ID: 934641741

View in Genome Browser
Species Human (GRCh38)
Location 2:96031001-96031023
Sequence CAGGGTGAGGGGTGGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1320
Summary {0: 2, 1: 0, 2: 13, 3: 143, 4: 1162}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934641741_934641756 16 Left 934641741 2:96031001-96031023 CCCCATTCCCACCCCTCACCCTG 0: 2
1: 0
2: 13
3: 143
4: 1162
Right 934641756 2:96031040-96031062 TTCACAGCCTGAAACACGGTGGG 0: 2
1: 0
2: 1
3: 8
4: 89
934641741_934641754 12 Left 934641741 2:96031001-96031023 CCCCATTCCCACCCCTCACCCTG 0: 2
1: 0
2: 13
3: 143
4: 1162
Right 934641754 2:96031036-96031058 CAGGTTCACAGCCTGAAACACGG 0: 2
1: 0
2: 2
3: 14
4: 194
934641741_934641755 15 Left 934641741 2:96031001-96031023 CCCCATTCCCACCCCTCACCCTG 0: 2
1: 0
2: 13
3: 143
4: 1162
Right 934641755 2:96031039-96031061 GTTCACAGCCTGAAACACGGTGG 0: 2
1: 0
2: 0
3: 11
4: 85
934641741_934641751 -7 Left 934641741 2:96031001-96031023 CCCCATTCCCACCCCTCACCCTG 0: 2
1: 0
2: 13
3: 143
4: 1162
Right 934641751 2:96031017-96031039 CACCCTGTTGAGTCGGGTACAGG 0: 2
1: 0
2: 0
3: 3
4: 30

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934641741 Original CRISPR CAGGGTGAGGGGTGGGAATG GGG (reversed) Intronic
900093589 1:931137-931159 CACGGTCAGGGGTGGGAGGGAGG - Intronic
900102370 1:967366-967388 CTGGGGGGGGGGTGGGCATGGGG - Intronic
900112248 1:1013264-1013286 CAGGGTGTTGGGTGGGGGTGGGG + Intergenic
900181599 1:1313479-1313501 CATGGTGAGGTGTGGGAATCTGG - Intronic
900209437 1:1446645-1446667 CATGGCGAGGGGTGGGGATGGGG + Intergenic
900219256 1:1498507-1498529 CATGGCGAGGGGTGGGGATGGGG + Intergenic
900620819 1:3586867-3586889 CAGGGTGAGGCCTGGGCTTGGGG - Intronic
900631601 1:3639382-3639404 CAGGGAAAGGGGTGGAAAAGTGG - Intronic
900914585 1:5627118-5627140 AAGAGTGAGGGAAGGGAATGTGG + Intergenic
901117872 1:6863318-6863340 CAGGGGTTGGGGAGGGAATGGGG - Intronic
901783709 1:11610792-11610814 GAGGGTTAGGAGTGGGAGTGCGG - Intergenic
902101485 1:13993779-13993801 GAGGGTCAGGGGTGGGCATGGGG + Intergenic
902120449 1:14160443-14160465 GAGGGTGAGGGGCTGGAAGGAGG + Intergenic
902177104 1:14658748-14658770 TAGGGTGGGGCGAGGGAATGTGG - Intronic
902208995 1:14891305-14891327 CAGGGTAAAGGGTGGGAAGGGGG - Intronic
902228895 1:15014838-15014860 CAGGGTGAGGGCACGGAAGGCGG - Intronic
902315713 1:15617273-15617295 GAGGGGGAGGAGTGGGAAGGGGG - Intergenic
902323160 1:15683066-15683088 AAGGATAAGGAGTGGGAATGGGG + Intergenic
902336696 1:15758535-15758557 CAGGCCAGGGGGTGGGAATGGGG - Intronic
902513756 1:16979411-16979433 CAGGGAGAGGGGAGGGAAAGGGG + Intronic
902623350 1:17663029-17663051 CAGGGTGCCAGGTGGGAAAGGGG - Intronic
902864373 1:19268781-19268803 CAGGGTGTGGGGTGGGGCAGTGG - Intergenic
902866599 1:19284196-19284218 CAGGGTGTGGGGTGGGACAGTGG - Intronic
902869608 1:19306227-19306249 CAGGGTGTGGGGTGGGGCAGTGG - Intronic
902943894 1:19820053-19820075 CTTGGTGAGGGGTGGGGGTGGGG - Intergenic
903010432 1:20326209-20326231 CAGGGTGGGGGATGGGATTGGGG + Intronic
903224026 1:21884975-21884997 CAGGTGGTGGGGTGGGAATGAGG - Intronic
904294198 1:29507198-29507220 GAGGGTGAGGGGTAATAATGGGG - Intergenic
904376632 1:30086040-30086062 CAGAGAGAGGGAGGGGAATGGGG - Intergenic
904622527 1:31783888-31783910 CAGGGTCATGGGTTGGAATATGG - Intergenic
904678902 1:32215340-32215362 CAGGTTCAGGGGAGGGAAAGGGG + Intronic
904778186 1:32924831-32924853 CGGGGTAAGGGATGGGGATGTGG + Intergenic
905203222 1:36327853-36327875 CAGGGGGTGGGGAGGGCATGTGG - Exonic
905207983 1:36353791-36353813 CAGGGTGAGGGGGTGGAATTAGG - Intronic
905490619 1:38340675-38340697 CAGGATGGGTGGTGGGAACGTGG + Intergenic
905567116 1:38974265-38974287 CAGGGTGTGGGCTGGGGGTGTGG - Intergenic
905968060 1:42116044-42116066 CGGGGTGGGGAGTGGGACTGGGG + Intergenic
905989070 1:42316867-42316889 CAGGGGAAAGGGTGGGAGTGGGG + Intronic
906087469 1:43148150-43148172 CGGGTTGCGGGGTGGGAACGCGG + Intronic
906237605 1:44221327-44221349 GAGATTGAGGGGTGGGGATGGGG + Exonic
906479926 1:46193216-46193238 CTGGGAGTGGGGTGGGAATAGGG + Intronic
906637217 1:47417342-47417364 CAGGGTGGGGGGTAGAGATGGGG - Exonic
906742290 1:48194244-48194266 GAGGGTGAAGGGTGGGGAGGAGG + Intergenic
906781628 1:48577779-48577801 CAGAGAGAGGGGTGAGAGTGAGG + Intronic
906911792 1:49960014-49960036 GAGGGTGAAGGGTGGGAGCGGGG + Intronic
907118502 1:51989958-51989980 GAGGGTCGGGGGTGGGGATGTGG - Intronic
907391437 1:54160834-54160856 CAGGGTGAGTGCTGGGAGTCAGG + Intronic
907395834 1:54189407-54189429 CAGGAAGGGTGGTGGGAATGGGG + Intronic
907412028 1:54289810-54289832 CAGGGTAGGGGGTGGGTGTGGGG + Intronic
907460181 1:54601250-54601272 CATGCTGAGGGGAGGGAGTGTGG - Exonic
907999720 1:59668353-59668375 CAGGGCAAGGGGAGGGAAAGTGG + Intronic
908213116 1:61921783-61921805 CAGGGGAAGAGGTGGGAAGGAGG + Intronic
908401482 1:63775512-63775534 CAGGTTTAGGGCTGGGAGTGGGG - Intronic
908835203 1:68222894-68222916 CAAGGTGTGGGGTGGGGGTGGGG + Intronic
908888881 1:68819923-68819945 TAGGGTTGGGGGTGGGAATGAGG + Intergenic
909095523 1:71283027-71283049 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
910684925 1:89906454-89906476 CAGAGTCAGGGGTGGGATTTTGG - Intronic
910748673 1:90602795-90602817 CAGGTTGAGTGGTGGGCATATGG + Intergenic
911548589 1:99252089-99252111 GAGGGTGAAGGGTGGGAAGAGGG + Intergenic
911587274 1:99705219-99705241 CAGGGTGTGGAATGGGGATGTGG - Intergenic
912138517 1:106692065-106692087 CAGGGTAAGGAGGGGGAATGAGG + Intergenic
912386036 1:109271671-109271693 CAGGGTCAGGGCTGGGCTTGCGG - Exonic
913148206 1:116013205-116013227 CAGGGAGAAGGCTGGGGATGAGG - Intronic
913558558 1:119994986-119995008 TAGCATGAGGGGTGGGAATGGGG - Intronic
913639283 1:120795485-120795507 TAGCATGAGGGGTGGGAATGGGG + Intergenic
914279167 1:146154473-146154495 TAGCATGAGGGGTGGGAATGGGG - Intronic
914540213 1:148605403-148605425 TAGCATGAGGAGTGGGAATGGGG - Intronic
914626434 1:149465811-149465833 TAGCATGAGGGGTGGGAATGGGG + Intergenic
915135372 1:153728048-153728070 AAGGGCGGGGGGTGGGAAGGCGG - Exonic
915340558 1:155174638-155174660 CAAGGTGAGGTGTGGGGGTGGGG + Intronic
915428115 1:155843912-155843934 CAGGGTTGGGAGTGGGTATGGGG - Intronic
915472709 1:156135378-156135400 CAGGGTTGGGGGTGGGGGTGGGG + Intronic
915473496 1:156139159-156139181 CAGGGCAGGGGGTGGGCATGAGG - Exonic
915558440 1:156673109-156673131 AAGGGTGAGGGGAGGGAAGTTGG + Exonic
915641324 1:157229307-157229329 CAGGGAGAGGGATGAGAATAGGG + Intergenic
915954360 1:160210091-160210113 CAGGTAGGGGGCTGGGAATGGGG + Intronic
916123745 1:161551052-161551074 CGGGGGGAGGGGTGGGTACGTGG - Intergenic
916133631 1:161632415-161632437 CAGGGGGAGGGGTGGGTACGTGG - Intronic
916281943 1:163061330-163061352 CAGTGGTAGGGATGGGAATGGGG + Intergenic
916419535 1:164623342-164623364 GAGGGCGTGGTGTGGGAATGGGG + Intronic
917000030 1:170347515-170347537 CAGGATGAGTGGTGGGTTTGTGG - Intergenic
917436170 1:175023504-175023526 CTGGGAGGTGGGTGGGAATGTGG + Intergenic
917508534 1:175650698-175650720 TAGGGGGAGGGGTAGTAATGGGG - Intronic
917713717 1:177712517-177712539 CATGGTGACAGGTGGGAATGTGG - Intergenic
917722113 1:177795874-177795896 GTGGGTAAGGGGTGGGAATAAGG - Intergenic
917976950 1:180245854-180245876 CAGGACACGGGGTGGGAATGTGG - Intronic
918220793 1:182434588-182434610 CAGAGAGAGGGGTGGGGATGTGG + Intergenic
918313684 1:183305033-183305055 AAGGATGCGGGATGGGAATGGGG - Intronic
918403905 1:184192795-184192817 CAGGGTTGGGGGTGGGAGGGTGG + Intergenic
918877622 1:190070039-190070061 GGGGGTGAGGGGAGGGAAAGTGG - Intergenic
919163386 1:193861318-193861340 CAGGGGGAGGGAAGGGGATGAGG - Intergenic
919776945 1:201200420-201200442 TGGAGTGAGGGGTGGGAATGGGG - Intronic
919796474 1:201324235-201324257 CAGGATCAGGGCTGGGAAAGGGG + Intronic
920054666 1:203183438-203183460 CATGGTGGGAGGTGGGAATGGGG - Intronic
920278921 1:204828903-204828925 GAGGGGAAGGGATGGGAATGTGG - Intronic
920416061 1:205800028-205800050 CTGGGTGGGGGGTTGGAAGGGGG + Intronic
920981397 1:210839426-210839448 GAAGGTGAGGGGTGGGAAGAGGG + Intronic
921394482 1:214654068-214654090 CAGGAGGAGGAGGGGGAATGAGG - Intronic
921501733 1:215912798-215912820 GAGGGTGAAGGGTGGGAAGATGG - Intronic
921519713 1:216145087-216145109 TAGGGTGAGGGAAGGGAAGGAGG - Intronic
922070057 1:222183474-222183496 CAGGGAAAGGGGTGGGATTGTGG - Intergenic
922088284 1:222371514-222371536 CAGGGTGAGGAGTGTGATTCAGG - Intergenic
922597807 1:226827307-226827329 GAGGCTGAGGGTCGGGAATGGGG + Intergenic
922783200 1:228269619-228269641 CAGGGTCAGGGGTGAGAGGGAGG - Intronic
922789410 1:228302838-228302860 CAGGGTAATATGTGGGAATGTGG + Intronic
922880064 1:228974165-228974187 CAGGGAGAGGGGTGGGGAAATGG - Intergenic
923039323 1:230308589-230308611 CAGGGCTAGGGGTGGGGAGGCGG + Intergenic
923228417 1:231961009-231961031 TAGGGTGAGGTATGGGAAAGGGG + Intronic
923452180 1:234128480-234128502 GTGGGTGAGGGATGAGAATGAGG + Intronic
923558975 1:235023905-235023927 CAGGCTGAGGGGTTTGAGTGAGG - Intergenic
924184532 1:241474422-241474444 CAGGGTTGGTGGTGGGAAGGAGG - Intergenic
924218969 1:241854073-241854095 GAAAGTGAGGGCTGGGAATGTGG - Intronic
924532007 1:244901481-244901503 GAGGGGGAGGGGTGGGGAGGAGG - Intergenic
1062874363 10:932344-932366 CCGGGTGTGGGGTGGGAGTTCGG - Intergenic
1062874464 10:932559-932581 CCGGGTGTGGGGTGGGAGTTTGG - Intergenic
1062874503 10:932641-932663 CCGGGTGTGGGGTGGGAGTTTGG - Intergenic
1062958264 10:1554240-1554262 CAGGGGCAGGGGTGGGCCTGTGG + Intronic
1063081290 10:2770145-2770167 CGGGGGAAGGGGTGGGAAGGGGG + Intergenic
1063243288 10:4193006-4193028 CAGGGTGAGAGATGGGAATTTGG - Intergenic
1063368282 10:5504658-5504680 CAGGGTGAGGACTCGGAAGGTGG + Intergenic
1063685722 10:8235725-8235747 AGGGGTGGGGGGTGGGAAGGGGG + Intergenic
1063785505 10:9378963-9378985 CTGGGGGAGGGGTGGCTATGTGG + Intergenic
1064008343 10:11715411-11715433 CAGGGTGGGGGGCGGGGGTGGGG - Intergenic
1064533193 10:16331262-16331284 GAGATTGAGGGGTGAGAATGGGG - Intergenic
1065810037 10:29433868-29433890 AGGGGTGGGGGGTGGGAATGGGG - Intergenic
1065864047 10:29898184-29898206 TGGGGTCAGGGGTGGGAGTGTGG + Intergenic
1066442311 10:35450140-35450162 CAGGGGGAGGGGTGGCAGAGAGG + Intronic
1066706329 10:38183042-38183064 CAGGGAAAAGGGTGGGAAGGGGG - Intergenic
1067170011 10:43898664-43898686 CTGGGTTAGGGGTGGCAAAGGGG - Intergenic
1067223322 10:44359538-44359560 CAGGTTGAGAGGTGGGCATGGGG + Intergenic
1067695966 10:48535920-48535942 CAGGTGGAGGGGCGGGAATTGGG + Intronic
1067823744 10:49553880-49553902 AAGGGTGAAAGGTAGGAATGAGG + Intergenic
1067966055 10:50913875-50913897 CAGGGAGTGGGTTGGGAGTGAGG + Intergenic
1068097724 10:52512683-52512705 AAGGGGAAAGGGTGGGAATGGGG - Intergenic
1068514064 10:58004471-58004493 CAGCGTAGGGGTTGGGAATGGGG - Intergenic
1068637449 10:59362924-59362946 CTGGGGGTGGGGTGGGAGTGTGG - Intronic
1068667471 10:59692391-59692413 AAGTTTGAGGGGTGGAAATGGGG + Intronic
1068806993 10:61207733-61207755 CTGGGTGGGAGGAGGGAATGGGG + Intergenic
1068974043 10:62989167-62989189 CAGGGTGTGAGGTTGGAGTGTGG - Intergenic
1069593772 10:69657410-69657432 CAGGGAGGGGGGTGAGCATGTGG - Intergenic
1069751571 10:70748518-70748540 CAGGGTGAGGGTGGGGAAGAGGG - Intronic
1069778709 10:70941682-70941704 CTGTGTGAGGGGTGGGGAGGAGG + Intergenic
1069805378 10:71119309-71119331 GAGGGTGAAGGGTGGGAGTAGGG - Intergenic
1069832054 10:71287521-71287543 CAGGGTGAGGGACGGGTTTGGGG + Intronic
1069873619 10:71548135-71548157 CAGCGGGAGGGCTGGGATTGGGG + Intronic
1069879126 10:71580851-71580873 CAGAGAAAGGGGTAGGAATGGGG - Intronic
1069957490 10:72060965-72060987 CTGGGTGAGTGGTGGGTGTGGGG - Exonic
1070710263 10:78676326-78676348 CAGGGTTGGGGGTGGGATTCTGG - Intergenic
1071312068 10:84352378-84352400 CAAGGTGAGGTGTGGGAACAGGG + Intronic
1071353159 10:84767076-84767098 CAGGGTGTGCGATGGGGATGTGG + Intergenic
1071550305 10:86561408-86561430 CAGGGTGGGGGGTGGGGGGGCGG + Intergenic
1071940488 10:90586331-90586353 AAAGGAGAGGAGTGGGAATGTGG - Intergenic
1072022221 10:91413417-91413439 TAGGGTGAGATGTAGGAATGAGG - Intronic
1072806083 10:98424729-98424751 GAGGGTATGGGGTGGGCATGGGG + Intronic
1073619587 10:105032894-105032916 TAGAGGGTGGGGTGGGAATGTGG + Intronic
1073847307 10:107571831-107571853 CAGGGGTAAGGGTGGGAAGGGGG + Intergenic
1073877194 10:107938547-107938569 CAGGGAGAAGGGAGGGAAGGGGG - Intergenic
1074013116 10:109504610-109504632 CAGGATGAGGAGTTGGATTGTGG - Intergenic
1074203467 10:111259995-111260017 CAAGCTGGGGGGTGGGAGTGGGG - Intergenic
1074296245 10:112192092-112192114 CAGGGTAAGGGGTAGGAGGGTGG + Intronic
1074543208 10:114383373-114383395 AAGGGTGAAGGGAGGGAAGGAGG + Intronic
1074600218 10:114906598-114906620 CAGGGTGAGGGGTGACAAACAGG - Intergenic
1074925906 10:118070462-118070484 GAGGGTTATGGGAGGGAATGTGG + Intergenic
1075126810 10:119707016-119707038 TAGGGGGAGGGGCGGGAAGGAGG + Intergenic
1075133209 10:119758298-119758320 CAGGGCCAGGGGTGGGAGCGGGG + Intronic
1075411409 10:122231285-122231307 TGGGGTGAGGGGTGGGAACGAGG - Intronic
1075651631 10:124131309-124131331 CTGGGAGAGGGGATGGAATGCGG - Intergenic
1075999873 10:126905787-126905809 GAGGGGGTGGGGTGGGAATGGGG + Intronic
1076212949 10:128664945-128664967 GAGGCTGGGGGATGGGAATGGGG + Intergenic
1076293545 10:129366193-129366215 CAGGGAAAGGGGTGGGACTAAGG + Intergenic
1076405446 10:130209281-130209303 CAGAGTGAGGGGTTGAACTGTGG + Intergenic
1076591254 10:131585093-131585115 CAGGGTGAGGACAGGAAATGTGG - Intergenic
1077179639 11:1206659-1206681 CAGGGAGTGGGGTGAGATTGCGG - Intergenic
1077290251 11:1786171-1786193 CAGGGTTGGGGGTGGGGAAGAGG - Intergenic
1077317438 11:1925687-1925709 CAGAGTGAGGGGAGAGAAGGCGG + Intronic
1077325127 11:1960465-1960487 CAGGCGGAGGGGTGGAAATATGG - Intronic
1077325552 11:1962468-1962490 CAGGCGGAGGGGTGGAAATGTGG - Intronic
1077392068 11:2304777-2304799 CATGGGGAGGAGTAGGAATGAGG - Intronic
1077503077 11:2917925-2917947 CCGGGCGAGGGGTGGGCATTGGG + Intronic
1077543808 11:3160147-3160169 CAGGGGGTGGGGTGGGGGTGAGG + Intronic
1077886268 11:6390324-6390346 CAGGGAGAGGGGGCGGAATCGGG + Intergenic
1077975795 11:7247247-7247269 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1078788300 11:14518687-14518709 CAGGGTAGGGGGTGGCAGTGGGG - Intronic
1079095817 11:17509544-17509566 GCGGGGGAGGGATGGGAATGGGG + Exonic
1079111513 11:17607791-17607813 CAGGGTGAGGGGAGGCACTGGGG - Intronic
1079124347 11:17708240-17708262 CAGTGGGTGGGGTGGGGATGAGG - Intergenic
1079146385 11:17856077-17856099 GTGGGTTAGGGGTGGGGATGTGG - Intronic
1079559204 11:21801874-21801896 CAGGGGCAGGGGTGGTAATTTGG + Intergenic
1080130369 11:28787516-28787538 CCTGTTGAGGGGTGGGAGTGAGG - Intergenic
1080563452 11:33485774-33485796 CTGGGGTTGGGGTGGGAATGGGG - Intergenic
1080586949 11:33691105-33691127 CAGGATGGGGGCTGGGAGTGGGG - Intergenic
1080649251 11:34209658-34209680 GAGGGTGAGGGGTAGGGGTGAGG + Intronic
1080767037 11:35306681-35306703 AAGGGTGAGTGGGGGGAAAGGGG - Intronic
1080892772 11:36423875-36423897 CACTGTGAGGGGCGAGAATGAGG + Intronic
1081660889 11:44887771-44887793 CTGGGGTAGGGCTGGGAATGAGG + Intronic
1081693004 11:45090789-45090811 CAGGGTAGGGAGTGTGAATGAGG + Intergenic
1081846765 11:46246364-46246386 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
1081868451 11:46372345-46372367 GAGGGAGAGGGGTGTGACTGTGG - Intronic
1082651574 11:55800332-55800354 CAGGGTGAAGGTTGGGAAGAGGG + Intergenic
1082768156 11:57184780-57184802 CAGGATGCAGGGTGGGAACGTGG - Intronic
1082921314 11:58497705-58497727 GAGGGTGAAGGGTGAGAAGGAGG + Intergenic
1082965968 11:58966477-58966499 CAGTGTGTGGAGTGGGAATCAGG - Intronic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083106730 11:60365466-60365488 CAGAGTCAGGGGCAGGAATGAGG - Intronic
1083386592 11:62315255-62315277 CAGGGTGAGGGGCTGGACTTCGG + Intergenic
1083432490 11:62621595-62621617 GAGGGAGAGGGGTGGAAATGGGG + Intronic
1083612642 11:64011425-64011447 CAGGGTGAGGGGATGGGATGTGG + Intronic
1083619094 11:64040251-64040273 CCTGCTGAGGGGTGGGATTGAGG + Intronic
1083638042 11:64130748-64130770 CAGGGTGGCGGGTGGGGAGGTGG - Intronic
1083762100 11:64824281-64824303 CAGGATGAGGGCTGGGAGTCAGG + Exonic
1083994735 11:66266353-66266375 CAGGGAGAAGGGTGGGGCTGGGG - Intronic
1084092707 11:66889141-66889163 CAGGGTGAAGGGAGGGAAAGTGG + Intronic
1084416936 11:69037880-69037902 TAGGGGGAGGGTAGGGAATGGGG + Intergenic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1084859157 11:72006914-72006936 CAGGGTGAAGGGAGAGAACGTGG - Intronic
1084861034 11:72018344-72018366 CTGGGTGAGGGGAGGGGCTGGGG + Intronic
1085020227 11:73202073-73202095 CAGGGGAAGGGGTGGGGATGAGG - Intergenic
1085026570 11:73239953-73239975 CAGAGTGAGGGGTGTGCTTGTGG + Intergenic
1085085751 11:73665574-73665596 CAGTGTGATGGGTGGAAACGGGG + Intergenic
1085259357 11:75195529-75195551 CAGGGTGTGGAGTGGGGAAGTGG - Intronic
1085460006 11:76687883-76687905 CAGGGTGAGGGCTGGGAGCTGGG + Intergenic
1086500614 11:87449290-87449312 AGGGGAGAGGGGAGGGAATGAGG + Intergenic
1086937626 11:92762396-92762418 CAGGCTGTGGCCTGGGAATGGGG - Intronic
1087017484 11:93567950-93567972 GTGGGTGAGGGATGGGACTGAGG - Intergenic
1087091990 11:94283177-94283199 CTGGGTTAGGGGAGGGAATGTGG - Intergenic
1087129937 11:94660026-94660048 CAGGGTCAGGGGAGGGAGTCGGG - Intergenic
1087449405 11:98299411-98299433 AAGGGGGAAGAGTGGGAATGGGG - Intergenic
1087641413 11:100759159-100759181 CAGGGTGATGGGGGTGAGTGGGG - Intronic
1088376590 11:109147836-109147858 AAGGGAGAGAGGTGGCAATGGGG + Intergenic
1088576816 11:111280111-111280133 CAGGGAGAGGTTGGGGAATGTGG - Intronic
1088723182 11:112612404-112612426 CAGGGTTGGGGGTGGGAGGGGGG + Intergenic
1088985948 11:114908415-114908437 AAGGGAGAGGGGTGGGGTTGGGG + Intergenic
1089279494 11:117363356-117363378 CAGGGTGAGGGGTGTGCAGAGGG - Intronic
1089302597 11:117507661-117507683 CAGGCTGAGGTGTGGGGCTGTGG - Intronic
1089350837 11:117820731-117820753 CAGGGGGAGGGGTGGGTCTAGGG + Intronic
1089576301 11:119446863-119446885 AAGGGTGAGGGCCTGGAATGGGG + Intergenic
1089653819 11:119932867-119932889 CAGGGTGAGGGATGGGGCAGGGG - Intergenic
1089809535 11:121120469-121120491 CAGGGAGAGGGCTGGGAAGCAGG + Intronic
1089984987 11:122804205-122804227 CTGGGTGAGAGGTGGGGATGGGG + Intronic
1090449295 11:126791844-126791866 GAGTGTGAGGTATGGGAATGTGG + Intronic
1090595614 11:128318191-128318213 CAGGGAGAAGGGTGGGAAGGGGG - Intergenic
1090745532 11:129702009-129702031 CAGGGTGGGGCTTGGGAATCTGG + Intergenic
1091111125 11:132969100-132969122 CAGGGGGAAGGGTGGGAGGGGGG - Intronic
1091132161 11:133155577-133155599 GAGGGTGTGGGCTGGGTATGCGG - Intronic
1091337913 11:134786280-134786302 CAGGGTAGGGGGTGGGAAGCAGG - Intergenic
1202808108 11_KI270721v1_random:15644-15666 CAGGCGGAGGGGTGGAAATATGG - Intergenic
1202808532 11_KI270721v1_random:17647-17669 CAGGCGGAGGGGTGGAAATATGG - Intergenic
1091787832 12:3253675-3253697 CAGGGTGACAGGTGGGAATTGGG + Intronic
1091875765 12:3931700-3931722 AAGGGTGAGGGGTGGGCTGGGGG - Intergenic
1091917012 12:4276999-4277021 GAGGGGGAGGGGCGGGAAGGAGG - Intronic
1091936988 12:4442214-4442236 CAGAGTGAGGGCTGGGGGTGGGG + Intronic
1092199357 12:6570512-6570534 CTGGGGGAGGGGAGGGAGTGAGG - Exonic
1092228440 12:6764142-6764164 CAGGGCTGGGGGTGGGAATGAGG - Intronic
1092488272 12:8921704-8921726 CTGGTTGAGGGGTGGGGAGGTGG - Exonic
1092878940 12:12872862-12872884 CAGGGTGACTGCTGGGACTGTGG + Intergenic
1092917804 12:13203906-13203928 CAAGGTGTGGGTTGGGAGTGGGG - Intronic
1093286789 12:17273572-17273594 CAGGGTAAGTGGAGAGAATGGGG - Intergenic
1093801353 12:23376351-23376373 CGTGGATAGGGGTGGGAATGAGG - Intergenic
1094404458 12:30100473-30100495 CAGGGTTAGGGATGGGATTGAGG - Intergenic
1095613791 12:44164354-44164376 CAGGGGAAGGGGTGGGATGGTGG - Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095944880 12:47748161-47748183 CAGGGTGAGGGGATGGGAGGAGG + Intronic
1095969646 12:47892710-47892732 CGGGTTGGGGGGTGGGGATGGGG + Intronic
1096114393 12:49046815-49046837 CAGGGTGTGAGGTGGAAAAGAGG + Intronic
1096124593 12:49110217-49110239 CTGGGTGAGGGGTGGGAGGGAGG + Intronic
1096183356 12:49563413-49563435 AAGGCTGAGGGCTGGGAAGGTGG - Intronic
1096344806 12:50836438-50836460 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1096393698 12:51249174-51249196 TAGGGTGAGGTGTGGGGAGGGGG - Intronic
1096439957 12:51632912-51632934 CACAGTGAGGGGTGGGAAGGGGG - Intronic
1096499420 12:52055976-52055998 CAGAGTGTGGGGTGGGGAGGGGG - Intronic
1096524553 12:52202766-52202788 CAGGGGGAGGGGTGGGATGAGGG + Intergenic
1096867449 12:54573245-54573267 CCAAGTGAGGGGTGGGGATGTGG + Exonic
1096946589 12:55414305-55414327 CTGGTTGAGGGGTGGGGAGGTGG + Intergenic
1097071748 12:56360218-56360240 CGGGGTGGCGGCTGGGAATGGGG - Intergenic
1097198382 12:57257659-57257681 AAGTCTGAGGGCTGGGAATGTGG - Intronic
1097261826 12:57724879-57724901 CATGGAGAGGGGTGGGAAGATGG - Intronic
1097288010 12:57892510-57892532 GAGGGTGAGAGGTGGGAAGCAGG + Intergenic
1097612174 12:61837740-61837762 CAGGGGGTGGGGTAGGAGTGCGG + Intronic
1098199394 12:68038899-68038921 TAGGGAGGGGGGTGGAAATGAGG - Intergenic
1099015949 12:77344407-77344429 CAGGGACAGGGGAGGTAATGAGG - Intergenic
1099042438 12:77672676-77672698 CAGGGGAAAGGGTGGGAGTGGGG + Intergenic
1099395345 12:82131713-82131735 GAGGGTGAGGGGTGGGAGGAAGG + Intergenic
1100329197 12:93569781-93569803 AAGGGGGAGGGGTGGGAGGGAGG - Intergenic
1100691559 12:97043748-97043770 CAGAGGGAAGGGTGGGAGTGGGG + Intergenic
1101152985 12:101901160-101901182 GAGGGACAGGGGTGGGAAAGTGG + Intronic
1101193228 12:102356238-102356260 AAAGCAGAGGGGTGGGAATGAGG - Intergenic
1101448572 12:104755931-104755953 AAGGGTGAGGAGTAGGAATCAGG + Intronic
1101591760 12:106131137-106131159 CAGGGTGGAGAGTGGGAAAGGGG - Intronic
1102037861 12:109782519-109782541 CAGGGTGCTGGGTGTGCATGCGG - Intergenic
1102037968 12:109782971-109782993 CAGGGGCAGGGGTGAGAGTGAGG - Intergenic
1102053542 12:109880121-109880143 TAGGGTGAGTGGAGGGAAAGAGG + Intronic
1102205508 12:111088111-111088133 CAGGGAATGGAGTGGGAATGGGG + Intronic
1102222274 12:111202517-111202539 GGGGGTGACGGGTGGGATTGGGG + Intronic
1102477121 12:113195891-113195913 TGGGGTGAGGGGTGGGGCTGGGG + Intronic
1102518818 12:113466722-113466744 TAGTGTGAGGGGAGGGGATGGGG - Intronic
1102627555 12:114247523-114247545 CAGGTTCAGGGCTGGGGATGGGG + Intergenic
1102733018 12:115131155-115131177 CAGGGGAAAGGGTGGGAAGGAGG - Intergenic
1102784508 12:115593377-115593399 CAGGGGAAAGGGTGGGAAGGTGG - Intergenic
1102913676 12:116737566-116737588 CAGGGAGAGGGGAAGGAAGGAGG + Intronic
1103023466 12:117555100-117555122 CTGGGTGAGGGGTAGGAGGGAGG - Intronic
1103248784 12:119481748-119481770 AAGGGAAAGGGGTGGGAAGGAGG - Intronic
1103425576 12:120830508-120830530 GAGGGGGAGGGGTGGGGAGGGGG + Intronic
1103458229 12:121084021-121084043 CAGGGTGTGTGGAGAGAATGGGG + Intergenic
1103553361 12:121751398-121751420 TAGGGTGTGGGGTGAGAGTGGGG - Intronic
1103691778 12:122780914-122780936 CAGGGTCATGGTTGGGAACGCGG + Intronic
1104307037 12:127618939-127618961 GAGGGTGGAGGGTGGGAGTGGGG + Intergenic
1104647119 12:130505523-130505545 GGGGGTGGGGGGTGGGGATGAGG - Intronic
1104647213 12:130505753-130505775 GGGGGTGGGGGGTGGGGATGAGG - Intronic
1104647240 12:130505812-130505834 GGGGGTGGGGGGTGGGGATGAGG - Intronic
1104918362 12:132278050-132278072 CAGAGAGAGGGGTTAGAATGGGG - Intronic
1104971005 12:132530708-132530730 CGGGGTGGGGGGTGGGGCTGGGG + Intronic
1104988627 12:132611578-132611600 GACGCTGAGGGGTGTGAATGTGG + Intergenic
1105307996 13:19182317-19182339 CCGGGTGCTGGGTGGGAAGGTGG - Intronic
1105720605 13:23110185-23110207 TAGGGGGAAGGGTGGGAGTGGGG - Intergenic
1105811584 13:24000823-24000845 CTGGGTGAGAGGTGTGAATTTGG + Intronic
1105929914 13:25042616-25042638 CATGGTGAGGGGTGGAGTTGCGG - Intergenic
1106248401 13:27967057-27967079 CGGGGTGAGGGCCGGGAAGGGGG - Intronic
1106356635 13:28989704-28989726 CAGTATGAGGGGTGAGGATGGGG + Intronic
1106415624 13:29543696-29543718 GAGGGAGAGGGGTGGGGAGGAGG + Intronic
1107251802 13:38372623-38372645 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1107272342 13:38634833-38634855 GAGGGTAGGGGGTGGAAATGTGG - Intergenic
1107396517 13:40023556-40023578 CATGGGGTAGGGTGGGAATGGGG + Intergenic
1107671658 13:42752637-42752659 CAGGCTAAAGGGTGGGAATGTGG - Intergenic
1107993498 13:45838894-45838916 CAGGGTGAGAGGTGGGCTTCTGG - Intronic
1108151299 13:47537521-47537543 CAGGGAGAAGGGTGGGAGGGAGG + Intergenic
1110544768 13:76744129-76744151 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1110851055 13:80245451-80245473 GATGGTGGGGGGAGGGAATGGGG - Intergenic
1111457312 13:88502122-88502144 CAGGGTGGGGGGTGGGAGGAGGG - Intergenic
1111679205 13:91423575-91423597 GGGGGTGTGGGGTGTGAATGTGG + Intronic
1112265553 13:97920233-97920255 TGGGGTGAGCGGTGGGAGTGGGG - Intergenic
1112508379 13:99988964-99988986 CAGGGATAGGGGTGGGGTTGGGG - Intergenic
1112690260 13:101885342-101885364 CAGGGTGGAGGGTGGGAGGGAGG + Intronic
1113002094 13:105652244-105652266 CTGGGGGAAGGGGGGGAATGAGG + Intergenic
1113170007 13:107490561-107490583 TAGGGTGATGGGTGGGAAAAGGG + Intronic
1113424388 13:110195973-110195995 CAGGGTGTGGAGTGGGGCTGTGG + Intronic
1113458268 13:110464262-110464284 CAGGGTTAGGGGTAGGGGTGAGG + Intronic
1113493926 13:110713583-110713605 GACGGTGAGGGGCGTGAATGCGG + Intronic
1113663987 13:112128236-112128258 CACGGCGAAGGGTGGGCATGTGG - Intergenic
1113987131 13:114326997-114327019 GTGGGTGGGGGGTGGGGATGGGG - Exonic
1114454825 14:22847625-22847647 CATGGGGAGGGGTGGGGGTGGGG + Exonic
1114477872 14:23010340-23010362 AAGGGAGAGAGGTGGGAAAGGGG - Intergenic
1115776815 14:36724387-36724409 CAGGAAGTGGGGTGGGAGTGAGG + Intronic
1116767163 14:49086759-49086781 AAGGGTGGTGGGTGGGGATGAGG - Intergenic
1117192712 14:53308935-53308957 CAGGGTGAAGCGTGGGAGGGGGG - Intergenic
1118768932 14:68928950-68928972 CTGGGAGAGGGGTGGAACTGTGG + Intronic
1118768940 14:68928980-68929002 CTGGGAGAGGGGTGGAACTGTGG + Intronic
1119126063 14:72127827-72127849 AGGGGTCAGGGATGGGAATGAGG - Intronic
1119319593 14:73721758-73721780 CAGGAGGATGGGTGGCAATGGGG - Intronic
1120035587 14:79693760-79693782 CAAGTTGAGGGGTTGGGATGGGG + Intronic
1121235140 14:92386618-92386640 TAGGGTGAGAGGAGAGAATGAGG - Intronic
1121472656 14:94167284-94167306 CAGGGTTTGGGGTGGGAAGGAGG + Intronic
1121544996 14:94756647-94756669 CAGGGTGTGGGGTGGGGAGGCGG - Intergenic
1121774710 14:96583094-96583116 CAGGGTGAGGGGGTGGTTTGAGG - Intergenic
1121917711 14:97851442-97851464 CAGGGTGGGGGTGGGGAGTGAGG - Intergenic
1122125042 14:99574423-99574445 GAGGGTGAGGGGAGCGTATGGGG - Intronic
1122742917 14:103882148-103882170 CGGGGTGCGGGGGGGGTATGAGG - Intergenic
1122774770 14:104112272-104112294 CAGGGGCAGGGGTGGGTAAGGGG - Intronic
1122821919 14:104351445-104351467 CAGGGGCAGGAGTGGGTATGGGG - Intergenic
1122882539 14:104696571-104696593 GAGTGTGAGGGAGGGGAATGGGG + Intronic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123031058 14:105451266-105451288 CAGGCTGTGTGGTGGGAATGGGG - Intronic
1202871903 14_GL000225v1_random:172701-172723 TGGGGTGAGGGTTGGTAATGAGG + Intergenic
1124003830 15:25780528-25780550 CAGGGTGAGGGGTGAGAGGCTGG - Intronic
1124567129 15:30826625-30826647 CAGTGGGAGGGGCGGGAATCAGG - Intergenic
1124621932 15:31278851-31278873 CAGTGGGTGGGGTGGGCATGAGG + Intergenic
1124636879 15:31371217-31371239 CCGAGTGAGGGATGGGAAGGAGG + Intronic
1124998238 15:34745087-34745109 CAGGGTGATGGTTGGGGATTTGG - Intergenic
1125378306 15:39058113-39058135 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1125404109 15:39335204-39335226 GAGGAAGAGTGGTGGGAATGAGG - Intergenic
1126676264 15:51161494-51161516 CAGTGTGAGTTGTGGGACTGAGG - Intergenic
1126681727 15:51208746-51208768 AAGGGTGGGGGGTGGGAGTGAGG - Exonic
1127385304 15:58462001-58462023 CTGTGTGATGGGTGGGACTGAGG - Intronic
1127585861 15:60377116-60377138 AAGGGTTAGAGGTGGGAGTGGGG + Intronic
1127761707 15:62146184-62146206 CAGGGTGAGGGTAGGGAAGGAGG - Intergenic
1127811640 15:62570213-62570235 GTGGGTGAGGCGGGGGAATGTGG - Intronic
1127825675 15:62700697-62700719 CAGGGTGCAGGGTGAGAAAGAGG - Intronic
1127963648 15:63908239-63908261 CAGAGTCTGGGGTGGGAGTGTGG - Exonic
1128095385 15:64950089-64950111 CAGGGCTAGGGGTAGGAATCTGG - Intronic
1128234192 15:66056280-66056302 CAGGGTGTGGGGTGGTAAAAAGG + Intronic
1128527386 15:68421700-68421722 CTGGGTGGGGGGTGGGGGTGAGG + Intronic
1128529452 15:68433741-68433763 CAGGGTCAGGGTAGGGAAGGAGG + Intergenic
1128674725 15:69600164-69600186 CAGGCAGAGGGGTGGGAGGGGGG + Intergenic
1128706108 15:69838432-69838454 CAGGGTTAGGGGTGGGAGCTGGG - Intergenic
1128865926 15:71115331-71115353 CGGGGTCAGGGGTGCGGATGGGG + Exonic
1129107512 15:73319814-73319836 CAGGGATAGGGGTGGGGGTGAGG - Intergenic
1129334040 15:74842002-74842024 CTGGGGGAGGGGTGGGATGGTGG + Intronic
1129643526 15:77408385-77408407 CAGGGGGAAGGGTGGGAGGGGGG + Intronic
1130092831 15:80835488-80835510 CAGGCTGAAGGGTGGCCATGCGG - Intronic
1130281999 15:82526145-82526167 GAGGGAGGGGGGTGGGAATCTGG - Intergenic
1130473366 15:84242308-84242330 GAGGGAGGGGGGTGGGAATCTGG - Intronic
1130480780 15:84356372-84356394 GAGGGAGGGGGGTGGGAATCTGG - Intergenic
1130490932 15:84431387-84431409 GAGGGAGGGGGGTGGGAATCTGG + Intergenic
1130502516 15:84510186-84510208 GAGGGAGGGGGGTGGGAATCTGG + Intergenic
1130553971 15:84910014-84910036 CAGGGTCAGGGGTAGGCAGGAGG - Intronic
1130674556 15:85940302-85940324 CAGGGTGAGGCCTGGGCATCAGG + Intergenic
1131050942 15:89347394-89347416 CGGGGGGAGGGGTGGGAGTGAGG - Intergenic
1131143101 15:89993513-89993535 GAGGGTGTAGGGTGGGAATGAGG - Intergenic
1131223939 15:90608269-90608291 GAAGGTGAGGGGTGGCACTGAGG - Intronic
1131229208 15:90647594-90647616 GAGGGGGAGGGGTGTGAAGGGGG - Intergenic
1131298027 15:91169421-91169443 CAGGGTGGGGGTGGGGGATGGGG - Intronic
1131357070 15:91754797-91754819 CAGGGTCAGGAGTGGCAAAGGGG - Intergenic
1131397990 15:92101953-92101975 CAGGGAGAGGGATGGCGATGGGG - Intronic
1131400700 15:92123467-92123489 CAGGGAGAGGGGTGGTAATCTGG - Intronic
1131541588 15:93279576-93279598 AGGGGTGAGGGGTGGGGGTGAGG - Intergenic
1132243462 15:100277374-100277396 CAGGGAGTGGGAAGGGAATGGGG - Intronic
1132482410 16:173089-173111 CAGAGTGAGGGGTGGGGTTTGGG - Intronic
1132483258 16:176893-176915 CAGAGTGAGGGGTGGGGTTTGGG - Intronic
1132490736 16:229232-229254 GAGGGTCTGGGGTGGGAGTGAGG - Intronic
1132862015 16:2076447-2076469 GACAGTGAGGGGTGGCAATGGGG - Intronic
1132877482 16:2146860-2146882 CAGGGGGAGGAGTGCGGATGGGG - Intronic
1133135990 16:3712467-3712489 CAGCTTGCGGGGTGGGGATGGGG - Intronic
1133548087 16:6827640-6827662 AAGGGTGAGGAGGGGGAAGGAGG - Intronic
1133591715 16:7251170-7251192 CAGGGGCTGGGGTGGGATTGGGG - Intronic
1133696251 16:8265826-8265848 AAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1133937391 16:10280188-10280210 GAGGGTTGGAGGTGGGAATGGGG + Intergenic
1134022497 16:10930746-10930768 AAGAGTGAGTGGAGGGAATGGGG - Exonic
1134276810 16:12783627-12783649 CAGTGTGATGGGTGGGAAAGTGG - Intronic
1135191408 16:20357735-20357757 CAGGGATGGGGGTGGGAAGGTGG + Intergenic
1135621215 16:23957644-23957666 TAAGGTGAGGGGTGGGGAGGAGG - Intronic
1135792776 16:25412947-25412969 CAGGGAGAGGGATGAGAATGTGG + Intergenic
1136247085 16:28982331-28982353 AGGGGTGAGGGAAGGGAATGGGG - Intronic
1136502194 16:30677509-30677531 GAGGGCGAGGGCTGGGAAAGCGG - Intergenic
1136517811 16:30778333-30778355 CTGGGTGAAGGGTGGGCCTGGGG + Intergenic
1137736633 16:50729307-50729329 CAGAGTGTGGGGAGGTAATGGGG + Intronic
1138042338 16:53685707-53685729 GAGGGTGAGGGGTGGGAGGAGGG + Intronic
1138185096 16:54970788-54970810 CAGTTTGAGGGGTGGGGTTGGGG + Intergenic
1138262805 16:55637365-55637387 CAGGGTGGGTGGTGGTGATGGGG + Intergenic
1138311091 16:56024591-56024613 CAGAGTGTGGTGTGTGAATGAGG - Intergenic
1138573420 16:57890897-57890919 CATGGGGGGGCGTGGGAATGGGG - Intronic
1138605831 16:58088222-58088244 GAGGGGGAAGGGTGGGAGTGGGG + Intergenic
1138667797 16:58586452-58586474 GAGGGTGAGGGGAGGGGAGGGGG + Intronic
1138673454 16:58633753-58633775 TAGGGAGAGGAGTGGGAATGAGG + Intergenic
1138948576 16:61882721-61882743 GAGGGTGAAGGGTGGGAAGAAGG + Intronic
1139227401 16:65246374-65246396 CAGGATGAGGTTTTGGAATGAGG + Intergenic
1139414392 16:66795564-66795586 GAGAGTGAGGTGTGGGACTGAGG + Intronic
1139640457 16:68287868-68287890 CAGGGTAAGTGGTGGGAAGGGGG + Exonic
1139917419 16:70437328-70437350 AAGGGGGAGGGCTGGGAAGGGGG + Intronic
1139949257 16:70661154-70661176 AAAGGTGAGGTGTGGGGATGGGG + Intergenic
1140058296 16:71545100-71545122 TAGGTTGAGGGTTGGGGATGGGG - Intronic
1140220888 16:73043043-73043065 CAGGAGTAGGGGTGGGAGTGCGG + Intronic
1140222901 16:73057479-73057501 CCGGGCGAGGGGTGAGAGTGGGG + Intronic
1140270960 16:73465926-73465948 GAGGGGGTGGGGTGGGAGTGGGG - Intergenic
1140416447 16:74777045-74777067 AGGGGTGAGGGGTGGGGTTGGGG + Intergenic
1140656474 16:77145479-77145501 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
1140829407 16:78737581-78737603 CAGGGAGAAGGGTGGGAGTAGGG - Intronic
1141747927 16:85938507-85938529 CAAGGAAAGGGGTGGGAAAGAGG - Intergenic
1141767184 16:86066417-86066439 CAGAGTGTGCGTTGGGAATGTGG + Intergenic
1141878463 16:86842265-86842287 CAGGGTGAGGGGTGGCACCCAGG + Intergenic
1141881812 16:86865312-86865334 CAGGGGGTTGGGTGGGAAGGCGG - Intergenic
1141896122 16:86959658-86959680 CTGGGTGAGGGGTGGGGATGGGG - Intergenic
1141930724 16:87200866-87200888 CAGGGAGAGGGGTGGGAGATGGG + Intronic
1142265542 16:89062572-89062594 CAGGGGCAGGGGAGGGAGTGAGG + Intergenic
1142501412 17:335262-335284 CAGGGTGAACAGTGGGAAGGAGG + Intronic
1142518125 17:446597-446619 CAGGGCGAGGGGTGGCAGTCTGG - Intergenic
1142562346 17:817898-817920 CTGGGTGAAGGCTGGGAAGGAGG + Intronic
1142594439 17:1022691-1022713 CAGGGTGAGGGCTGGAGAGGCGG - Intronic
1142735546 17:1896517-1896539 CAGGGAGTGGGGTGGGGCTGGGG + Intronic
1142805331 17:2368399-2368421 CATGGGAATGGGTGGGAATGGGG - Intronic
1143175786 17:4954103-4954125 TAGGGTGTGGGGTTGGAACGAGG - Intronic
1143203335 17:5127037-5127059 GTGGGTTTGGGGTGGGAATGGGG + Intronic
1143382144 17:6503234-6503256 CAGAGTGAGGGGTGGGAGGCTGG - Intronic
1143410817 17:6707358-6707380 AGGGAGGAGGGGTGGGAATGGGG - Intronic
1143517252 17:7426081-7426103 CATTGTCAGGGGTGGGGATGGGG - Intronic
1143542989 17:7580598-7580620 CTGAGTGAGGGGTGAGACTGAGG - Intronic
1143730767 17:8881433-8881455 CAGGGTGAGGGGTATGATTTGGG - Intronic
1143779234 17:9220781-9220803 CAGGGCGCGGGGTGACAATGAGG + Intronic
1144100485 17:11938102-11938124 CAGGGTGAGGTGTGGGTTTCAGG + Intronic
1144334272 17:14255155-14255177 CAGGCTGAGGGGTGGGTACAGGG - Intergenic
1144422282 17:15109734-15109756 TAGGCTGAGGGGTGGGGATTGGG - Intergenic
1145016447 17:19401743-19401765 CAGGGTGAGGGCTGGCAAGAAGG - Intergenic
1145365779 17:22265951-22265973 CAGGATGAAGGGAGGCAATGAGG + Intergenic
1146696389 17:34911751-34911773 CATTGTGATGGGTGGGAATGGGG + Intergenic
1147134703 17:38428332-38428354 CGGGGTGGGTGGTGGGAAGGGGG + Intergenic
1147166623 17:38596830-38596852 CAGGTTGAGGGTTGGGGGTGTGG - Intronic
1147182213 17:38693569-38693591 GTGGGTGTGGGGTGGGAAGGGGG + Intergenic
1147241088 17:39091018-39091040 CAGGATGACGGGTGGGAACAGGG - Intronic
1147387089 17:40089127-40089149 GAGGGTGAGGTGTGGGGACGTGG - Intronic
1147977289 17:44255141-44255163 CATGCTGGGGGGTGGAAATGAGG + Intronic
1148086257 17:44995498-44995520 GAGGCTGAGAGGTGGGAAGGGGG + Intergenic
1148088669 17:45009622-45009644 CATGGTGAGGGGTGGGCAGAGGG - Intergenic
1148454893 17:47805890-47805912 CAGGTGGTGGGGTGGGAGTGGGG + Intergenic
1148457694 17:47819915-47819937 TGGGGGGCGGGGTGGGAATGGGG - Intronic
1148547393 17:48528704-48528726 CAGGGGTAGGGGTGGAGATGGGG + Exonic
1148603443 17:48910565-48910587 CAGGGGGAGGGGAGGGAGAGAGG - Intronic
1148684637 17:49494818-49494840 GAAGGGGAGGGGTGGGGATGGGG + Intergenic
1148908438 17:50926564-50926586 CAGGATGTGGGCTGGGAAGGAGG + Intergenic
1148986046 17:51622220-51622242 AAGGGTTGGGGGAGGGAATGTGG + Intergenic
1148996164 17:51711834-51711856 CTGGGGGTGAGGTGGGAATGTGG + Intronic
1149497782 17:57131204-57131226 CTGGGTGCGGGGTGGGGGTGGGG - Intergenic
1149602576 17:57902947-57902969 CATGGTGAGGGGTTGGAGTGTGG - Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1150070668 17:62147540-62147562 GGGGGTGCGGGGGGGGAATGGGG - Intergenic
1150558612 17:66275995-66276017 CAGGAGGACGGGTGGGACTGGGG - Intergenic
1150580405 17:66468711-66468733 GAGGGTGGAGGGTGGGAAAGTGG + Intronic
1151221308 17:72615146-72615168 CAGGGTGATGGGAGGGAGGGAGG - Intergenic
1151322442 17:73360005-73360027 CAGGCTGAGAGGTGGGGAGGTGG - Intronic
1151508273 17:74543275-74543297 CAGGGTGACCTGGGGGAATGGGG + Intronic
1151511211 17:74561402-74561424 CAGGTAGAGGGCTGGGAAGGTGG - Intergenic
1151538801 17:74753734-74753756 CAGGGGGAGGGGGGTGAATGGGG + Intronic
1151540880 17:74764038-74764060 CAGGGTGATGGTGGGGGATGGGG - Intronic
1152008032 17:77694721-77694743 CAGGGAGTGGGGAGGGAAGGAGG - Intergenic
1152238415 17:79150023-79150045 GAGGGTGGGGGGTGGGGGTGGGG + Intronic
1152242576 17:79168025-79168047 CTGGGTGAGGGGTGGGTAACTGG + Intronic
1152280121 17:79380188-79380210 CTGGGGGAGGGGTGGCAAGGGGG - Intronic
1152334646 17:79693495-79693517 CAGGGTGAGGGGTGCACATGTGG + Intergenic
1152405659 17:80096565-80096587 GGAGGTGAGGGGTGGGCATGGGG - Intronic
1152573559 17:81130738-81130760 CAGGGACAGGGGTGGGCACGGGG - Intronic
1152585206 17:81186220-81186242 CTGGGAGTGGGGTGGGAAGGGGG - Intergenic
1152635349 17:81428576-81428598 CAGGGTGGGTGGAGGGAGTGGGG - Intronic
1153682264 18:7511838-7511860 GATGGAGATGGGTGGGAATGAGG + Intergenic
1154031354 18:10756631-10756653 GAGGAGGAGGGGTGGGGATGAGG + Intronic
1154935744 18:21054534-21054556 CAGATTTAGGGGTGGGGATGTGG - Intronic
1155185981 18:23386863-23386885 CAAGGTGAGGGGGGAGAATGAGG + Intronic
1155229290 18:23757400-23757422 AAGGGTTAGAGGTGGGAATCCGG - Intronic
1155339390 18:24798832-24798854 GAGGGAGAGGGGTGGGAATGAGG - Intergenic
1155451088 18:25963645-25963667 GTGGGTTTGGGGTGGGAATGGGG - Intergenic
1155498019 18:26461566-26461588 CAGCCTGAGGGGTAGGAGTGGGG + Intronic
1156445332 18:37232490-37232512 CAGGGGCAGGTGTGGGAGTGAGG + Intergenic
1156469302 18:37367443-37367465 CTGGGGCAGGGGTGGGGATGGGG + Intronic
1156470725 18:37375881-37375903 CATGGGGAGGGGCTGGAATGGGG - Intronic
1156504532 18:37581013-37581035 CAGGGTGAGTGGTGAGGATCCGG - Intergenic
1156505937 18:37592853-37592875 CAGGGTGAGGTATGGCAGTGAGG - Intergenic
1156526881 18:37776159-37776181 CAGGCAGAGAGGTGGGAAGGAGG + Intergenic
1156640349 18:39088000-39088022 CAGGGGGTGGGGTAGGAGTGGGG + Intergenic
1156766445 18:40662614-40662636 CAGGGCGTGTGGTGGGGATGTGG + Intergenic
1156840256 18:41602563-41602585 CAGGATGAGGGATAGCAATGAGG + Intergenic
1157055211 18:44219922-44219944 CAGGGTAAAGGGTGGGAGTGAGG + Intergenic
1157190937 18:45581046-45581068 CATGGGGAAGGGAGGGAATGTGG + Intronic
1157776784 18:50402256-50402278 CGGGGTAAGGGATGGGGATGAGG - Intergenic
1157791472 18:50535517-50535539 GAGGGTGGGGAGTGAGAATGGGG - Intergenic
1157867353 18:51197759-51197781 GAGGGTGGGGGGTGGGGCTGGGG - Intronic
1158126921 18:54110412-54110434 GAGGGTGAAGGGTGGGAGGGGGG - Intergenic
1158543768 18:58378858-58378880 CAGGGAGATGTGTGGGAATCGGG + Intronic
1159300661 18:66562124-66562146 CAGGGTGGGGAGTGGGCATGGGG + Intronic
1159946341 18:74447092-74447114 CAGGCTGAGGGGCGGGAAGCTGG + Exonic
1160227286 18:77020806-77020828 CGGGGTGTGGTCTGGGAATGCGG - Intronic
1160325328 18:77941686-77941708 GAGGGTGAGGGGTGGGGAGGTGG - Intergenic
1160710436 19:548831-548853 CGGGGGGAGGGGTGGCAGTGGGG - Intronic
1160988426 19:1850872-1850894 CAGGGTGAGGAGGGGGAGAGAGG + Intergenic
1161004924 19:1930292-1930314 CAGGGTGAGGGGCAGCAACGCGG - Intergenic
1161026578 19:2039949-2039971 CAGGGTGGGGGCTGGGAGGGGGG - Intronic
1161088083 19:2344231-2344253 CAGGGTGATGGGGGGTGATGGGG - Intronic
1161281778 19:3449424-3449446 CAGTGTCTGGGGTTGGAATGGGG - Intronic
1161335165 19:3709036-3709058 CAGGGTGAGGGGTTGGGGGGCGG - Intronic
1161358585 19:3833629-3833651 CAGGGTCGGGGCTGGGAACGAGG - Intronic
1161483678 19:4523629-4523651 CAGGGACGGGAGTGGGAATGGGG - Exonic
1161588149 19:5116726-5116748 CAGGGTGGGGGCAGGGAATGCGG + Intronic
1161589323 19:5121966-5121988 CAGGGGGAGGGAGGGGACTGAGG - Intronic
1161630806 19:5354508-5354530 CAGAGTGAGGAGTGGGAAAGAGG + Intergenic
1161837803 19:6659812-6659834 CGGGGTAAGGGATGGGGATGAGG + Intergenic
1161930519 19:7336608-7336630 AAGGGGGAGGGCTGGGAAGGAGG - Intergenic
1162017366 19:7852900-7852922 GAGCGTGAGGGGAGGGAATGGGG - Intronic
1162042337 19:7978374-7978396 CAGGGTGGGGGAGGGGAAAGGGG + Intronic
1162386039 19:10361262-10361284 CAGGGTGGGGGTTGAGACTGAGG + Intronic
1162800113 19:13105468-13105490 CAGGGTGAGTGGTGGTAAGGTGG - Exonic
1162926830 19:13934460-13934482 CAGGGTGTGGTGCGGGAGTGGGG - Intronic
1163026037 19:14512918-14512940 CAGTGTGAGGAGTGGGACGGTGG - Intergenic
1163047921 19:14658597-14658619 CAGGCAGAGGGGTGGGCAGGTGG + Intronic
1163159965 19:15458477-15458499 AAGGGTGGGAGGTGGGACTGAGG + Intronic
1163318146 19:16555469-16555491 CAGGGTTAGGGGAAGGGATGTGG + Intronic
1163520274 19:17787907-17787929 CGGGGTGTGGGGAGGGATTGGGG + Intronic
1163520379 19:17788243-17788265 GAGGGGGAGGGGTGGGGAGGAGG - Intronic
1163598081 19:18231974-18231996 CAGGGTGGGGTGAGGGAGTGGGG + Intronic
1163683864 19:18699748-18699770 CAGGGTGAGGGGTTGAGATCTGG + Intronic
1163790899 19:19305658-19305680 GAGGGTGAGGGGCGGGGCTGGGG - Intronic
1163795813 19:19337492-19337514 AGGGGTGAGTGGTGGGAGTGCGG + Intronic
1163831224 19:19548020-19548042 CCTGGGGAGGGGTGGGAATGGGG + Intergenic
1163928040 19:20363892-20363914 CAGGGTAAGGGGCAGGGATGAGG - Intergenic
1164108060 19:22126125-22126147 CAGGCTGAGGGCTGGTACTGGGG - Intergenic
1164147351 19:22520084-22520106 GAGTGTGAGAGGTGGGAAAGAGG - Intronic
1164159247 19:22616026-22616048 GAGTGTGAGAGGTGGGAAAGAGG + Intergenic
1164645435 19:29855706-29855728 CAGGCAGAGGGGAGGGAGTGGGG - Intergenic
1164838558 19:31375044-31375066 CAGGCTCAGGGGTGGGAACCTGG - Intergenic
1165062255 19:33210688-33210710 CAGGGTGGGGGTTGGGGGTGGGG - Intronic
1165073982 19:33270579-33270601 CAGGGTGAGGTGGGGCATTGAGG - Intergenic
1165253545 19:34559066-34559088 CAGGGTAAAGGATGGGAATGAGG + Intergenic
1165561023 19:36679814-36679836 AAGGTTGGGGGGTGGGGATGTGG + Intergenic
1165792457 19:38500322-38500344 CAGGGAGAGGGGTCAGGATGGGG + Intronic
1165792480 19:38500388-38500410 CAGGGAGAGGGGTCAGGATGAGG + Intronic
1165843209 19:38801914-38801936 CAGGGAGAAGGGTGGGCATGAGG + Intronic
1165879291 19:39031563-39031585 CTGTGGGAGGGGTGGGAGTGGGG - Intronic
1166047693 19:40238991-40239013 CAGGGTGGGAGGTGGGAGGGAGG + Intronic
1166104184 19:40589472-40589494 GAGGGGGAGGGGTGGGATGGGGG + Intronic
1166607958 19:44162247-44162269 CAAGGTGAGGTGGGGGGATGGGG - Intergenic
1166643386 19:44513135-44513157 CAGGGAGGGGGATGGGGATGGGG - Intronic
1166688445 19:44809439-44809461 CAGGGTGCTGAGTGGGAAGGGGG - Intronic
1166772807 19:45294471-45294493 CAGGGTGAGGGGTGGGAAGTAGG + Intronic
1166775318 19:45308582-45308604 TTGGGGGAGGGCTGGGAATGGGG - Intronic
1166783017 19:45352115-45352137 CAGGCTGAGGGTGGGGAGTGGGG + Intronic
1166798943 19:45444257-45444279 CTGGGGGAGGGGGGGAAATGGGG - Intronic
1166930592 19:46299062-46299084 CAGGGTGAGGCCTGAGAATGGGG - Intronic
1167088062 19:47324141-47324163 CAGGGCGTGGGGCGGGAAGGAGG - Intergenic
1167114381 19:47480257-47480279 CGGGGTAAGGGGTGGGGTTGAGG - Intronic
1167158734 19:47754670-47754692 CAGTGTCAGGGGTGGGTAGGAGG - Intronic
1167243241 19:48357926-48357948 CAGGGAGGGGGGTTGGGATGGGG + Intronic
1167250124 19:48394958-48394980 CAGGGATGGTGGTGGGAATGTGG + Intronic
1167590885 19:50403594-50403616 CAAGGTGAGGGCTGGGCAGGTGG + Exonic
1167603544 19:50467903-50467925 CAGAGGGAGGGGTGGCAAGGTGG - Intronic
1168011000 19:53532238-53532260 CTGGGACAGGGGTGGGAATAGGG - Intronic
1168277495 19:55285605-55285627 CAGGATGGAGGGTGGGAAGGTGG + Intronic
1168318453 19:55494420-55494442 TGGGGAGAGGGGTGTGAATGCGG - Intronic
1168371603 19:55839121-55839143 GTGGGTGAGGGGTGGGAAAGGGG - Intronic
1168460117 19:56547649-56547671 TAGGGTGAGGGGTGGGAAAAGGG - Intronic
1168503886 19:56916586-56916608 CAGGGGGAGGAGTTGGAAAGAGG + Intergenic
925423067 2:3727179-3727201 CAGGGGGAGGGGAGGGGAGGAGG - Intronic
925961721 2:9023399-9023421 CAGGGAGAAGGGTGGGAGGGGGG + Intergenic
926104558 2:10142159-10142181 CAGAGTGAGGGGTGGGAGATGGG + Intronic
926409171 2:12583780-12583802 CAGGGAGAGGGGTATGAAAGGGG + Intergenic
926634531 2:15165679-15165701 CAGGGGGAGGTGTGGAGATGAGG + Intergenic
926696020 2:15770662-15770684 CTGGGTGAGGCGAGGGGATGTGG + Intergenic
926705429 2:15834259-15834281 AGGTGGGAGGGGTGGGAATGAGG - Intergenic
926915475 2:17887262-17887284 CAGGGGGAAGAGTGGGAGTGGGG - Intronic
927215017 2:20663531-20663553 AAGGGTCTGGGGCGGGAATGTGG + Intergenic
927871618 2:26627758-26627780 AAGGGTGAGGGGTGGGTAGGTGG - Intronic
927907372 2:26869459-26869481 TAGGGCTGGGGGTGGGAATGGGG - Intronic
927929026 2:27032419-27032441 GAGGCTGAGGGGTGGGGGTGGGG + Intergenic
928101663 2:28440863-28440885 CAGGGTGTGGGGTGGGGATGGGG + Intergenic
928135299 2:28683260-28683282 CAGGGAGAGAGGTGGACATGAGG + Intergenic
928309099 2:30195031-30195053 CAGGGTGAGGTTTGGGAACCTGG - Intergenic
928526114 2:32142741-32142763 CAGGGTGAGAGTTGGGAATGAGG + Intronic
929370227 2:41214476-41214498 CAGGGGGAAGGGTGGGAGAGTGG - Intergenic
929554705 2:42918684-42918706 AAGAGTGTGGGGTGGGAGTGGGG + Intergenic
929561588 2:42959690-42959712 CTGGGTTAGGGGTGGGCGTGGGG + Intergenic
929641909 2:43589677-43589699 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
929801955 2:45111925-45111947 TAGGGGGTGGGGTGGGAGTGAGG + Intergenic
929815260 2:45225576-45225598 CAGGGGGTGGGGTGGGAGTGGGG - Intergenic
929879044 2:45820887-45820909 CATGCTGGGGGGTGGGAAGGGGG - Intronic
929935997 2:46295221-46295243 GAGGGTGAGGGGTGGGAGGAGGG - Intronic
930174347 2:48286457-48286479 TAGGGCTGGGGGTGGGAATGGGG - Intergenic
930619288 2:53627357-53627379 CAGGGGGAGGGGTGATAAAGGGG - Intronic
931846079 2:66205330-66205352 CAGGGTGGGGGGTGGGAGATGGG + Intergenic
932356062 2:71069084-71069106 CAGGGTGGGGAGTGGGAGTGGGG + Intronic
932436113 2:71703375-71703397 CAGGGTGAGGGCTCGGTCTGGGG + Intergenic
933188736 2:79308681-79308703 TAGGGTGAGAGGTGGGAGTCTGG + Intronic
933658209 2:84906142-84906164 CAGGGTGAGGGGCTGGGCTGGGG - Intronic
934619150 2:95793556-95793578 CAGGGTGAGGGGTGGGAATGGGG + Intergenic
934641741 2:96031001-96031023 CAGGGTGAGGGGTGGGAATGGGG - Intronic
934650023 2:96085402-96085424 CAGAGGGAGGGCTGGGACTGAGG + Intergenic
934656294 2:96118191-96118213 TAGGGTTGGGGGTGGGAAGGAGG - Intergenic
934675105 2:96244232-96244254 CAGGGTAAAGGGTGGGAAGGGGG + Intergenic
934901465 2:98163118-98163140 TGGGGTGAGGGGTGGGGAGGGGG + Intronic
934905337 2:98196114-98196136 CAGGGTGCTGGGTGGGGATGGGG + Intronic
935064401 2:99635692-99635714 CAGGTTTAGGGGTGGCATTGTGG - Intronic
935624836 2:105163594-105163616 AATGGTGGGAGGTGGGAATGAGG - Intergenic
936062447 2:109304244-109304266 CAGGGGCTGGGGTTGGAATGGGG - Intronic
936074460 2:109392911-109392933 CAGGATGAGGGGTGCCTATGAGG + Intronic
936928792 2:117765276-117765298 GAGGGTGAAGGGAGGGAAGGAGG + Intergenic
936944138 2:117915328-117915350 CAGAGGGAGGGATGGGGATGGGG - Intergenic
937126313 2:119476983-119477005 CAGGGGTAGGGGAGGGAAGGTGG + Intronic
938285882 2:130116494-130116516 CAGGGTGAAGGGTGGGAGGAGGG - Intronic
938368985 2:130756806-130756828 CTGGGGTGGGGGTGGGAATGGGG - Intronic
938429723 2:131222408-131222430 CAGGGTGAAGGGTGGGAGGAGGG + Intronic
939278660 2:140034863-140034885 GAGGGTGAGGGGTGGGAGGAAGG - Intergenic
939371707 2:141309720-141309742 GAGGGTGAGGGGAGGGAACTTGG + Intronic
939881927 2:147640868-147640890 CAAGGTCAGGGTTGGGAACGCGG + Intergenic
940224907 2:151390814-151390836 GAGGGTGATGGCTGGGGATGCGG - Intergenic
941096566 2:161244803-161244825 CAGGGTCAGGGGTGAGAGGGAGG - Intergenic
941231639 2:162917519-162917541 GGGGTTGGGGGGTGGGAATGTGG + Intergenic
941612329 2:167677067-167677089 CTGGGTGAGGGGTAGGAAAAAGG + Intergenic
942298879 2:174542945-174542967 CAGGATGATGGGTTGAAATGTGG + Intergenic
942517251 2:176767082-176767104 AAAGGTGATGGGTGGAAATGGGG - Intergenic
943281035 2:185933154-185933176 CAGGGGGAAGGGAGGGAGTGGGG + Intergenic
943363497 2:186948037-186948059 TGGGGCTAGGGGTGGGAATGGGG - Intergenic
943560873 2:189460428-189460450 GAGGGTGTGGAGTGGGAAGGAGG - Intronic
943654783 2:190496905-190496927 CAGGGGAAAGGGTGGGAAAGGGG + Intronic
943669335 2:190644744-190644766 GAGGGTGAGGGGTGGGAGGACGG + Intergenic
944148983 2:196537305-196537327 CAGGGTGGGAGGTGGGAAGATGG + Intronic
944166256 2:196724819-196724841 CAGATTGAGGTGTGGGCATGGGG + Intronic
944845098 2:203660126-203660148 GTGGGGGTGGGGTGGGAATGGGG + Intergenic
944939166 2:204604670-204604692 CAGGGTGAGTGGAGGGGCTGAGG + Intronic
945128159 2:206536425-206536447 GAGGTGGAGGGGTGGGAGTGGGG + Intronic
945218894 2:207464434-207464456 CAGGGGAAGAGGTGGGAATAGGG + Intergenic
945259380 2:207830015-207830037 CGGGGTGGGGGGTTGGAAGGGGG + Intronic
945281419 2:208038929-208038951 GTGGGTGATGGGTGGGTATGTGG + Intergenic
945604417 2:211910574-211910596 CAGGGTGGAGGGTGGGAAGATGG + Intronic
945918121 2:215726151-215726173 CAGGGAGAGGGGAGGGAGGGAGG + Intergenic
946011056 2:216563828-216563850 CTGGGTGGGGGGTGGGTAGGCGG - Intronic
946178330 2:217935433-217935455 CAGGGTGAGGGGTGGGGGCTGGG - Intronic
946204259 2:218092095-218092117 CAGGGTGAGGGGAGAAAGTGGGG + Intergenic
946411605 2:219517893-219517915 CAGAGTGGGGAGTGGGAAGGAGG - Intronic
946537143 2:220643391-220643413 CATGGTGGGTGGTGGGTATGAGG + Intergenic
947174281 2:227347102-227347124 GAGAGTGAAGGGTGGGAAAGGGG + Intronic
947523608 2:230865801-230865823 CAGGGCGTGGGGTGGGAAGGGGG - Intronic
947964735 2:234269918-234269940 AAGGGTGAGGGGCAGGAACGAGG + Intergenic
948172806 2:235919106-235919128 CAGGGTCAGCTGTGGGAAAGAGG + Intronic
948305597 2:236944802-236944824 CCGGGTGTGGGCTGGGACTGGGG - Intergenic
948765389 2:240216672-240216694 CAGGGTGAGGGGTGGGGGTGGGG + Intergenic
948765578 2:240217089-240217111 CAGGGTGAGGGGTGGGGGGGTGG + Intergenic
948871936 2:240805072-240805094 CAGGGAGAGGGGAGGGAGAGGGG + Intronic
948892556 2:240914600-240914622 CTGAGTGAGGGGTGGGATGGAGG - Intergenic
949063437 2:241974727-241974749 CCTGGTAAGGTGTGGGAATGTGG - Intergenic
1169132152 20:3171959-3171981 CAGGTTGAGGGGTGGGTTGGAGG - Intronic
1169498188 20:6134490-6134512 CAGTGTGAGGGGTGTGGAGGGGG - Intergenic
1170184049 20:13567268-13567290 GAGGGTGAAGGGTGGGAGGGGGG + Intronic
1170657748 20:18305607-18305629 CAGGGTGAGGGGCAGGGATAAGG - Intronic
1170763996 20:19274723-19274745 CAGGGGGAGGGGCAGGAAAGGGG + Intronic
1170927608 20:20740133-20740155 CAGGGTAAAGGGTGGGAGGGGGG + Intergenic
1171019632 20:21573557-21573579 ATGGGTGAGGAGTGGGAATTGGG + Intergenic
1171326455 20:24297823-24297845 CATTGTGAGGGGTGGGAATGAGG + Intergenic
1171979896 20:31620258-31620280 CAGGGTGGGAGGTGGCCATGTGG - Intergenic
1172010343 20:31842805-31842827 CATGGTGAGGAGGGGGAAGGAGG - Intergenic
1172116756 20:32577533-32577555 CATGGTGAGGGATGGAGATGTGG - Intronic
1172173939 20:32961103-32961125 CAGAGTGGGGAGCGGGAATGGGG - Intronic
1172205867 20:33162494-33162516 CAGGATTAAGGGTGGGAAAGAGG - Intronic
1172639604 20:36432729-36432751 CAGGGTCAGGGGTGGGATGAGGG + Intronic
1172658381 20:36550241-36550263 CAGGGTTGGAGGTGGGAATGAGG + Exonic
1173030833 20:39358094-39358116 CAGGGAGTGTGGTGGAAATGGGG + Intergenic
1173201538 20:40958797-40958819 CACTGTGGGGGGTGGGAAAGCGG - Intergenic
1173552315 20:43941147-43941169 CAGGGTGATGTGAGGGAAGGGGG + Intronic
1173639944 20:44594659-44594681 AGGGGTGAGGGGTGGGAATGGGG - Intronic
1173681104 20:44882639-44882661 TGGGGTGAGGGGAGGGAGTGAGG + Intergenic
1173706529 20:45114359-45114381 CCTTGTCAGGGGTGGGAATGGGG + Intronic
1173809418 20:45947180-45947202 CAGGGTGAGAGGTGGGCAACAGG + Intronic
1173819612 20:46011886-46011908 CAGGGATAGTGGTGGAAATGTGG - Intronic
1173858757 20:46268508-46268530 CCGTGTGTGGGGTGGGAATGGGG - Intronic
1173922933 20:46759361-46759383 CAGGGTGAGGGGTGGAACATGGG + Intergenic
1174410364 20:50331083-50331105 CAGGGTGAGGGGTAAGAAAGGGG + Intergenic
1174421403 20:50401360-50401382 CAGGGACAGGGATGGGAAGGAGG - Intergenic
1174448908 20:50608234-50608256 CTGACTGAGGGGTGGGAGTGAGG + Intronic
1174647828 20:52101323-52101345 CAGGAGGAGGGGTGGTAGTGTGG + Intronic
1174949250 20:55026676-55026698 CAGGGGGAGGGGAGGTAATTTGG - Intergenic
1175001211 20:55632616-55632638 CAGGCTGAGTGGGCGGAATGAGG - Intergenic
1175375847 20:58523453-58523475 CTGGGTGGGGGGTGGGGGTGGGG - Intergenic
1175417734 20:58812672-58812694 CAGGGATGAGGGTGGGAATGAGG - Intergenic
1175486612 20:59351451-59351473 CAGGGACAGGGGTGGGTGTGGGG - Intergenic
1175572692 20:60036379-60036401 CTGGGGGAAGGGTGGCAATGGGG - Intergenic
1175645310 20:60665931-60665953 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1175741598 20:61423382-61423404 CTGGGTCAGGGTTGGCAATGAGG - Intronic
1175903505 20:62369000-62369022 CAGGGGGAGAGGTGGGGGTGGGG + Intergenic
1176098866 20:63356113-63356135 CAGGGTGAGGGGTGTGGGGGAGG + Intronic
1176098898 20:63356189-63356211 CAGGGTGAGGGGTGTGAGGGAGG + Intronic
1176098920 20:63356243-63356265 CAGGGTGAGGGGTGTGAGGGAGG + Intronic
1176098951 20:63356313-63356335 CAGGGTGAGGGGTGTGGGGGAGG + Intronic
1176135935 20:63521976-63521998 CAGGGTGGGGGGTGGGAGGTGGG - Exonic
1176244182 20:64089585-64089607 GAGGATGAGGGGTTGGGATGGGG - Intronic
1176257216 20:64158730-64158752 TAGGGGGAGGGGAGGGGATGGGG - Intronic
1177101363 21:16900728-16900750 CAGTGTGAGGGGAAAGAATGAGG - Intergenic
1177154263 21:17485628-17485650 GACGGTGAGGAGTGGGAAGGAGG - Intergenic
1177264537 21:18765453-18765475 CAGGGTGTGTGATGGGGATGTGG - Intergenic
1178489114 21:33036686-33036708 CAGGGTGGGGCGGGGGAGTGTGG - Intergenic
1178490786 21:33050057-33050079 CGGGGTGAGGGGTGGGCCAGGGG + Intergenic
1178510649 21:33202326-33202348 CAGCGTGGGGTGTGGGATTGAGG - Intergenic
1178683009 21:34689021-34689043 CAGTGTGGGGTGAGGGAATGAGG + Intronic
1178762280 21:35414683-35414705 CAGGGGGAGGGTAGGCAATGAGG - Intronic
1178880260 21:36444264-36444286 GAGGGTGAGGGGAGGGAATTAGG - Intergenic
1178908469 21:36655132-36655154 CAGGGAGAGGGGATGGAATTGGG - Intergenic
1179430409 21:41317246-41317268 CCGGGTGGGGGGTGGGGGTGCGG - Intronic
1179498428 21:41790629-41790651 GATGGGGAGGGGAGGGAATGGGG + Intergenic
1179498508 21:41790813-41790835 ATGGGGGAGGGGAGGGAATGGGG + Intergenic
1179644428 21:42766954-42766976 CTGGGGGTGGGGTGGGAGTGGGG - Intronic
1179786453 21:43733243-43733265 CGGGGGGGGGGGTGGGGATGGGG - Intronic
1179882010 21:44296808-44296830 GAGGGTGGGGCGTGGGAGTGGGG + Intronic
1179923511 21:44520346-44520368 CCTGGTGAGGGCTGGGAAAGTGG + Intronic
1180042398 21:45287341-45287363 CAGGGTGATGGGATGGGATGGGG - Intronic
1180155399 21:45974995-45975017 CAGGGTGTGGTGTTGGAAGGCGG - Intergenic
1180182628 21:46124731-46124753 CAGGTTGGGGGGAGGGCATGGGG - Intronic
1180202411 21:46232559-46232581 CAGGGGTTGGGGAGGGAATGGGG + Intergenic
1180286188 22:10746785-10746807 TGGGGTGAGGGTTGGTAATGAGG - Intergenic
1180780875 22:18518778-18518800 CAGGGTGAGTGCTGGGTTTGAGG - Intergenic
1180787692 22:18556241-18556263 CAGGGTGAGTGCTGGGTTTGAGG - Intergenic
1180835633 22:18928229-18928251 CATGATGAGGGGTGGGACTGGGG - Intronic
1180926800 22:19560786-19560808 AAGGGTGAGGGGTGGGAGAGAGG + Intergenic
1180936978 22:19632323-19632345 CAGGGTGTGGGATGGGGGTGTGG + Intergenic
1181164411 22:20975782-20975804 CAGGGTCAAGGGTGGGAAACAGG + Intronic
1181234047 22:21439065-21439087 CAGGGTGAGTGCTGGGTTTGAGG + Intronic
1181244600 22:21495766-21495788 CAGGGTGAGTGCTGGGTTTGAGG - Intergenic
1181283977 22:21739149-21739171 GAGGGTGGGGTGTGGGAAAGGGG - Intergenic
1181324296 22:22032860-22032882 CAGGGTGAGAGGTGGGTCAGTGG - Intergenic
1181387751 22:22557976-22557998 GTGGGGGAGGGGTGGGCATGGGG + Intronic
1181387767 22:22558012-22558034 GTGGGGGAGGGGTGGGCATGGGG + Intronic
1181387783 22:22558048-22558070 GTGGGGGAGGGGTGGGCATGGGG + Intronic
1181387798 22:22558084-22558106 GTGGGGGAGGGGTGGGCATGCGG + Intronic
1181387888 22:22558319-22558341 GCGGGGGAGGGGTGGGGATGGGG + Intronic
1181387906 22:22558356-22558378 GGGGGGGAGGGGTGGGGATGGGG + Intronic
1181473343 22:23154090-23154112 GAGGGTAAGGGGTGGGAGAGTGG - Intronic
1181886429 22:26025618-26025640 TTTGGTGAGGGGAGGGAATGGGG + Intronic
1181986862 22:26805875-26805897 TAGGGTGCTGGGTGGGAGTGGGG + Intergenic
1182130382 22:27845927-27845949 AAGGATGAGGGGTGGGAAGGGGG + Intergenic
1182393987 22:30022201-30022223 AGGGGTATGGGGTGGGAATGGGG - Intronic
1182435025 22:30325142-30325164 CAGGGTGAGGGTTCAGAATGAGG + Intronic
1182767546 22:32769269-32769291 CAGGTGGAGGGATGGGAGTGAGG - Intronic
1182869022 22:33629610-33629632 CAGGGGTTGGAGTGGGAATGGGG + Intronic
1182896199 22:33861363-33861385 GTGGGTGAGGAGTGGGAGTGAGG - Intronic
1182910755 22:33982148-33982170 CAGGCTGAGGGAGGGGAAAGGGG - Intergenic
1182988674 22:34745301-34745323 GAGGGTGAAGGGTGGGAAGAGGG - Intergenic
1183359745 22:37377277-37377299 CAGGGTGGGGGCTGGGGCTGAGG - Intronic
1183411850 22:37659419-37659441 AAGGGTGAGGGGCGGGGAAGAGG + Intronic
1183430941 22:37765483-37765505 CAAGGTGAGGTTTGTGAATGAGG + Intronic
1183478513 22:38050307-38050329 CTGAGGGAGGGGTGGGGATGGGG + Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183947628 22:41335708-41335730 CAGGCTCAGGTGTGGGAAGGAGG + Intronic
1183983705 22:41557711-41557733 CAGGGTGAGGGAAGGGAATGCGG - Intergenic
1184119049 22:42438485-42438507 GAGGGAGAGGGGAGGGAGTGGGG - Intergenic
1184151702 22:42643441-42643463 CAGGGTGGGGGGTGGGGGGGCGG - Intronic
1184248845 22:43249032-43249054 AAGGGTGAGTGGTGGGACAGGGG + Intronic
1184426148 22:44410392-44410414 CGGGCCGAGGGGTGGGAAAGAGG - Intergenic
1184533355 22:45070762-45070784 CAGGGTGAGGGGTAGGGCAGGGG - Intergenic
1184644067 22:45886575-45886597 CCGGGAGAGGGGCGGGAAGGAGG - Intergenic
1184661349 22:45967028-45967050 CTGGGTGAGGGGCAGGGATGGGG + Intronic
1184667989 22:45998548-45998570 CCTGGTGAGGGGTGGGGATGAGG - Intergenic
1184742998 22:46439924-46439946 CTGTGTGAGGGGTGGGAGGGCGG - Intronic
1185101522 22:48843328-48843350 CAGGGTGTGGGGTGGGGGTTTGG + Intronic
1185388126 22:50545837-50545859 CAGGCTGAGAGGAGGGACTGTGG + Intergenic
1203285721 22_KI270734v1_random:153528-153550 CCTGATGAGGGGTGGGACTGGGG - Intergenic
949204669 3:1423660-1423682 GGGGGTGGGGGGTGGGAAGGGGG + Intergenic
949331854 3:2932054-2932076 CGGGGTGGGGGGTGGGAGTTTGG + Intronic
950113548 3:10435643-10435665 CAGGGTGACAGGTGGGCAGGAGG + Intronic
950417172 3:12875366-12875388 CAGGGTGAGGGGTGTGAGCCAGG - Intergenic
950702773 3:14761633-14761655 CAGGATGAGGGATGGGCCTGGGG + Intronic
950859240 3:16132873-16132895 GGGGGTGAGGGGTGAGAATAGGG + Intergenic
951470997 3:23055962-23055984 AAGGGTGAGGGGTGGACATTTGG - Intergenic
951859657 3:27237645-27237667 CAGGAGGAAGGGTGGGAGTGGGG + Intronic
952347021 3:32497471-32497493 TAGTGTGAGGGGTGGGAAAGTGG + Intronic
952905075 3:38134443-38134465 CAAGGTGAGGGGTGGAATAGAGG + Intronic
952949917 3:38514755-38514777 CAGGGGGAGGGGGGGGAGGGTGG - Intronic
953277302 3:41514774-41514796 AAGGGTGAGGGGTGGGAGGAAGG + Intronic
953636824 3:44671196-44671218 AAAGGTGAGAGGTGGGAATATGG + Intergenic
953767647 3:45756091-45756113 CAGGGTGTGGTGTGGGCATCTGG + Exonic
953781890 3:45878494-45878516 CAGGGTGAGGCTGGGGGATGGGG + Intronic
954237430 3:49267561-49267583 CAGGGTGGGGGTGAGGAATGAGG - Intergenic
954387083 3:50249731-50249753 CAGGATGAGGGGAGGGGATCTGG - Intronic
954755183 3:52835349-52835371 CAGTGTGTGGGGTGGGTGTGGGG + Exonic
955195320 3:56800740-56800762 CAGAGTGAGGTGTGGGAGAGTGG + Intronic
955401984 3:58598696-58598718 CAGGGAAAGGGGTGAGATTGGGG - Intronic
955645973 3:61137840-61137862 CAGGGAGAGAGGTGGGTATGGGG - Intronic
956518527 3:70078410-70078432 CTGGGTGTGGAGTGGCAATGTGG + Intergenic
956790530 3:72676775-72676797 CAGGGAGATTGGTGGGGATGGGG - Intergenic
957465119 3:80580005-80580027 AAGGTTGAGAGCTGGGAATGAGG - Intergenic
958014303 3:87920245-87920267 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
958789749 3:98637866-98637888 CAGGGGGAAGGGTGGGAGTGGGG - Intergenic
959902830 3:111679255-111679277 GAGGGTCAGGGTTGGGAAGGAGG + Intronic
960041683 3:113156229-113156251 CAGGGCTGGGAGTGGGAATGGGG + Intergenic
960172771 3:114482017-114482039 TAGGGTGAGGGTTGGGTCTGAGG + Intronic
960225136 3:115159271-115159293 CAGGGAGAGGGGTGGGAGGATGG - Intergenic
960460052 3:117922520-117922542 CTGGGTGAGGAGTGTGATTGGGG - Intergenic
960515377 3:118596791-118596813 AGGAATGAGGGGTGGGAATGTGG - Intergenic
960966737 3:123110837-123110859 CAGGGTGAAGGGTAGGGATGGGG - Intronic
960974247 3:123159771-123159793 GAGGGTGAGGGGGGTGAAGGTGG + Intronic
961008202 3:123419165-123419187 CATGATGAGGGGAGGGGATGCGG - Intronic
961372698 3:126441100-126441122 CAGTTTGAGGGGCTGGAATGGGG - Intronic
961396797 3:126599235-126599257 CAGGGAGAGGGGAAGGAAGGAGG - Intronic
961439295 3:126943206-126943228 CAGGGAGTGGGGTGGTAGTGGGG - Intronic
961491332 3:127258410-127258432 CAGGGTGAGGGGACAGCATGTGG - Intergenic
962207262 3:133445196-133445218 CAGACTGAGGGCTGGGAGTGGGG + Intronic
962342382 3:134596453-134596475 CCTGGGGAGGGCTGGGAATGTGG - Intergenic
962975586 3:140443081-140443103 GAGTGAGAGGGATGGGAATGGGG - Intronic
963790506 3:149577998-149578020 GAGGGTGGGGGGAGGGAAGGAGG - Intronic
963956488 3:151260076-151260098 TATGGTGATGGGTGGGACTGGGG + Intronic
963958391 3:151280684-151280706 GATGGTGAGGGGTGGGTAGGGGG + Intronic
964332203 3:155615761-155615783 CAGGGGGAGGGTTGGGATGGGGG + Intronic
964511348 3:157455567-157455589 GAGGGTGAAGGGTGGGAAAAGGG - Intronic
966441539 3:179950359-179950381 TAGGGTGAGGGGAGGGGGTGGGG + Intronic
967115542 3:186334275-186334297 CAGGGTGGGGTGGGGGAATATGG - Intronic
967390780 3:188951837-188951859 CAGGGGAAGAGGTGGGAATGCGG + Intronic
968173667 3:196530053-196530075 CAGGGGAAAGGGTGGGAAGGGGG - Intergenic
968278460 3:197458325-197458347 CAGGGTGAGTGGAGGGCATGTGG - Intergenic
968287023 3:197514748-197514770 CAGGGTGTGGGGATGGGATGGGG - Intronic
968299913 3:197604563-197604585 CAGGGAAAGTGGTGGGAGTGAGG + Intergenic
968514533 4:1010686-1010708 CAGGATGAGGGGAGGCCATGGGG + Intronic
968517339 4:1020777-1020799 CAGGGGAAGGGGTGGGGCTGGGG + Intronic
968615851 4:1577419-1577441 CAGGGTGCGGGGTGGTAGGGGGG + Intergenic
968787369 4:2632677-2632699 TAGGGTGAGGGGTGGGGGTGGGG + Intronic
968831413 4:2934483-2934505 CAGGGTGGGGGGCGGGACCGGGG - Intronic
969471466 4:7391818-7391840 CTGGGTGAGGGGCTGGAAGGAGG - Intronic
969619484 4:8271932-8271954 GAGGCTGAGGGGTGCGAGTGTGG + Intronic
970251316 4:14119020-14119042 AAGGGTGATCGCTGGGAATGGGG + Intergenic
971380321 4:26091290-26091312 CCGGGTGAAGGGTGGGAGCGGGG - Intergenic
971433659 4:26595631-26595653 GAGGGTGGGTGGTGGGAGTGGGG - Intronic
972762363 4:42119438-42119460 CAGGCAGAGGGGTGGGAAGGAGG - Intronic
972953876 4:44365159-44365181 CAGGGAGAGTGGTGGGCATATGG + Intronic
973088197 4:46095966-46095988 CTGGGTGGGGAGTGGGAAGGAGG - Intronic
973607139 4:52599249-52599271 CAGGGGGAGGGGTAGGGGTGGGG + Intronic
973802195 4:54489758-54489780 CTGGGATAGAGGTGGGAATGGGG + Intergenic
974454207 4:62105262-62105284 CAGGGTGAAGGGTGGGAGGAGGG - Intergenic
975342473 4:73258104-73258126 AATCGTGAGGTGTGGGAATGTGG - Intronic
975432938 4:74316164-74316186 CAGGGTTAGAGGTGGGGTTGAGG - Intergenic
975477714 4:74842613-74842635 CATGGTGTTGGGTAGGAATGAGG - Intergenic
975488280 4:74959466-74959488 CATGGTGAGGGGAGGAAAGGTGG - Intronic
975582778 4:75921744-75921766 CAGGGTGAGGAGTGGCAGTGGGG + Intronic
975893856 4:79062432-79062454 CAATGTGAGGTGTGGGAATGGGG - Intergenic
976040891 4:80884008-80884030 GAGGGTGAAGGGTGGGAAAAGGG - Intronic
976151893 4:82100710-82100732 CAGGATGATTGGTGGGAATAAGG - Intergenic
976371593 4:84295043-84295065 GAGGGTGAGAGGTGGGGATAGGG - Intergenic
976687450 4:87830578-87830600 GAGGGTGAAGGGTGGGAAGAAGG + Intronic
976726273 4:88218592-88218614 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
976892550 4:90067781-90067803 GAGGGTGAGGGGTGGGCAAAGGG - Intergenic
976925084 4:90486165-90486187 TAGATTGAGGGGTGGGAGTGGGG - Intronic
977371409 4:96141810-96141832 AAGGGAGAGGGCTGGGACTGAGG - Intergenic
977570269 4:98621778-98621800 CTGCGGGGGGGGTGGGAATGAGG - Intronic
977683703 4:99823745-99823767 CAGCATGATGGGTGGCAATGGGG + Intronic
977850143 4:101817527-101817549 GAGGGTGAGGGGTGGGAGGAGGG + Intronic
978170983 4:105669795-105669817 TGGGGTTAGGGGTGGGAAAGAGG - Intronic
978381863 4:108137259-108137281 CAGGGGAAAGGGTGGGAGTGGGG + Intronic
978464375 4:108993175-108993197 CAGGGTTTGGGGTGGGAGTGTGG - Intronic
978476193 4:109133979-109134001 CAGGGAGAGGGATGGGAGTCAGG + Intronic
978532349 4:109728084-109728106 CGTGGTAAGGGGAGGGAATGTGG - Intronic
978619039 4:110621557-110621579 CTGGGGGAGGGGAGGAAATGGGG - Intronic
979486331 4:121275049-121275071 AGGGGCCAGGGGTGGGAATGGGG - Intergenic
979549722 4:121977297-121977319 CATTGTGAGTGGTGGGGATGAGG + Intergenic
980219854 4:129901019-129901041 CAGGAGAAGGGATGGGAATGGGG - Intergenic
980901726 4:138911451-138911473 CCAAGTGAGGGGTGGGAGTGAGG + Intergenic
981447611 4:144858224-144858246 AAGAGTGGGGGATGGGAATGGGG + Intergenic
981512456 4:145572688-145572710 GAGGGTGGGGGGGGGGAATGAGG + Intergenic
981761517 4:148200339-148200361 CTGTGTGGGGGGTGGGGATGTGG - Intronic
982066282 4:151657471-151657493 CAGAGTGAGGAGTGGGGGTGGGG + Intronic
982313251 4:154006831-154006853 GAGGTTGAGGGGTGGAAGTGAGG - Intergenic
982520200 4:156407022-156407044 CAGGGGAAAGGGTGGGAGTGGGG + Intergenic
982575939 4:157110071-157110093 AAGGTTGCGGGGTGGGAATAAGG + Intronic
982601009 4:157448706-157448728 TAGGGAGCGGGGTGGGCATGAGG + Intergenic
983270084 4:165551171-165551193 CATGGTGAGGAGTGGGTTTGGGG - Intergenic
983766895 4:171495332-171495354 AGGGGTGAGGGGTGTGAATGGGG - Intergenic
984852849 4:184168909-184168931 GAGGGTGGGGTGGGGGAATGAGG - Intronic
984873605 4:184348605-184348627 CAGGGGGTGGGGTGGGGAGGCGG - Intergenic
985106392 4:186504288-186504310 CAGGGAGATGGATCGGAATGGGG - Intronic
985451576 4:190066262-190066284 GGGGGTGGGGGGTGGGGATGGGG - Intergenic
985784831 5:1887996-1888018 CAGGGTTAGGGGAGGGCATGGGG + Intergenic
985921354 5:2978833-2978855 CGGGCTGAGGGCTGGGATTGGGG - Intergenic
986120931 5:4835606-4835628 CAGGGTGTGAGGTGGGATTGGGG + Intergenic
986664787 5:10091873-10091895 CAGGGCCAGTGGTGGAAATGTGG + Intergenic
987043015 5:14080515-14080537 GAGGGTGTGGGGTGGGGATTAGG - Intergenic
987333627 5:16878826-16878848 CAGGGAGAAGGGTGGGAGGGTGG + Intronic
987334528 5:16887152-16887174 CAGGATAAGGGGAAGGAATGTGG - Intronic
987840646 5:23218962-23218984 TATGGTTAGGGGTGGGATTGAGG + Intergenic
987955842 5:24738965-24738987 CAGGGTGAGGGCTGGGAAGAGGG - Intergenic
988798377 5:34673746-34673768 CAGAGGCAGGGGTGGGAATGGGG - Intronic
988799865 5:34686321-34686343 CAGGAGCAGGGGTGGGGATGTGG + Intronic
988909631 5:35826438-35826460 CCGTGTGTGGGGTGGGTATGGGG - Intergenic
989111066 5:37906988-37907010 CAGGGTCAGGGGTTGGGGTGAGG + Intergenic
990154060 5:52854435-52854457 AAGGTGGAGGGGTGGAAATGAGG - Intronic
990311969 5:54548846-54548868 CAGGGAGTGGGGTGGGATTGAGG - Intergenic
990335955 5:54772951-54772973 CAAGGTGAAGGGTGTAAATGGGG + Intergenic
990358310 5:54992928-54992950 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
990413920 5:55567894-55567916 TAGGGGGAAGGGTGGGAAAGGGG - Intergenic
990543442 5:56797796-56797818 AGGGGTGTGAGGTGGGAATGTGG + Intergenic
991625508 5:68596716-68596738 CAGGGTGAGGGGATGGATTCAGG + Intergenic
991700290 5:69310812-69310834 TGGGGATAGGGGTGGGAATGAGG + Intronic
992269333 5:75050431-75050453 CAGAGTGAGAGGTGGGACGGAGG - Intergenic
992441446 5:76800970-76800992 CAGGGTAAGGAGAGAGAATGAGG + Intergenic
992820246 5:80488510-80488532 CTGGGGGAGGTTTGGGAATGCGG + Intronic
993163627 5:84321571-84321593 AAGGATGAGGGTTGAGAATGAGG - Intronic
993408706 5:87547231-87547253 CAGGGTGAAGAGTGAGCATGGGG - Intergenic
994373485 5:98992926-98992948 AAGGGTGGAGGGTGGGAAGGAGG + Intergenic
994685606 5:102947522-102947544 CAGGGTAAAGGATGGGAAGGAGG + Intronic
994760390 5:103844498-103844520 CAGTGTGAGGGGTGGCTATAAGG + Intergenic
994777670 5:104055506-104055528 CAGGGAGAAGGGTGGGAGGGAGG - Intergenic
995008140 5:107226418-107226440 GAGGGTGAAGGGTGGGAGTAGGG + Intergenic
995375360 5:111468166-111468188 CAGGGGAAAGGGTGGGAGTGGGG + Intronic
996717725 5:126601135-126601157 GAGGGTGAGGGGTGGGAGCTAGG + Intronic
997015413 5:129928187-129928209 CAGGGTGGGGGGTGGGGAGAGGG - Intronic
997196415 5:131983252-131983274 ATGGCTGAGGGGTGGGCATGTGG - Intronic
997352238 5:133239223-133239245 CAGGGAGGGGGGTGGGGGTGGGG - Intronic
997469334 5:134108227-134108249 CAGGGTGGGGGTTGGGAGTGGGG - Intergenic
997509259 5:134442125-134442147 AAGGGTGAGGGGAGGGGCTGGGG + Intergenic
997848658 5:137311300-137311322 CTTGTTGAGGGGTGGGAAGGAGG + Intronic
997853781 5:137355576-137355598 CAGGATGAGGGCTTGGTATGGGG + Intronic
997863145 5:137437908-137437930 CTGGGTGGGGAGAGGGAATGGGG - Intronic
997978710 5:138455574-138455596 CAGGGTCTGGGGTTGGAGTGTGG + Intergenic
998046655 5:138992416-138992438 CAGAGTGAGGGGTAGGATTTTGG - Intronic
998787948 5:145732821-145732843 CAGGGGTAGGAGTGGAAATGGGG + Intronic
999015714 5:148102226-148102248 AAGGGTGAGGGTTGGGAATGAGG + Intronic
999238488 5:150114112-150114134 CACGGGGAGGGTTGGGAAGGGGG - Exonic
999239543 5:150119595-150119617 CAGGCTCAGGGGTGGAAAAGTGG + Intronic
999278668 5:150349947-150349969 CAGGGTGCTGGGTGAGAATGAGG + Intergenic
999430915 5:151524714-151524736 CATGAGCAGGGGTGGGAATGAGG - Intronic
999781751 5:154856063-154856085 CTGGGTGAGGGGTGGTAGTGAGG + Intronic
1000047802 5:157535927-157535949 CAGGGGCAGGGGTGGGATGGGGG - Intronic
1000806717 5:165804155-165804177 CAGGGTGGGGGGTGGGGTTATGG + Intergenic
1001064182 5:168522711-168522733 CAGTGGGGGGGGTGGGATTGGGG - Intergenic
1001326769 5:170734047-170734069 CAGGTTGAGGAGTGGAACTGTGG - Intronic
1001392170 5:171388063-171388085 GGGGGTGAGGGGCGGGAATCCGG + Intronic
1001548637 5:172586524-172586546 AAGGGTGGGGGCTGGGGATGGGG + Intergenic
1001733220 5:173975487-173975509 CAGGGGAAAGGGTGGGAGTGAGG - Intronic
1001895143 5:175372351-175372373 GAGGGTGAAGGGTGGGAGTGGGG - Intergenic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002280859 5:178129452-178129474 AAGGGTGAGGGTTAGGAAGGAGG - Intergenic
1002678131 5:180935719-180935741 CTGGGAGGGGGCTGGGAATGGGG - Intronic
1002704221 5:181149226-181149248 GAGGGTCAGGGGTGGATATGTGG + Intergenic
1003131277 6:3397138-3397160 CAGGGTGTGGGATGGGAGAGTGG - Intronic
1004150228 6:13112019-13112041 GAGGGTGAAGGATGGGAAGGCGG - Intronic
1004160807 6:13211265-13211287 CAGGGGGAGGGGTGGGAGGCTGG - Intronic
1004356945 6:14938044-14938066 CAGGGTGTGTGGTGAGCATGGGG - Intergenic
1004699421 6:18065312-18065334 CTGGGTGGGGGAGGGGAATGGGG - Intergenic
1004766852 6:18738830-18738852 CTGGGTGAGGGAGGGAAATGGGG + Intergenic
1005440247 6:25859855-25859877 AAGGGGGAGGAGTGGAAATGGGG - Intronic
1005601560 6:27431357-27431379 TGTGGTGAGGGGAGGGAATGGGG - Intergenic
1005639071 6:27777335-27777357 CAGGGATAGGGGTGGGGATAAGG + Intergenic
1005948617 6:30614494-30614516 CAAACTGAGAGGTGGGAATGAGG + Intronic
1006047474 6:31309197-31309219 AAGGGTGAGAGGTGGCCATGAGG + Intronic
1006246426 6:32740981-32741003 CAGAGAAAGGGGAGGGAATGGGG + Intergenic
1006375876 6:33671397-33671419 CAGGTTGGGTGGGGGGAATGCGG - Intronic
1006618227 6:35343865-35343887 CAGGGTGGAGGGTGGGAGTGAGG - Intronic
1007243098 6:40441280-40441302 TGGGGTGAGGGGTGTGAACGCGG + Intronic
1007343521 6:41209256-41209278 CAGGGAGAAGGGAGGGAAAGAGG - Intergenic
1007429895 6:41770753-41770775 CAGGGTGGGTGGTGGGCATGGGG + Exonic
1007448433 6:41924937-41924959 GAGGGTGAGGGCAGGGGATGAGG + Intronic
1007634884 6:43293358-43293380 AAGAGACAGGGGTGGGAATGTGG + Intergenic
1007782255 6:44261168-44261190 CAGAGTGAGAGGAAGGAATGTGG - Intronic
1008051021 6:46900471-46900493 CAGGGTGAGTGTTGAGAAGGAGG - Intronic
1008620552 6:53267112-53267134 CAGGGTAAGGGGAGAGATTGGGG + Intergenic
1009359009 6:62791526-62791548 CAGGGGGAGGGTTGGAAGTGGGG - Intergenic
1009739616 6:67726993-67727015 GAGGGTGAGAGGAGGGAATCAGG + Intergenic
1009798964 6:68508670-68508692 CAGGGGGAAGGGTAGGAAGGGGG - Intergenic
1009846972 6:69146324-69146346 CAGAGTGAGCACTGGGAATGGGG + Intronic
1009985779 6:70779526-70779548 CAGGGGCTGTGGTGGGAATGTGG + Intronic
1010029257 6:71256156-71256178 CAGGGATAGGGGTGGGGCTGGGG + Intergenic
1010122971 6:72400635-72400657 CCGGGTGAGGGGAGTGAGTGTGG - Exonic
1010164508 6:72899796-72899818 TGGGGTGAAGGGTGGGAAGGGGG - Intronic
1010429005 6:75757512-75757534 TTGGGTGAGGGGTGGGAATTGGG + Intronic
1010819872 6:80401062-80401084 AAGGGTGAAGGGTGGGAAGAGGG + Intergenic
1011698565 6:89934683-89934705 GAGGGTGAGGGGAGGAGATGGGG + Intronic
1012445078 6:99298917-99298939 CAGGGTTGGGGTTGGGGATGGGG - Intronic
1013122357 6:107151914-107151936 CAGGCTGAGAGGTGTGATTGAGG + Intergenic
1013300743 6:108802981-108803003 AATAGTGAGGGGTGGGAGTGGGG + Intergenic
1013465569 6:110414537-110414559 GTGGGTGAGGGGTGGGACAGAGG - Intronic
1013803272 6:113970755-113970777 GGGGCTGAGGGGTGGGAAGGAGG - Intronic
1014022306 6:116605222-116605244 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1014386039 6:120803616-120803638 AAGGGTGAGGGGGGGGAGGGCGG + Intergenic
1015579046 6:134703521-134703543 TAAGGTGAGTGGTGGGAAGGAGG + Intergenic
1015729674 6:136335080-136335102 CAGGGTGTGTGATGGGAGTGTGG - Intergenic
1015843655 6:137496905-137496927 CGGGGGGAGGGGAGGGAAGGAGG + Intergenic
1017637421 6:156456312-156456334 AAGGGGGAGGGGAGGGGATGGGG - Intergenic
1017802526 6:157910623-157910645 CTGGGGGAGGGGAGGGAATGTGG - Intronic
1018129692 6:160717200-160717222 GAGGGTGAGTGGTGGGGGTGGGG + Intronic
1018168259 6:161121161-161121183 CAGGGGAAAGGGTGGGAAGGCGG - Intergenic
1018176843 6:161184571-161184593 GAGGATGACAGGTGGGAATGGGG - Intronic
1018221230 6:161581749-161581771 AAAGGTGAGGGATGGGAAAGTGG + Intronic
1018360342 6:163061453-163061475 GAGGGTGATGGGTGGAGATGTGG + Intronic
1019056002 6:169223990-169224012 CATGGTGGGGAGTGGGGATGAGG + Intronic
1019059224 6:169243217-169243239 CAGAGGGAGTGGTGGGAATGTGG - Intronic
1019482459 7:1273182-1273204 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482482 7:1273249-1273271 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482505 7:1273316-1273338 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482528 7:1273383-1273405 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482551 7:1273450-1273472 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482574 7:1273517-1273539 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482620 7:1273651-1273673 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482643 7:1273718-1273740 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482688 7:1273852-1273874 CAGGGTGAGGGTGTGGAATGGGG + Intergenic
1019482708 7:1273919-1273941 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482729 7:1273986-1274008 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482752 7:1274053-1274075 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019482774 7:1274120-1274142 CAGGGCGAGGGTGTGGAATGGGG + Intergenic
1019559925 7:1650922-1650944 CTGGGGGAGGGGTGGGCAAGTGG - Intergenic
1019643712 7:2118093-2118115 CAGGGTGGAGGGTGGGTAAGGGG - Intronic
1019698894 7:2463077-2463099 CAGGGGCAGGGGAGGGAATGGGG + Intergenic
1019831735 7:3336863-3336885 CAGGGTGATGGTGGGGAGTGGGG + Intronic
1020107066 7:5427083-5427105 GAGGGGGAGGGGATGGAATGGGG - Intergenic
1020244911 7:6422460-6422482 CAGGCTGCGGAGTGGGCATGGGG + Intronic
1021008893 7:15437635-15437657 GAGGGTGAGGCGGGAGAATGGGG - Intronic
1021116911 7:16754341-16754363 AAGGGTACGGGGTGGGAAAGCGG - Intronic
1021888552 7:25164773-25164795 CAGGGGGAAGGTTGGGAAAGGGG - Intronic
1022163348 7:27733446-27733468 ATGGGTGAGGGTTGGGAAAGTGG + Intergenic
1022214074 7:28240762-28240784 AGGGGTAAGGGGTGGGAGTGAGG - Intergenic
1022263233 7:28727681-28727703 GAGGGTTAGGGGTGGAGATGTGG + Intronic
1022359454 7:29644311-29644333 CGGGGTAAGGGATGGGGATGAGG + Intergenic
1022412293 7:30148602-30148624 CGGGGTGAGGGGTTGGATTCTGG + Intronic
1022751175 7:33227606-33227628 TAGGGGGAAGGTTGGGAATGGGG - Intronic
1023010008 7:35917913-35917935 CAGGATGAGGGGTGAGGAGGAGG - Intergenic
1023085800 7:36568911-36568933 CAGAGTGTGGGTTGGGGATGGGG + Intronic
1023338265 7:39192727-39192749 AAGGGGGAGGCGTGAGAATGTGG - Intronic
1023484082 7:40665701-40665723 CAGGTTGAGGAGTGGGGATTGGG + Intronic
1023779381 7:43641979-43642001 CAGGGGCAGGGGAGGGAATTGGG + Intronic
1023879603 7:44310779-44310801 CAGGGTGAGGGAAGGGAATGGGG + Intronic
1024080823 7:45853666-45853688 CAGGATGAGGGGTGAGGAGGAGG + Intergenic
1024172907 7:46808958-46808980 GAGGGTGAAGGGTGGGGAGGAGG + Intergenic
1024442934 7:49442769-49442791 CTGGGTGGGGGGTGGGAGAGGGG - Intergenic
1024665080 7:51538089-51538111 CAGGGGGAAGGGTGGGAGGGAGG - Intergenic
1024778410 7:52816402-52816424 CAGGGTGTGCTGTGGGACTGAGG - Intergenic
1025249423 7:57342104-57342126 CAGGGACAGGGATGGGAAGGAGG + Intergenic
1025333612 7:58355991-58356013 CAGGGTGGGGGTGGGGGATGGGG + Intergenic
1025763623 7:64418958-64418980 TAGGGTGAGGGGTTAGGATGGGG - Intergenic
1025776783 7:64567967-64567989 CAGGGGATGGGGTGGGACTGGGG - Intergenic
1025847941 7:65217290-65217312 CAGGATGGGGGGTGGGGAGGAGG - Intergenic
1025951057 7:66145850-66145872 CAGGGTGAAGGGTGGGCGTGGGG - Intronic
1026577279 7:71582811-71582833 CAGGGGAAAGGGTGGGAAGGGGG + Intronic
1026627215 7:72005796-72005818 TAGGGGTGGGGGTGGGAATGAGG + Intronic
1026895408 7:74007442-74007464 TAGAGTGAGGGCTGGGGATGGGG - Intergenic
1027224247 7:76234068-76234090 CAGGGAGTGGGGTGGGAGGGAGG - Intronic
1027260633 7:76462089-76462111 CAGGGTGCCGGGTGCGAAAGGGG + Intronic
1027312012 7:76960202-76960224 CAGGGTGCCGGGTGCGAAAGGGG + Intergenic
1027329185 7:77073509-77073531 CAGGGTTAGAAGTGGGAGTGGGG - Intergenic
1027364885 7:77447142-77447164 CAGGGAGAGGGGAGGAAATAAGG - Intergenic
1028104775 7:86864170-86864192 CGGGGGGAAGGGTGGGAAGGAGG - Intronic
1029459147 7:100685411-100685433 CAGGGTGGGCAGTGGGGATGGGG + Exonic
1029582036 7:101443169-101443191 CAGGATGGGGGGTTGGAAAGAGG - Intronic
1029606600 7:101602851-101602873 CAGGGTGAGGGGTGGGATGGGGG - Intergenic
1029611164 7:101627345-101627367 CAGGGGCAGGGGTGGGAGGGAGG + Intronic
1029737637 7:102473519-102473541 CAGGGTGAGGGGTGGCCACAAGG + Exonic
1029786579 7:102797861-102797883 CAGGGTTAGAAGTGGGAGTGGGG + Intronic
1030018155 7:105244972-105244994 CAGGGAGAGGGCAGGGAAGGGGG - Intronic
1031290217 7:119924744-119924766 AAGGGTGAGTGGGGAGAATGAGG + Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1032283867 7:130526819-130526841 AAGGGTGGGTGGTGGGGATGGGG + Intronic
1032284596 7:130531051-130531073 AAGGGTGGGTGGTGGGGATGGGG + Intronic
1032546894 7:132751349-132751371 CAGGGGGATGTGTGGGAAGGGGG - Intergenic
1032720912 7:134550291-134550313 CAGGGTAAGGGATGGGGATGAGG - Intronic
1032853719 7:135816690-135816712 CAGGCAGAGGGATGGGACTGTGG + Intergenic
1033306075 7:140226674-140226696 CAGGGTGACAGGTGTTAATGTGG - Intergenic
1033415765 7:141160201-141160223 CAGGGAAAGGGGTGGGAGTGGGG - Intronic
1033462510 7:141560610-141560632 CAGGGGGAAAGGTGGGAGTGGGG - Intronic
1033539010 7:142338838-142338860 CCTGGAGAGGGGTGGGAAGGTGG + Intergenic
1033621865 7:143069168-143069190 CAGGGTGAGGAATGAGAAAGAGG + Intergenic
1033913636 7:146296254-146296276 CAGGGTGAGGTCATGGAATGGGG - Intronic
1034270380 7:149800815-149800837 GGGGGTGGGGGGTGGGAGTGTGG - Intergenic
1034345727 7:150384154-150384176 CAGGGCCAGGCGTGGGAAGGGGG + Intronic
1034415759 7:150963568-150963590 CTGGGGCTGGGGTGGGAATGGGG - Intronic
1034493892 7:151409226-151409248 CAGGGTGAGGTCTGGGGGTGGGG - Intronic
1034846765 7:154453430-154453452 TAAGGTGAGGGTTGGCAATGCGG - Intronic
1034926921 7:155129987-155130009 AAGGGAGAGGGGTGGAAAGGAGG + Intergenic
1034944327 7:155252131-155252153 CCGGGTGCGGGGTGGAAATCAGG + Intergenic
1035051985 7:156004244-156004266 CCGGGTGAGGTGAGTGAATGCGG - Intergenic
1035230552 7:157463531-157463553 GAGGGTGAGGGGTGAGGATGGGG - Intergenic
1035264894 7:157685178-157685200 CGGGATGAGGGGTGGGAGGGCGG - Intronic
1035285456 7:157803350-157803372 TAGGGTGAGTGGTGGGTGTGTGG - Intronic
1035520815 8:273922-273944 CTGGGTGAGGGGTGAGAAGTGGG + Intergenic
1036165946 8:6433861-6433883 CAGGGTGAGGGGGGAGACAGAGG - Intronic
1036220876 8:6920922-6920944 TAGGGGAAGGGGTGGGTATGAGG + Intergenic
1036411217 8:8503457-8503479 GAGGGAGAGGGCTGGGGATGAGG + Intergenic
1036670490 8:10782166-10782188 CAGGGTGGGGGATAGAAATGGGG + Intronic
1036795660 8:11754678-11754700 TGGGGTGAGGAGTGGGAAGGAGG - Intronic
1036942690 8:13066869-13066891 CAGGGGAAAGGGTGGGAAGGGGG + Intergenic
1037055273 8:14432523-14432545 CAGGGTAAAGGGTGAGAAGGGGG + Intronic
1037353502 8:17991849-17991871 CAGGGGAAAGGGTGGGAAGGGGG - Intronic
1037696551 8:21228824-21228846 CAGGGTGTGGGGAGGGCCTGTGG - Intergenic
1037814671 8:22105647-22105669 CAGGGAGGGGGCTGGGAAAGGGG + Intergenic
1037820732 8:22133521-22133543 CAGGGTGGGGGGTGGGGTGGGGG - Intergenic
1037822081 8:22139916-22139938 GAGGCTTAGGGGTGGGTATGAGG - Intronic
1038324321 8:26561058-26561080 CAGGGGGAGGGATGGGAGGGGGG + Intronic
1039170972 8:34744452-34744474 GGGGGTGAGGAGTGGGGATGTGG + Intergenic
1039465952 8:37784886-37784908 CTGGGGCAGGGGTGGGGATGGGG + Intronic
1041007323 8:53508039-53508061 TGGGGTGAGGGGTGGGAAGTGGG - Intergenic
1041150787 8:54931367-54931389 CAGGGGAAAGGGCGGGAATGAGG + Intergenic
1041399719 8:57429122-57429144 GAGGGTGAAGGGTGGGAAAAGGG - Intergenic
1041577839 8:59420398-59420420 GAGGGTGAAGGGTGGGAAGAAGG + Intergenic
1041859989 8:62502425-62502447 GAGTGTGAGGGCTGGGAAAGGGG - Intronic
1041972082 8:63755230-63755252 GAGGGTGAGGGGTGGGAGGAGGG - Intergenic
1041989486 8:63968552-63968574 GGGGGTTAGGGGTGGGAAAGAGG + Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042313707 8:67402937-67402959 CGGGGAAAGGGCTGGGAATGGGG - Intergenic
1042634672 8:70860653-70860675 TAGGGGTAGGGGTGGGGATGGGG - Intergenic
1042803010 8:72741559-72741581 AAGAGTGAGGGGGTGGAATGAGG - Intronic
1042861366 8:73317464-73317486 CAGGGTGTGAGTTGGGAGTGGGG + Intronic
1042875891 8:73439558-73439580 CAGTGACAGGGGTGGGAAAGAGG + Intronic
1043442220 8:80286315-80286337 CAGTTTGAGGTATGGGAATGAGG - Intergenic
1043979473 8:86621632-86621654 CAGGGAGAAGGGTGGGAAGGGGG - Intronic
1043982810 8:86660296-86660318 CAGGGTGGGAGGTGGGGTTGGGG + Intronic
1044002363 8:86899164-86899186 AAGGGTGAAGGGAGGAAATGGGG + Intronic
1044031481 8:87242947-87242969 CAGGGTGGAGGGAGGAAATGTGG + Intronic
1044122650 8:88416380-88416402 CAGAGTCAGAGGAGGGAATGTGG + Intergenic
1044157850 8:88872199-88872221 CAGTTTGAGGAGTGGGAAAGAGG - Intergenic
1044553367 8:93536173-93536195 CAGGGTGAGGTATGGGAAAAAGG + Intergenic
1044666907 8:94641100-94641122 CAGGAAGGGGGGTGGGAAGGAGG - Intronic
1044763020 8:95542296-95542318 CAGGGTGGAGGGTGGGGAGGAGG + Intergenic
1045040452 8:98219042-98219064 CAGGATCAGGGGTAGGAGTGAGG + Intronic
1045320279 8:101077229-101077251 AAGGGTAAGGGGTGGCAAGGAGG - Intergenic
1045358620 8:101411850-101411872 GAGGGTGTGGGGTGGGGTTGAGG - Intergenic
1045432974 8:102131098-102131120 CAAGGTTGGGGGTGGGAATGGGG - Intergenic
1045477393 8:102564796-102564818 CTGGGTGGGAGATGGGAATGGGG + Intergenic
1045583285 8:103501077-103501099 CAGGGAGAGAGGCGGGAATATGG - Intronic
1045603486 8:103746594-103746616 GAGGTTGAGGGGTGGGAAGACGG - Intronic
1045685114 8:104703634-104703656 CAGGGAGAGGGAGGGGAAAGAGG - Intronic
1046580937 8:116091617-116091639 CAGGGTGTGGGGTGGGTGAGTGG - Intergenic
1046915429 8:119673568-119673590 CACTGTCGGGGGTGGGAATGTGG - Intergenic
1047827046 8:128588121-128588143 AAGGGTGAGGGGGTGGAAGGAGG - Intergenic
1047837821 8:128713698-128713720 AGGGGTGAGGGGTTGTAATGAGG - Intergenic
1048291103 8:133182432-133182454 CAGGTTGTGGGGATGGAATGAGG - Intergenic
1048369541 8:133765734-133765756 CAGGATCTGGGGTGGGAATGGGG - Intergenic
1048545450 8:135382462-135382484 GAGGGTGGAGGGTGGGAAGGAGG - Intergenic
1048857534 8:138697334-138697356 CAGGGTGAGGGGGTAGAATCAGG + Intronic
1048991251 8:139761527-139761549 CAGGGTGTGGGGTTGGGAGGAGG - Intronic
1049163910 8:141115291-141115313 CAGGGTGGGGGGTGGCACTGTGG + Intergenic
1049231962 8:141489158-141489180 CACAGTGAGGGGTGGGGTTGGGG - Intergenic
1049391304 8:142373017-142373039 CAGGCTGAGGGGTAGGATGGAGG - Intronic
1049468721 8:142765463-142765485 CAGGGTGGGGGGTGGGGAGGAGG + Intronic
1049510853 8:143025999-143026021 GAGGGTGGGGGATGGGAAGGAGG - Intergenic
1049537664 8:143189674-143189696 GGGGGTGGGGGGTGGGAGTGGGG - Intergenic
1049537686 8:143189717-143189739 GGGGGTGGGGGGTGGGAGTGGGG - Intergenic
1049537710 8:143189761-143189783 GGGGGTGGGGGGTGGGAGTGGGG - Intergenic
1049651455 8:143771682-143771704 CAGGGTGCGTGGTGGGGGTGAGG + Intergenic
1049706948 8:144047418-144047440 CTGGGTGAGGGGCGGGGAGGGGG + Intergenic
1050281253 9:4052483-4052505 CAGGGTGTGAGTGGGGAATGAGG - Intronic
1050491344 9:6191277-6191299 CAGGGTCTGGGGTGGGAAGAAGG - Intergenic
1050723514 9:8619340-8619362 CAGGTTGAGGGGTGGGGGTTGGG - Intronic
1051190430 9:14505681-14505703 TAGGGAGAAGGGTGGGATTGGGG + Intergenic
1051219939 9:14837340-14837362 CAGAGACAGAGGTGGGAATGGGG - Intronic
1051680554 9:19603490-19603512 CAGGGTGAGGGGAGGGAGGGGGG + Intronic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1051930055 9:22374173-22374195 GAGGGTGAGGGGGTGGAAGGAGG + Intergenic
1052757345 9:32554602-32554624 CAGGGATTGGGGTGGGTATGGGG - Intronic
1052807525 9:33025693-33025715 CGGGGTGGGGGGGGGGAGTGGGG + Intronic
1052816688 9:33107410-33107432 GGGGGAGAGGGGAGGGAATGAGG - Intronic
1053283018 9:36833567-36833589 CAGGGCTAGGGGTGGGACTTGGG - Exonic
1053519208 9:38761325-38761347 AAGAGTGAGGGGTTGGAGTGGGG - Intergenic
1053653988 9:40197238-40197260 CAGGGTGTGGAGCGGGAGTGAGG + Intergenic
1054673734 9:67833184-67833206 CAGGGTGTGGAGCGGGAGTGAGG + Intergenic
1054718765 9:68583138-68583160 CAAGGTGAGAAGTGGTAATGCGG - Intergenic
1055240106 9:74173257-74173279 CAAGGGGAGGGGTCCGAATGAGG + Intergenic
1055391240 9:75824284-75824306 CAGGGTGAGGTGCAGGATTGAGG - Intergenic
1055861848 9:80760436-80760458 CTGCGTGAGGGTTGGGAATGGGG + Intergenic
1055939539 9:81636578-81636600 CAGGGAGAGGGGTGAGAGGGTGG - Intronic
1056027148 9:82510764-82510786 CAGGGGGAAGGGTGGGAGGGAGG + Intergenic
1056034870 9:82593783-82593805 GAGGGTGGGGGGTGAGAAGGAGG + Intergenic
1056098497 9:83278245-83278267 CAGTCTGAGGGGTGGGCAGGAGG + Intronic
1056367817 9:85923274-85923296 CATGGTCAGGAGTGCGAATGGGG - Intergenic
1056634879 9:88323287-88323309 CATGGGGTGGGGTGGGGATGGGG - Intergenic
1056709604 9:88980075-88980097 CAGGGTGGGGGGTGGGGGTGGGG + Intergenic
1056796273 9:89660849-89660871 CAGGGTGGGGGTGGGGATTGTGG + Intergenic
1056850894 9:90082640-90082662 CAGGGTGACAGGTGGGCAGGTGG + Intergenic
1057459775 9:95250750-95250772 TAGGCTGAGGGGTGGCAATGAGG - Intronic
1058228023 9:102391029-102391051 TAGGTTCAGGAGTGGGAATGGGG - Intergenic
1058366356 9:104213806-104213828 CTGGGATGGGGGTGGGAATGGGG - Intergenic
1058472871 9:105299003-105299025 CAGGAAGAGGGGTGGGAGTAGGG + Intronic
1058479197 9:105373555-105373577 AAGGGAGAGGGAGGGGAATGTGG + Intronic
1058654510 9:107207605-107207627 CTGGGTGGGGTGGGGGAATGGGG + Intergenic
1059309290 9:113377221-113377243 GAGGGTGCGGGGAGGGAATAAGG - Intergenic
1059515765 9:114893741-114893763 CAGCCTGAGAGGTGGGAGTGGGG + Intronic
1059670389 9:116485585-116485607 CATGGTGAGTGGTGGGACTGGGG - Intronic
1059774346 9:117460704-117460726 GAGGAGGAGGGGTGGGAAAGAGG + Intergenic
1059960239 9:119557420-119557442 CAGGGTGTGGGGTGGACATGGGG - Intergenic
1060037013 9:120264294-120264316 CAGGGTGAGTGGGGAGAGTGAGG - Intergenic
1060150861 9:121287239-121287261 CAGGGGGAGGAGTGGGAGGGAGG + Intronic
1060196710 9:121628678-121628700 CAGGGGCAGGGGAGGGAAAGCGG + Intronic
1060201274 9:121652787-121652809 CAGCCTGCAGGGTGGGAATGTGG - Intronic
1060437510 9:123606943-123606965 CATGCAGAGGGTTGGGAATGTGG + Intronic
1060478105 9:124000128-124000150 CAGGGTGAGGGCTGGGGGCGCGG - Intergenic
1061239039 9:129358610-129358632 CAGGGTGTGGGAGGGGAAAGAGG - Intergenic
1061389595 9:130310099-130310121 CAGGCAGAGGGCTGGGAAAGGGG - Intronic
1061644266 9:131987426-131987448 GAGGGGGAGCGGTGGGAATGTGG + Intronic
1061755564 9:132809724-132809746 CAGGATGAGGGGAAGGGATGTGG + Intronic
1061985449 9:134127671-134127693 CGAGGTGAGGGGTGGGAACTGGG + Intergenic
1062130958 9:134892806-134892828 CATGGTGAGGGGTAGGGAAGGGG - Intergenic
1062177882 9:135174376-135174398 CAGGATCAGGGGTGGGACTCAGG + Intergenic
1062379606 9:136280854-136280876 CAGGGTTAGGGGTTGGATGGGGG + Intergenic
1062414236 9:136439718-136439740 CGGGGAGAGGGGTGGGAAGCGGG + Exonic
1062453034 9:136623436-136623458 CTGGGTGAATGCTGGGAATGTGG + Intergenic
1203732540 Un_GL000216v2:103894-103916 TGGGGTGAGGGTTGGTAATGAGG - Intergenic
1185484128 X:469327-469349 CAGGCTGTGGGGAGGGAATGAGG + Intergenic
1185581381 X:1213262-1213284 AAGGGGGAGGGGAGGGAAGGGGG - Intergenic
1185592516 X:1286935-1286957 CGGGGAGAGGGGAGGGAAGGAGG + Intronic
1185765636 X:2723742-2723764 CCAGGTGGGAGGTGGGAATGTGG + Intronic
1185812976 X:3127861-3127883 TAGGGTAAGGGGTGGTAATATGG + Intergenic
1185887280 X:3794047-3794069 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1186300289 X:8193372-8193394 CAGGGTGCAGGGTGGGAGTAGGG - Intergenic
1186372602 X:8962567-8962589 AAGGGAGAAGGGTGGGAAGGGGG + Intergenic
1186495590 X:10010656-10010678 CAGGCTCAGGAGTTGGAATGGGG - Intergenic
1186848149 X:13552224-13552246 CAGGGTGAGGGGTAGGGGTGGGG + Intergenic
1187107628 X:16260609-16260631 CAGGGTGTGCTATGGGAATGTGG + Intergenic
1187989702 X:24856207-24856229 CAGAGTTAGGAGTGGGAAGGAGG - Intronic
1188229502 X:27644117-27644139 CAGGGTCATGGGTTAGAATGTGG - Intronic
1188434803 X:30148240-30148262 CAGGGTGGGTGCTGGGAGTGGGG - Intergenic
1188487598 X:30700473-30700495 CATGGGGAAGGGTGGGGATGGGG - Intronic
1188619241 X:32199535-32199557 AAGGGGGAGGGGTGTGAAGGGGG + Intronic
1188619246 X:32199551-32199573 AAGGGGGAGGGGTGTGAAGGAGG + Intronic
1188738262 X:33744561-33744583 CAGGGTGGAGGGTGGGAAGAGGG + Intergenic
1189283111 X:39833063-39833085 CAGGGTGAGTGGGGAAAATGAGG - Intergenic
1189298629 X:39936350-39936372 GAGGGTGAGGGAGGGGAAAGGGG + Intergenic
1189650217 X:43180922-43180944 CAGGATGAGGGGTGGAAAAAAGG - Intergenic
1189850410 X:45171520-45171542 TAGGGTGAGGGCTGGGGGTGGGG - Intronic
1189921297 X:45905444-45905466 GAGGGTGAAGAGTGGGAATATGG - Intergenic
1190044132 X:47098994-47099016 CACAGTGAGGGTTGGGGATGGGG - Intergenic
1190095768 X:47479049-47479071 AGGGGTGAGGGTTGGGAATGAGG + Intronic
1190471251 X:50781762-50781784 CAGGATGAGGTGAGGGAGTGAGG - Intronic
1190489058 X:50962895-50962917 GAGGGTGAAGGGTGGAAGTGGGG + Intergenic
1190492517 X:50997129-50997151 CAGGGTGAGTGGTGTGGGTGAGG - Intergenic
1190581380 X:51894985-51895007 CAGGAGGTGGGGTGGGAATAGGG - Intronic
1190681462 X:52830339-52830361 CAGGGGGAGGGGGGAGAAGGAGG - Intergenic
1191784759 X:64905472-64905494 CAGGGTAAAGGTTGGGATTGGGG + Intergenic
1191965619 X:66754013-66754035 CAAGGGGAAGGGTGGGAAGGGGG - Intergenic
1192249106 X:69396561-69396583 GAGGGTCATGCGTGGGAATGGGG - Intergenic
1192320117 X:70083928-70083950 CAGGGTCAGGGGTCAGACTGCGG + Intergenic
1192343297 X:70281421-70281443 AAGGATGAGGGATGGGAAGGAGG - Intronic
1192345745 X:70303861-70303883 CAGGGAAAGGGGTGGGAATGGGG - Intronic
1192452352 X:71252368-71252390 CAGGCTGTGGGGGAGGAATGGGG - Intronic
1192809453 X:74536302-74536324 CAGAGTGTGGAGTGGGCATGGGG - Intergenic
1192848101 X:74925900-74925922 TGGGGGGCGGGGTGGGAATGGGG - Intergenic
1193386380 X:80876721-80876743 TGGGGGGAGGGGTGGGAAGGGGG + Intergenic
1193515463 X:82456448-82456470 GAGGGTGAAGGGTGGGAAGTGGG + Intergenic
1193593631 X:83419887-83419909 CTGTGTTGGGGGTGGGAATGGGG - Intergenic
1193917585 X:87383919-87383941 CAAGGGGAAGGGTGGGAAGGAGG + Intergenic
1193924910 X:87472589-87472611 CAGGGTGAAGGGTGGGGTTAGGG + Intergenic
1193966766 X:87997352-87997374 AAGGGTTAGGGGTGGCCATGAGG - Intergenic
1194347369 X:92782817-92782839 CAGGGGGAAGGGTGGGAAAGAGG + Intergenic
1194801356 X:98277530-98277552 CAGGGAGAAGGATGGGATTGGGG + Intergenic
1195004339 X:100671406-100671428 CAGGATGAGGGGTGGGTAGCAGG + Intergenic
1195010278 X:100726919-100726941 AAGGGTGAGGGGTGGGAGAAGGG - Intronic
1195469958 X:105219874-105219896 GGTGGAGAGGGGTGGGAATGGGG + Intronic
1196417754 X:115490588-115490610 CAGGGGGAGGGGTTGGAGTGGGG - Intergenic
1196595496 X:117541175-117541197 CAGGGTGAGGTGTGACAAGGTGG - Intergenic
1196655112 X:118209986-118210008 CGGTGTGAGGGGTGGGTGTGTGG + Intergenic
1197087053 X:122491107-122491129 CAGGGAGAAGGGTGGGAAGTGGG - Intergenic
1197335377 X:125204751-125204773 GAGGGTGAGGGGTGGGGTGGGGG + Intergenic
1197818661 X:130524188-130524210 AAGCGTGAAGGGTGTGAATGAGG - Intergenic
1198103723 X:133443258-133443280 GAAGTAGAGGGGTGGGAATGAGG + Intergenic
1198421643 X:136474487-136474509 CAGGGTGAAGTGAGGGAAGGGGG + Intergenic
1198451310 X:136768887-136768909 CAGGGAGACAGGAGGGAATGAGG + Intronic
1198452188 X:136777982-136778004 CAGGGGGAAGGGTGGGAGTAGGG + Intronic
1198733871 X:139764810-139764832 CAAGTTGAGGGGAGGGATTGGGG - Intronic
1198867240 X:141137295-141137317 TATGCTGAGGGGTGAGAATGAGG + Intergenic
1199293264 X:146129149-146129171 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1199324153 X:146476955-146476977 CAGGGTCAGGGGCTGGGATGGGG + Intergenic
1199470791 X:148193376-148193398 CAGGGTGGGGGGAAGAAATGGGG - Intergenic
1199536873 X:148912460-148912482 CAGGGTGGAGGGTGGGAAGAGGG + Intronic
1199825186 X:151491622-151491644 CAGGGATGGGAGTGGGAATGAGG - Intergenic
1199825736 X:151497910-151497932 ATGGGGGAGGGGTGGGAATGGGG - Intergenic
1199874299 X:151919293-151919315 GGGGGTGGGGGATGGGAATGGGG - Intronic
1199894805 X:152118792-152118814 TGGGGTGGGGGATGGGAATGGGG + Intergenic
1200129155 X:153831513-153831535 CCGGGTGAGGGCTGGGGCTGAGG - Intergenic
1200402894 X:156029894-156029916 GAGGGTGAGGGTTGGGGTTGGGG + Intergenic
1200655692 Y:5899450-5899472 CAGGGGGAAGGGTTGGAAAGAGG + Intergenic
1200705137 Y:6436220-6436242 CAGGGTGAAGGGAGGAAGTGAGG - Intergenic
1200911341 Y:8534092-8534114 CAGGATGAAGGGAGGCAATGAGG + Intergenic
1200916199 Y:8573351-8573373 CAGGATGAAGGGAGGCAATGAGG + Intergenic
1200919137 Y:8597568-8597590 CAGGATGAAGGGAGGCAATGAGG + Intergenic
1200930420 Y:8691950-8691972 CAGGATGAAGGGTGGCAGTGAGG - Intergenic
1201028974 Y:9728488-9728510 CAGGGTGAAGGGAGGAAGTGAGG + Intergenic
1201283396 Y:12359930-12359952 CAGGGCAAGGGATGGGGATGAGG + Intergenic
1201683662 Y:16677836-16677858 CAGGGTGTGGAGTGGGAAATCGG + Intergenic
1201728850 Y:17184615-17184637 CAGAGTCAGAGGTGGGTATGTGG + Intergenic
1202149847 Y:21834820-21834842 CAGGATGAAGGGTGGCAGTGAGG + Intergenic
1202628405 Y:56883726-56883748 TGGGGTGAGGGTTGGTAATGAGG + Intergenic