ID: 934642156

View in Genome Browser
Species Human (GRCh38)
Location 2:96033179-96033201
Sequence GTGCTGACAAATAGGGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 2, 1: 0, 2: 0, 3: 25, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934642156_934642161 -7 Left 934642156 2:96033179-96033201 CCCTCTTCCCTATTTGTCAGCAC 0: 2
1: 0
2: 0
3: 25
4: 258
Right 934642161 2:96033195-96033217 TCAGCACGACCCTGATGAGTGGG 0: 2
1: 0
2: 0
3: 1
4: 63
934642156_934642160 -8 Left 934642156 2:96033179-96033201 CCCTCTTCCCTATTTGTCAGCAC 0: 2
1: 0
2: 0
3: 25
4: 258
Right 934642160 2:96033194-96033216 GTCAGCACGACCCTGATGAGTGG 0: 2
1: 0
2: 0
3: 2
4: 76
934642156_934642162 -3 Left 934642156 2:96033179-96033201 CCCTCTTCCCTATTTGTCAGCAC 0: 2
1: 0
2: 0
3: 25
4: 258
Right 934642162 2:96033199-96033221 CACGACCCTGATGAGTGGGCTGG 0: 2
1: 0
2: 0
3: 4
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934642156 Original CRISPR GTGCTGACAAATAGGGAAGA GGG (reversed) Intronic
900415831 1:2534272-2534294 GTGCTGAGAAATGGCTAAGATGG + Intergenic
900730815 1:4258396-4258418 GTGCTGACTAAAAGGGACCAAGG + Intergenic
905327767 1:37169970-37169992 GGGCTGACACAAGGGGAAGAGGG + Intergenic
905943924 1:41885810-41885832 GTGCTCAGAAATAGGAAGGAAGG - Intronic
906843600 1:49165957-49165979 GTAATGAAAAATAAGGAAGAGGG + Intronic
907413104 1:54296106-54296128 AAGCAGACAAATAAGGAAGAAGG - Intronic
907576143 1:55527684-55527706 GAGGTGACATTTAGGGAAGAAGG + Intergenic
908953054 1:69586207-69586229 GTTCTTACACATAGGGAGGAAGG - Intronic
909848522 1:80430288-80430310 GTTCTGAAAAATAGAGAAGGAGG - Intergenic
914921214 1:151848432-151848454 GGGCAGCCAAATAGGAAAGAAGG + Intronic
915706598 1:157849649-157849671 GTGCTGAGAGAGAGGCAAGAAGG + Intronic
915723211 1:157999143-157999165 GGGCTGAGAACTAGGGAAGGGGG - Intronic
915799998 1:158780821-158780843 GTGCTGACACAGATGGTAGAAGG - Intergenic
917841380 1:178982502-178982524 GTGCTGGGAAATATTGAAGAAGG + Intergenic
921784335 1:219210338-219210360 GTGGTGACATAGAGGGAACAGGG + Intronic
924001673 1:239560740-239560762 GAGCTGACATATGGGGAAAATGG - Intronic
1063607955 10:7539554-7539576 GTGGTGAGAAAGAGAGAAGATGG + Intergenic
1065145209 10:22761800-22761822 GTGCTGACATATGGAGAAGGAGG - Intergenic
1067787378 10:49260414-49260436 GTGCTCACAAACAATGAAGAGGG - Intergenic
1068614362 10:59096389-59096411 CTGCAGACAAATAGGCAAGAGGG - Intergenic
1069569793 10:69487384-69487406 GCTCTGACAAATAGAAAAGAGGG - Intronic
1071269567 10:83994431-83994453 ATGCTAACAAATAAGGAAGCAGG + Intergenic
1071978505 10:90979042-90979064 GTGAGGACAATTTGGGAAGAAGG - Intergenic
1072231488 10:93417680-93417702 GTGCAGACAAAGTGGGATGATGG - Intronic
1073583316 10:104686687-104686709 TTGATGACAAGGAGGGAAGAGGG - Intronic
1073628355 10:105122132-105122154 GTGCTGATAATGAGGGAAGTTGG + Intronic
1075378363 10:121997760-121997782 CTGCTGGCTAATAGGGGAGAGGG + Intronic
1075609827 10:123843611-123843633 ATGCTCAGAGATAGGGAAGATGG - Intronic
1076263935 10:129094245-129094267 ATGGTGAGAAATAGGGCAGAGGG + Intergenic
1076411157 10:130252023-130252045 GTGCAGACACACAGGGAAGGAGG - Intergenic
1078143014 11:8705246-8705268 GTGGAGAGAAATAGGGAAGAGGG - Intronic
1078237104 11:9495602-9495624 TTACTGATAAATAGTGAAGATGG - Intronic
1078443895 11:11389828-11389850 GTGCTCACACATAGGGCAGGAGG - Intronic
1078470488 11:11582123-11582145 GAGGTGACATATGGGGAAGAGGG + Intronic
1079516755 11:21278210-21278232 TTGCTGCCAAATTAGGAAGAAGG + Intronic
1079668195 11:23134449-23134471 GTGCTAACACATAGAGAATAAGG - Intergenic
1081055935 11:38411297-38411319 GAGCTGATAAGAAGGGAAGAAGG + Intergenic
1081415398 11:42808952-42808974 GTGAGGAAAAAAAGGGAAGAGGG - Intergenic
1084354511 11:68628459-68628481 AGGGTGAGAAATAGGGAAGAAGG - Intergenic
1084653785 11:70503660-70503682 GTGAGGACAAATAGGGCAGGAGG - Intronic
1086878649 11:92128482-92128504 GTTCTTACAACAAGGGAAGAAGG - Intergenic
1088384145 11:109234159-109234181 GTGCTCAGAAAATGGGAAGAGGG - Intergenic
1088404657 11:109460492-109460514 GTACAGACCAGTAGGGAAGAGGG + Intergenic
1088415118 11:109580047-109580069 CTGCTGACACATAGAGAAGGTGG - Intergenic
1088757133 11:112894781-112894803 GTGCTGTTAAATAGGAAACAGGG - Intergenic
1088928191 11:114323075-114323097 GTGAGGACATATGGGGAAGAGGG + Intergenic
1089615342 11:119691869-119691891 CTGCTGAGAAAGAGGGAGGAAGG - Intronic
1090570428 11:128038771-128038793 GGGCAGACCCATAGGGAAGATGG - Intergenic
1091034127 11:132217898-132217920 GTGCTTACAAATAGGAAAATAGG - Intronic
1093505327 12:19858601-19858623 GTGATGATAAACAGGGAATATGG - Intergenic
1094035999 12:26072663-26072685 GTGCTCACAATTAGTGAACATGG - Exonic
1095709777 12:45275976-45275998 GTGCTGTCAAGGAGGGAGGAGGG - Intronic
1096377816 12:51128724-51128746 GTGCAGATAAATCTGGAAGAAGG + Intronic
1096951180 12:55474225-55474247 GTGCTGAATAATAGTGATGATGG - Intergenic
1097720266 12:63012281-63012303 ATGCTAACATATAGGGGAGAGGG - Intergenic
1098167784 12:67715809-67715831 GTGATGGCAAAGAGGGAAGAGGG + Intergenic
1099168674 12:79338181-79338203 ATGGTGAAAAATGGGGAAGATGG - Intronic
1099959520 12:89383458-89383480 ATCCTGAAAAAAAGGGAAGATGG - Intergenic
1100413236 12:94344012-94344034 GTGAGGACAAAGTGGGAAGAAGG + Intronic
1100442253 12:94627784-94627806 ATGCTGAGAAATAGACAAGAGGG - Intronic
1100803475 12:98257447-98257469 GTGCTCACCAACAGGGAAGGGGG + Intergenic
1101122686 12:101599445-101599467 ATGCTTAGAAATAGGCAAGAGGG - Intronic
1102438001 12:112940232-112940254 CTGCTGACAAAGTGGGAACAGGG - Intronic
1103845935 12:123902149-123902171 GTGCAGACACACAGGGAAGAGGG - Intronic
1104190770 12:126480030-126480052 GGGCTGAGAAATTGGGAAAATGG + Intergenic
1105064782 12:133187015-133187037 GTGATAAGAGATAGGGAAGAGGG - Intronic
1105982011 13:25526962-25526984 GTGCTGGCAGATTGGGGAGAGGG + Intronic
1107064306 13:36195996-36196018 GTGGTGACACAGAGGGAATAGGG + Intronic
1107067577 13:36231971-36231993 GTGATGACAAATTGGCAATATGG + Intronic
1107332809 13:39319856-39319878 GTGGTGACAAGTAATGAAGAGGG + Intergenic
1109984226 13:69955551-69955573 GTTCTAACAAATATGGGAGATGG - Intronic
1110474538 13:75898633-75898655 GTTCTGACAAATACAGAAAAGGG + Intergenic
1110728290 13:78851847-78851869 CAGCTGACAATTAGGTAAGAGGG + Intergenic
1111175247 13:84586242-84586264 GTTCTAACAAATAGGGAAGTAGG - Intergenic
1111954104 13:94738101-94738123 GTGCTGACAGAGGGGAAAGAGGG + Intergenic
1112319671 13:98395183-98395205 GTGCGGAGAGATAGAGAAGAGGG - Intronic
1112921842 13:104622970-104622992 GTGCAGTAAAGTAGGGAAGAGGG - Intergenic
1114812942 14:25921693-25921715 GTGGTTACAAATGGGGAGGATGG + Intergenic
1115018749 14:28649289-28649311 GGGATGACAGAAAGGGAAGAGGG + Intergenic
1115166773 14:30457385-30457407 GTGCTGAGCAAAAGGGAAAAAGG + Intergenic
1115535832 14:34372578-34372600 GAGCTTACAAATGGGGAAGAGGG + Intronic
1115784117 14:36805127-36805149 GTGCTGACAAGAAGGCAAGGAGG - Intronic
1116029585 14:39554751-39554773 AAGCTGACAACTAGGAAAGAAGG + Intergenic
1118482343 14:66179835-66179857 GTGAGTACAAAGAGGGAAGATGG - Intergenic
1120840722 14:89082857-89082879 CTGCTGGCAAACAGGGAGGAGGG - Intergenic
1120874918 14:89367156-89367178 CTGTTGAAAATTAGGGAAGATGG - Intronic
1121099201 14:91238443-91238465 GTGGTGAGAAAAAGGGGAGAAGG + Intronic
1121405981 14:93719666-93719688 CAGCTGACAAATAGGCCAGAGGG - Exonic
1122159579 14:99773658-99773680 GTGATGGCAAGTAGGGCAGACGG - Intronic
1124385474 15:29204842-29204864 ATGCCGACAAATGGTGAAGATGG - Intronic
1124638425 15:31379827-31379849 GTCCTGAGAAATATGGAAAAAGG - Intronic
1125599837 15:40909430-40909452 GTGCAGAGTAAAAGGGAAGAGGG - Intergenic
1125698377 15:41658797-41658819 GTGAGGACAACTTGGGAAGAAGG - Intronic
1125795961 15:42403988-42404010 GGGCTGGGAAATATGGAAGAGGG + Intronic
1128870739 15:71153489-71153511 GTGGTGAGAAGCAGGGAAGATGG - Intronic
1128919058 15:71593980-71594002 CTGATGAGAAAGAGGGAAGAGGG + Intronic
1129502140 15:76049500-76049522 TTGTTGATGAATAGGGAAGAAGG - Intronic
1130118258 15:81024359-81024381 GTGCTGACAATGAGGGAGGAGGG + Intronic
1131248379 15:90815304-90815326 ATGCTGACAAACAAGAAAGAGGG - Exonic
1133740500 16:8647512-8647534 GTGGTCACAAGTAGGGGAGACGG + Exonic
1133791575 16:9013282-9013304 GTGCTGGCAGAGAGGGGAGAGGG - Intergenic
1134646222 16:15869223-15869245 GTGCTGAAAAAAAATGAAGAGGG - Intronic
1135049332 16:19179771-19179793 CTGCTGAGAAATTGGGAAGGAGG - Intronic
1135052495 16:19204210-19204232 GTGGTGACAAGTCGGGGAGAGGG - Intronic
1136395283 16:29989007-29989029 GAGCTGAGAAATGGGTAAGAAGG - Intronic
1136530243 16:30863279-30863301 TTGCTGAGAAGTAGTGAAGAGGG - Intronic
1137858797 16:51825016-51825038 TTGCTGACAAAAAGTGGAGAAGG - Intergenic
1139997356 16:70993259-70993281 GTGCTTACAAATCACGAAGATGG - Intronic
1141305068 16:82855157-82855179 CTGCTGACTCTTAGGGAAGAGGG - Intronic
1142400021 16:89853739-89853761 GTGCTGAGAACTTGGGAAGAAGG - Intronic
1145297461 17:21602456-21602478 GTGCTTACACATAGGGACGTTGG + Intergenic
1145886818 17:28387824-28387846 TTGGTGGGAAATAGGGAAGAAGG + Intronic
1149156415 17:53635475-53635497 GTTCTGACAATTAGGGAAGGTGG - Intergenic
1149968791 17:61194865-61194887 GAACTGACAAATAGGGGAGCTGG - Intronic
1153008030 18:514456-514478 GCGCTGACGAACAGGAAAGAGGG - Intergenic
1153294823 18:3535404-3535426 TTGCTTAGAAATAGGGAAAAAGG + Intronic
1153851456 18:9099281-9099303 TTGCTGGCAAAAAGAGAAGATGG - Intergenic
1154020274 18:10658514-10658536 TGGTTGACAAAAAGGGAAGATGG + Intergenic
1157308172 18:46531992-46532014 CTGGTGACAAAAAAGGAAGATGG + Intronic
1157380400 18:47209727-47209749 GGTCTGACAAACAGGGAAGATGG + Intergenic
1158326948 18:56322682-56322704 GTGCTCACAAATGGGGAGCAGGG - Intergenic
1158873232 18:61709023-61709045 GAGGTGGCAAATGGGGAAGAAGG + Intergenic
1164274274 19:23702909-23702931 GAGGTGGCAAATGGGGAAGAAGG + Intergenic
1165168627 19:33874526-33874548 ATGCAGAAAAATAGGGAAAAGGG + Intergenic
1167002589 19:46754992-46755014 GTGCTGAAAAATGGTTAAGATGG - Intronic
1167211043 19:48134275-48134297 GTGGTGACAGATAGGGAACAGGG - Intronic
1168707453 19:58478067-58478089 GTGCTGAAAAGTGGGGCAGATGG - Exonic
926075205 2:9937412-9937434 CTACTGCCAAAAAGGGAAGAGGG + Intergenic
928867110 2:35929814-35929836 CTACAGCCAAATAGGGAAGAAGG + Intergenic
929406016 2:41641762-41641784 GTTGTTACAAATAGGAAAGATGG + Intergenic
929706764 2:44221348-44221370 GTGCTGAAAAATACCGCAGAAGG + Intronic
930395780 2:50822624-50822646 ATGCTGAGAAAAAGAGAAGAGGG + Intronic
930413969 2:51065678-51065700 GTTCTGAAAAATAGGGATGTGGG + Intergenic
932108080 2:68967325-68967347 GTGAAGACAAAGATGGAAGATGG + Intergenic
933693585 2:85198367-85198389 GAGCTGGCAAGTAGGGAAGGGGG + Intronic
934618737 2:95791378-95791400 GTGCTGACAAATAGGGAAGAGGG + Intergenic
934642156 2:96033179-96033201 GTGCTGACAAATAGGGAAGAGGG - Intronic
936012806 2:108936020-108936042 GTGGTGACCAGTAGGGAGGACGG - Intronic
936266902 2:111017768-111017790 GTGCTGGCAAGCAGGGAAGGAGG - Intronic
938059159 2:128238731-128238753 GTGCGGACACAGCGGGAAGATGG - Intronic
942335662 2:174882407-174882429 TTGCTGAAAAATAGAAAAGATGG - Intronic
942449211 2:176098757-176098779 GGTCTGACAAACAGGGAAGTGGG - Intergenic
943320682 2:186438822-186438844 GGGCTGGAAAATAGGGTAGAAGG - Intergenic
943810419 2:192180769-192180791 AGGCTGACAAATATGGAAGAAGG + Intronic
943832659 2:192482978-192483000 ATGCTGACAAATATGGAGAATGG + Intergenic
943838697 2:192550133-192550155 GTGCTGTCAAATAGAAGAGATGG - Intergenic
945212504 2:207398038-207398060 GGGCTGTCAAAAAGGGAGGAGGG - Intergenic
946424468 2:219585847-219585869 GAGGTGGCAAATGGGGAAGAAGG - Intergenic
946913864 2:224495238-224495260 CTGCTGGCAAATAAGGAAAATGG + Intronic
1169330660 20:4713699-4713721 GTGATGACACACAGGGAAGGAGG - Intergenic
1169416717 20:5423562-5423584 GTGCTGAGAGATTTGGAAGATGG + Intergenic
1171322896 20:24262144-24262166 GTTCTGAGAAATTCGGAAGAGGG - Intergenic
1173186857 20:40846908-40846930 GTGTTGAAAAGTAGGGGAGAAGG - Intergenic
1173836297 20:46128388-46128410 GTTTTGACAAACTGGGAAGATGG + Intronic
1175127539 20:56763661-56763683 GAGAAGAAAAATAGGGAAGAAGG + Intergenic
1175345401 20:58269260-58269282 GTGCGGACACATTGGGAAGCTGG + Intergenic
1176362448 21:6009164-6009186 ATGCTGACTAATGGGGTAGATGG - Intergenic
1177017013 21:15803824-15803846 GTCCTGAGAAATAGGTAAGAGGG - Intronic
1178288614 21:31347097-31347119 GGCCTGAGAGATAGGGAAGAAGG - Intronic
1178347774 21:31846497-31846519 ATGCTAATAAATAGAGAAGAGGG - Intergenic
1179761070 21:43529381-43529403 ATGCTGACTAATGGGGTAGATGG + Exonic
1182387129 22:29953795-29953817 GAACAGACAAACAGGGAAGAGGG - Intronic
1183257016 22:36769131-36769153 GTGATGACAAATAGAAAAGCAGG - Intronic
1184593088 22:45498820-45498842 GTGCTGAGAACTAGAGAAGGGGG + Intergenic
950431229 3:12952380-12952402 GTGCTGACTGATGGGGAGGAGGG - Intronic
950593013 3:13952604-13952626 GAGGTGGCAAATGGGGAAGAAGG - Intronic
953224152 3:41001032-41001054 GTAATGAAAAATAGAGAAGAGGG + Intergenic
955013394 3:55043208-55043230 GTGCTGACAAGAAGGCAAAATGG - Intronic
955560813 3:60188098-60188120 GTGCTGACAAAAGGTGTAGATGG - Intronic
955830332 3:62994763-62994785 GTGTTCACAAATCAGGAAGATGG - Intergenic
955859483 3:63312504-63312526 CTGCTGACAGAAGGGGAAGATGG - Intronic
956536513 3:70282715-70282737 CTGGTGACAAATAAGCAAGAAGG - Intergenic
956619205 3:71203872-71203894 GTGCAGAGAAAAAAGGAAGATGG + Intronic
956651582 3:71509347-71509369 GTGATGACACAGAGGGAAGATGG - Intronic
957595633 3:82261745-82261767 ATGATGAGAAATAGAGAAGAGGG - Intergenic
958610774 3:96423350-96423372 GTGATGACTCATTGGGAAGATGG + Intergenic
960497775 3:118395516-118395538 ATCGTGACAAATAGGGAAGATGG - Intergenic
960498493 3:118406284-118406306 GAGCTGACATATAGGGGAAAGGG - Intergenic
960975499 3:123169880-123169902 CTGGTGACAGTTAGGGAAGAGGG - Intronic
961055191 3:123781487-123781509 GTGCTGACAAATGGGAGAGGGGG + Intronic
961690771 3:128667828-128667850 GAGGTGGCAAATGGGGAAGAAGG + Intronic
962396367 3:135018259-135018281 GTGCTGACAAGTGGCTAAGAAGG + Intronic
963268623 3:143264363-143264385 GGACTGACATAGAGGGAAGAGGG + Intergenic
963692614 3:148523602-148523624 GTTCTGAAAAATAGAGGAGAAGG + Intergenic
964269219 3:154937280-154937302 GTGCTAACAAATTTGGAAAATGG - Intergenic
964925622 3:161953194-161953216 GTGCTGGCAATTAGGGATGATGG + Intergenic
965121400 3:164562122-164562144 ATGATAACAAATAGGTAAGATGG - Intergenic
965336618 3:167435373-167435395 AGGCTGAGAAACAGGGAAGAAGG - Intergenic
965490011 3:169323921-169323943 GTGCTGAAAAATAGCCAAGGAGG - Intronic
966029998 3:175334364-175334386 GGAGTTACAAATAGGGAAGAGGG - Intronic
966067117 3:175831831-175831853 AGGGTGAGAAATAGGGAAGAAGG - Intergenic
966908426 3:184544244-184544266 GGGCTGACCAAAAGCGAAGAAGG - Intronic
968416187 4:436228-436250 ATGCTGATAAAAAGGGAAAAAGG + Intronic
971504569 4:27352201-27352223 ATGTTGACAAATAGGGACAATGG - Intergenic
973033160 4:45370709-45370731 GTGTTGAAAAATAGAGAAAAAGG - Intergenic
973581577 4:52349380-52349402 GAGGTGGCAAATGGGGAAGAAGG - Intergenic
975413787 4:74084893-74084915 GAGGTGACAAATGGGGAAGAAGG + Intergenic
975905096 4:79200377-79200399 GTTCTGGGAAAGAGGGAAGAAGG + Intergenic
977151530 4:93519258-93519280 GTGCTGAAACAAACGGAAGATGG + Intronic
980379208 4:131989798-131989820 ATGCTGATAAGAAGGGAAGAGGG + Intergenic
982240903 4:153298415-153298437 GTGAGGACAAAGAGGCAAGAAGG - Intronic
986048237 5:4061834-4061856 GTGATGACAGATGGAGAAGACGG + Intergenic
986910376 5:12548563-12548585 GTGAAGACAAATAAGAAAGAAGG + Intergenic
987106748 5:14647126-14647148 GGGCTGACAAACAGGGAGAAAGG + Intergenic
988912233 5:35854989-35855011 GCCCTGACAAATGGAGAAGATGG + Intronic
989359098 5:40579099-40579121 GTGCCGATAAATAGTGAAAAGGG + Intergenic
997043840 5:130289873-130289895 GTGCTTGCAAACAGGGAAGTTGG + Intergenic
999006083 5:147981091-147981113 GAGATGAGAACTAGGGAAGAAGG + Intergenic
999769804 5:154766820-154766842 GTGCTGACAACTAGGAAACTGGG - Intronic
1003294436 6:4811896-4811918 GAGCTGATGAATGGGGAAGAGGG - Intronic
1004400892 6:15287862-15287884 GAGCTCACAAATGGGGAAGTGGG - Intronic
1005252150 6:23959542-23959564 CTGTTGACAAGTAGAGAAGATGG - Intergenic
1005774373 6:29114734-29114756 GTGGAGAGAAATAGGGAAAATGG - Intergenic
1007738146 6:43994592-43994614 GTTCTGACCAAGAGGGAAGTGGG - Intergenic
1009038926 6:58154081-58154103 GTTCTGAAAAATAGAGAAGGAGG - Intergenic
1009214821 6:60908917-60908939 GTTCTGAAAAATAGAGAAGGAGG - Intergenic
1009478998 6:64131714-64131736 GTGCTGACAAGTGGTGAAGTGGG + Intronic
1009669935 6:66735139-66735161 GTGCTGAAAAATATGACAGAAGG + Intergenic
1009684760 6:66942882-66942904 GTGCTGAAAAATTAGGCAGAAGG + Intergenic
1010192456 6:73208601-73208623 GTGCAGACAAATGGGGAGAATGG - Intergenic
1010194110 6:73223283-73223305 GTGCAGACAAATGGGGAGAATGG - Intronic
1010196051 6:73241223-73241245 GTGCAGACAAATGGGGAGAATGG - Intronic
1014676524 6:124373909-124373931 ATGCTGAGAAATAGGGATGCAGG + Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1016809580 6:148247006-148247028 CTGCTGAAAATAAGGGAAGAAGG + Intergenic
1016938445 6:149465814-149465836 AAGCTGAAAAAGAGGGAAGATGG + Intronic
1017232731 6:152090648-152090670 GTGCTGAGAAATGGAGAAGGGGG + Intronic
1017886805 6:158606507-158606529 GTTCTTAAAAAGAGGGAAGATGG + Intronic
1018053267 6:160030096-160030118 GTGATGAGAAAGAGGGGAGAAGG - Intronic
1018432654 6:163735177-163735199 GTGCTGACAAATACTGCAAAGGG - Intergenic
1024882290 7:54101416-54101438 GTGCTGACAACTGGGGAATGTGG + Intergenic
1026170909 7:67953199-67953221 GTGATAAGAAATAGGGAAGTAGG + Intergenic
1027243575 7:76350069-76350091 GTGCTGAAAAATGGTGAAGCTGG + Intronic
1027776120 7:82466515-82466537 GAGCTGAAAAATATGGAACATGG + Intergenic
1028651010 7:93150682-93150704 GAGGTGGCAAATGGGGAAGAAGG + Intergenic
1030352008 7:108500269-108500291 ATGGTGAAAAATAGGGAAAATGG - Intronic
1032131027 7:129227716-129227738 GTGCTGAAAAAACAGGAAGATGG - Intronic
1033046099 7:137963270-137963292 GTGCTGACTAAGTGGGAACAGGG - Intronic
1036045851 8:5139591-5139613 GTGTTGACACAAATGGAAGATGG - Intergenic
1039737542 8:40348642-40348664 GTGATGAGAAAGAGGGAGGAAGG - Intergenic
1040744541 8:50625332-50625354 GTGCTTACAAAAAGGGAAGTGGG - Intronic
1042892472 8:73627445-73627467 GTATTCACAAACAGGGAAGAAGG - Intronic
1043663744 8:82781857-82781879 TAGCTGATAAATTGGGAAGATGG - Intergenic
1045002423 8:97889918-97889940 ATGCTGACAACCAGGGAAGGTGG - Intronic
1046347562 8:112953106-112953128 GTGTAGACAAATTGAGAAGAGGG + Intronic
1046524603 8:115368719-115368741 GAGCAGACAAGTAGGGTAGAGGG - Intergenic
1047470170 8:125163379-125163401 CTGCTTACAAAATGGGAAGAGGG - Intronic
1050685452 9:8163712-8163734 GGGCTGGCAAATAAGGAGGATGG - Intergenic
1051544204 9:18255833-18255855 CTTCTGACAAAGAGGGTAGATGG - Intergenic
1052791884 9:32882869-32882891 TTAATGACTAATAGGGAAGAGGG - Intergenic
1056368644 9:85932176-85932198 TTGCTGACAATTGTGGAAGATGG - Intergenic
1188160270 X:26791739-26791761 GTGAAGACAGATAGGGAAGAGGG - Intergenic
1188557078 X:31424541-31424563 GTGCTTACAAAGATGGAAGATGG + Intronic
1188838690 X:34989077-34989099 GTGGTGGCGAACAGGGAAGAAGG - Intergenic
1189238437 X:39506991-39507013 GAGCTGATAATGAGGGAAGAGGG + Intergenic
1189844794 X:45125122-45125144 GTTCTGACAAATAGAGGAGGAGG - Intergenic
1192302440 X:69919206-69919228 GTGATGACTAAGGGGGAAGAGGG + Intronic
1194083290 X:89494933-89494955 GTTCTGAAAAATAGAGAAGAAGG - Intergenic
1194386051 X:93256552-93256574 GTGATGACAAAAGTGGAAGATGG - Intergenic
1194616532 X:96110504-96110526 ATGCTGACAAAAAGGGTAGATGG + Intergenic
1194967347 X:100303728-100303750 TTGCTGAAAAAAAGGGAAGAAGG - Intronic
1195476401 X:105290617-105290639 ATGGTGACAAATTGGGAAGGGGG + Intronic
1196641096 X:118062042-118062064 GTGATGAGAAATAGAGAGGATGG - Intronic
1196975382 X:121152956-121152978 GAGGTGGCAAATAAGGAAGAAGG + Intergenic
1197260161 X:124308864-124308886 CTGCTGAAAAGTGGGGAAGAAGG - Intronic
1197717646 X:129720836-129720858 CTGCTGACACACAGTGAAGAGGG - Intergenic
1199286537 X:146060486-146060508 GTTATGACACATAGGCAAGAGGG + Intergenic
1199398461 X:147368101-147368123 GTGCTGAGAAATAAGGCAGGAGG + Intergenic
1199982135 X:152926996-152927018 GGGCAGACACAGAGGGAAGACGG - Intronic
1199986096 X:152952704-152952726 GTGGTGAAAAGAAGGGAAGAGGG + Intronic
1200050221 X:153425318-153425340 GTTCGGACAGACAGGGAAGAAGG + Intergenic
1200063216 X:153492771-153492793 GAGCAGACCAGTAGGGAAGAGGG - Intronic
1200110545 X:153738566-153738588 GTCCTGACAGAAAGGGGAGACGG - Intronic
1200183982 X:154169854-154169876 GTCCTGACAGAAAGGGGAGACGG - Intergenic
1200189636 X:154206982-154207004 GTCCTGACAGAAAGGGGAGACGG - Intergenic
1200195389 X:154244791-154244813 GTCCTGACAGAAAGGGGAGACGG - Intergenic
1200201041 X:154281912-154281934 GTCCTGACAGAAAGGGGAGACGG - Intronic
1200435941 Y:3150807-3150829 GTTCTGAAAAATAGAGAAGAAGG - Intergenic
1201241669 Y:11962762-11962784 GTGATCACAAATATGGAAGCAGG - Intergenic
1201287463 Y:12391430-12391452 GTGCAGACAGATTGGGGAGAAGG - Intergenic
1201473373 Y:14357004-14357026 GTGCAAACAAATAGTGAAGAAGG + Intergenic
1201505710 Y:14697150-14697172 TTGCTGACCATTAGAGAAGATGG + Intronic
1202023833 Y:20498111-20498133 ATTCTGAAAAATAGAGAAGAAGG - Intergenic
1202368740 Y:24183510-24183532 GAGTGGACAAACAGGGAAGAAGG + Intergenic
1202502045 Y:25486607-25486629 GAGTGGACAAACAGGGAAGAAGG - Intergenic