52743502-52743524 ATGTATGTCAGGGAGCAGAGTGG - Intergenic
928112445 2:28521816-28521838 CAGTAGGGCTCTGAGCAGGGTGG - Intronic
934619703 2:95796693-95796715 CTGTATGGCTGGGAACAGAGAGG - Intergenic
934619823 2:95797268-95797290 CTGTATGGCTCGGAGCAGAGAGG - Intergenic
934641065 2:96027289-96027311 CTGTATGGCTCGGAGCAGAGAGG + Intronic
934641185 2:96027864-96027886 CTGTATGGCTGGGAACAGAGAGG + Intronic
938564913 2:132509918-132509940 GTGTATGGCTGGTAGGAGAGGGG + Intronic
944204585 2:197144168-197144190 CTGAATGCCTCTGAGCAGACAGG - Intronic
945840085 2:214877183-214877205 CTCTCAGGCTCAGAGCAGAGTGG + Intergenic
946940835 2:224768797-224768819 CTGAATGGCTAGGAAGAGAGGGG + Intronic
947955034 2:234182047-234182069 CTGTACGGGACGGAGCAGACTGG + Intergenic
949044166 2:241863308-241863330 CTGGATGGCTCGGCACAGAGAGG - Intergenic
1169068911 20:2709762-2709784 TTGGGTGGCTCTGAGCAGAGAGG + Intronic
1169341433 20:4799463-4799485 CTGAATGGCTGGGTTCAGAGAGG - Intronic
1170043820 20:12065284-12065306 CTGCATAGCTCTCAGCAGAGAGG + Intergenic
1172639044 20:36430071-36430093 CTGTCTGCCATGGAGCAGAGAGG - Intronic
1173044554 20:39497260-39497282 CTCCATGGCTAGGAACAGAGAGG + Intergenic
1173342514 20:42165190-42165212 CTATATGGCTGGTAGCAGTGGGG - Intronic
1174546302 20:51327849-51327871 CTGTCTGGAAAGGAGCAGAGAGG - Intergenic
1180056191 21:45360297-45360319 ATGTGTGGCTCTGTGCAGAGGGG + Intergenic
1182876013 22:33691576-33691598 ATGTATGGATGTGAGCAGAGAGG - Intronic
1183391277 22:37546764-37546786 CTGTATGGCTCTCCTCAGAGGGG - Intergenic
1183739804 22:39663258-39663280 CTGTATGGCTTGCATCTGAGGGG + Intronic
1184054224 22:42033649-42033671 CTCTGTGGCTCTCAGCAGAGAGG + Intronic
951743576 3:25951351-25951373 CTGTATGGCTCTGAACCAAGTGG - Intergenic
954150975 3:48656855-48656877 CTGGATGGGTCGGAACAGCGTGG + Exonic
958959117 3:100492379-100492401 CGGGACGGCTCGGGGCAGAGAGG - Intergenic
961942932 3:130656400-130656422 GTGTCTGGCTCTCAGCAGAGAGG + Intronic
962002774 3:131316742-131316764 CTGTCTGGCTTAGATCAGAGAGG + Intronic
963074337 3:141332453-141332475 CTGCAGGGCTCAGAGCTGAGAGG - Intronic
963318510 3:143786593-143786615 CTGTATTTCTGGCAGCAGAGAGG - Intronic
963781998 3:149495694-149495716 CTGTGTGACTAGCAGCAGAGGGG - Intronic
967149581 3:186636444-186636466 CGGTATGGCTAAGAGCACAGGGG - Intronic
971841321 4:31856066-31856088 CTGTCTGGCTATGAGCAGTGGGG - Intergenic
976872188 4:89808665-89808687 CTGGATGGTTGGGAGCAGAGGGG + Intronic
978229861 4:106385565-106385587 GTGTTTGGCTCCTAGCAGAGAGG + Intergenic
979803356 4:124939270-124939292 CTTTATGTCATGGAGCAGAGTGG + Intergenic
982802559 4:159722759-159722781 GTGTCTGGCTCTCAGCAGAGAGG + Intergenic
984943085 4:184951265-184951287 GTGTATGTCTCGGAGTGGAGTGG - Intergenic
985549719 5:526846-526868 CTGGAGGGCTCGGGGCAGACGGG + Intergenic
987755738 5:22096479-22096501 CTGCCTGGCTAGGAGGAGAGAGG - Intronic
987924663 5:24325051-24325073 CTGTATGACTCTGAGCACACAGG + Intergenic
989138203 5:38176240-38176262 CTGGATGGCTGGAATCAGAGTGG - Intergenic
994851281 5:105057582-105057604 CTCTATAGCTCTCAGCAGAGAGG - Intergenic
999611607 5:153376038-153376060 TTGTATGGCTAGGAGGAGAATGG - Intergenic
1002056690 5:176601955-176601977 CTGCCTGGTTCCGAGCAGAGGGG - Intronic
1002071137 5:176679612-176679634 ATGTATGTCTTGAAGCAGAGGGG - Intergenic
1003066236 6:2905530-2905552 CTCTAGGCCTCGGAGCACAGAGG - Intergenic
1003495696 6:6661348-6661370 CTGTCTGTCTGAGAGCAGAGGGG - Intergenic
1006688782 6:35861636-35861658 CTTTATGCCTGGGACCAGAGCGG - Intronic
1006838796 6:37015090-37015112 CAGTATGACTCGGGCCAGAGTGG - Intronic
1007791287 6:44310302-44310324 CTGTATGGCGTTGAGCAGCGGGG + Exonic
1011215221 6:84998325-84998347 CTGCAGGGCTTTGAGCAGAGAGG + Intergenic
1015663739 6:135603860-135603882 CTCTATAGCTCTCAGCAGAGAGG - Intergenic
1015663748 6:135603931-135603953 CTCTGTGGCTCTCAGCAGAGAGG - Intergenic
1015794859 6:137001486-137001508 CTTTATGGCTGGGATCAAAGGGG + Exonic
1017967269 6:159277209-159277231 CTGTGTGGCTGGGAGAAGGGAGG + Intergenic
1023314882 7:38925922-38925944 CTGTAAGAATCTGAGCAGAGTGG - Intronic
1023674195 7:42613473-42613495 CTGAATGGTTAGAAGCAGAGTGG - Intergenic
1025684161 7:63702545-63702567 CTGTATTGCTGGCAGCAGAAAGG + Intergenic
1027812664 7:82925148-82925170 ATGAATGGCCAGGAGCAGAGCGG - Intronic
1030243837 7:107359807-107359829 CTGTGTGGCCCTCAGCAGAGAGG - Intronic
1037803346 8:22046707-22046729 GTGTGTGGCTCAGAGGAGAGAGG - Intronic
1038181830 8:25236258-25236280 CTGGATGGGTCTGAGCAGAGAGG + Intronic
1038700042 8:29841367-29841389 CTGTGTGGCTGGCAGGAGAGAGG - Intergenic
1041330035 8:56714391-56714413 CTGGAGGGATCGGGGCAGAGAGG - Intergenic
1044501510 8:92964201-92964223 CTACATAGCTGGGAGCAGAGTGG - Intronic
1044934590 8:97280719-97280741 CTGGGTGGCTTAGAGCAGAGGGG - Intergenic
1049204117 8:141355447-141355469 CTGTGTGGCTGGGAGCAGGAGGG - Intergenic
1050212086 9:3271800-3271822 CTGTTTGGCTGGGAACACAGTGG - Intronic
1050687781 9:8190966-8190988 CAGTACGGGTTGGAGCAGAGTGG - Intergenic
1053027814 9:34745143-34745165 CTCCATGACTCAGAGCAGAGAGG + Intergenic
1053624533 9:39855073-39855095 CTGTTTGGCACGTAGCAGTGTGG + Intergenic
1053880338 9:42588155-42588177 CTGTTTGGCACGTAGCAGTGTGG - Intergenic
1054116215 9:61165450-61165472 CTGTTTGGCACGTAGCAGTGTGG + Intergenic
1054219364 9:62395625-62395647 CTGTTTGGCACGTAGCAGTGTGG - Intergenic
1054231349 9:62513548-62513570 CTGTTTGGCACGTAGCAGTGTGG + Intergenic
1054591545 9:67017094-67017116 CTGTTTGGCACGTAGCAGTGTGG - Intergenic
1054822480 9:69537423-69537445 CTATATGGCTAGGAGCACATGGG + Intronic
1057468591 9:95337935-95337957 CTGCGTGGCTCTCAGCAGAGAGG - Intergenic
1060170693 9:121458777-121458799 CTGAATGACTGGGGGCAGAGAGG - Intergenic
1062121573 9:134836639-134836661 CTGTAGCCCTGGGAGCAGAGTGG + Intronic
1188807457 X:34609172-34609194 CTGAATGGCTCTGAGCAGTGAGG + Intergenic
1189269644 X:39742036-39742058 CTGTATGTCTCCTAGCAGACAGG + Intergenic
1192789644 X:74368778-74368800 CTGTATGTCTAGAAGCAAAGAGG + Intergenic
1196541499 X:116915999-116916021 CTGTAAGGCTATGAGCACAGAGG + Intergenic
1201111762 Y:10804562-10804584 CTGAATGGATCGGAGTGGAGTGG - Intergenic
1201622650 Y:15977749-15977771 CTGTAAGGCCCGTAGGAGAGTGG + Intergenic