ID: 934642205

View in Genome Browser
Species Human (GRCh38)
Location 2:96033377-96033399
Sequence GCTCTTTGCCGGGCAGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 2, 1: 0, 2: 0, 3: 18, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934642205_934642210 -2 Left 934642205 2:96033377-96033399 CCCAAGCCTGCCCGGCAAAGAGC 0: 2
1: 0
2: 0
3: 18
4: 120
Right 934642210 2:96033398-96033420 GCCATTCGAAGCCCTCCTCCAGG 0: 2
1: 0
2: 0
3: 4
4: 88
934642205_934642212 -1 Left 934642205 2:96033377-96033399 CCCAAGCCTGCCCGGCAAAGAGC 0: 2
1: 0
2: 0
3: 18
4: 120
Right 934642212 2:96033399-96033421 CCATTCGAAGCCCTCCTCCAGGG 0: 2
1: 0
2: 1
3: 6
4: 85
934642205_934642213 5 Left 934642205 2:96033377-96033399 CCCAAGCCTGCCCGGCAAAGAGC 0: 2
1: 0
2: 0
3: 18
4: 120
Right 934642213 2:96033405-96033427 GAAGCCCTCCTCCAGGGCTATGG 0: 2
1: 0
2: 1
3: 17
4: 203
934642205_934642218 23 Left 934642205 2:96033377-96033399 CCCAAGCCTGCCCGGCAAAGAGC 0: 2
1: 0
2: 0
3: 18
4: 120
Right 934642218 2:96033423-96033445 TATGGTTTCATCTCCCTACGTGG 0: 2
1: 0
2: 0
3: 4
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934642205 Original CRISPR GCTCTTTGCCGGGCAGGCTT GGG (reversed) Intronic
900154458 1:1198399-1198421 GTTCTGTGCCAGGCAGGCTGGGG - Intergenic
901051148 1:6426446-6426468 CCTCTGGGCTGGGCAGGCTTGGG + Intronic
901205227 1:7490856-7490878 GCTCTTTCCTGGGAAGACTTTGG + Intronic
901632833 1:10656232-10656254 GCTCACTGGCGGGCAGCCTTGGG + Intronic
902659700 1:17892481-17892503 GCTGTTTGCCAGCCAGGCTGGGG + Intergenic
902783643 1:18719635-18719657 GCCCCTTGCCGGGGAGGCTCCGG - Intronic
903500867 1:23799660-23799682 GTCCTTTGCCAGGCAGGCTGAGG + Intronic
908051668 1:60239486-60239508 GCTCTTTGGCTGGGAGTCTTGGG - Intergenic
910657679 1:89634086-89634108 GCTGTATACCGGGCAGGCGTGGG - Intronic
918904823 1:190478282-190478304 GCGCTGTGCCGGTGAGGCTTAGG + Intergenic
922228981 1:223669115-223669137 GCTCCTTGCCAGGCAGCCTGAGG + Intergenic
922705749 1:227789217-227789239 GCTCCTTCCCGGTCAGGTTTGGG - Intergenic
923002416 1:230018476-230018498 GTTCTCTGGCGGGCAGGCGTGGG - Intergenic
923214458 1:231835414-231835436 GTTCTTTGGCGGGCAGGAGTGGG + Intronic
924180285 1:241434102-241434124 GCTCTCTGGCGGGCAGGAGTTGG - Intergenic
1062934409 10:1375166-1375188 CCTTTGTGCCGGGCAGCCTTGGG + Intronic
1065437293 10:25716633-25716655 GTTCTCTGGCGGGCAGGGTTGGG - Intergenic
1065438179 10:25722729-25722751 GTTCTCTGGCGGGCAGGGTTGGG - Intergenic
1069870264 10:71528749-71528771 GCATGTTGCAGGGCAGGCTTGGG - Intronic
1070112075 10:73495912-73495934 GCTCTGGGCCGGGCGGGGTTGGG + Exonic
1070741205 10:78904365-78904387 CCTCTTTGGAGGGCAGGATTAGG + Intergenic
1071561560 10:86650012-86650034 GCTCTTGGCTGGGCAGCATTTGG - Intergenic
1071600093 10:86954812-86954834 GCTCTGTGCCCGGCAGGGGTCGG + Intronic
1073132807 10:101201178-101201200 GCTCTCTGGCGGGCAGGAGTGGG + Intergenic
1074943276 10:118255486-118255508 GTCATTAGCCGGGCAGGCTTAGG + Intergenic
1075710278 10:124527047-124527069 GCTCTGTGGCGGGCAGGCTCTGG - Intronic
1075814392 10:125253696-125253718 GCTCTCTGCCAGGCAGGAATTGG + Intergenic
1076248659 10:128967263-128967285 GCTGTTTGCTGGGAAGGCTCTGG - Intergenic
1079001455 11:16760662-16760684 GCTATGTGCCAGGCAGTCTTAGG + Intergenic
1079137570 11:17784629-17784651 GCTGTGTGTCGGGGAGGCTTGGG - Intergenic
1084199423 11:67545508-67545530 GCTCTTTGATTGGCAGGGTTTGG - Intergenic
1085274614 11:75290272-75290294 GGTCTTTGCAGGGCAGGCTGCGG + Intronic
1092167747 12:6353426-6353448 GCGCTTAGCTGGGCAGGCTCTGG - Intronic
1100183207 12:92107662-92107684 GCTCGTTGCCAGGCAGGCCCGGG - Intronic
1104417040 12:128604079-128604101 GCTCCTTGCTGGAAAGGCTTTGG - Intronic
1105210777 13:18255577-18255599 GCTCTGTGCCATGCAGGCTTAGG + Intergenic
1106823478 13:33492035-33492057 GTTCTTTGGCGGGCAGGGGTGGG + Intergenic
1111631237 13:90848750-90848772 GTTCTTTGGCGGGCAGGAGTGGG + Intergenic
1113492056 13:110699960-110699982 TCTCTTTCCCGTGCAGGCTGAGG - Intronic
1119759046 14:77138847-77138869 GCTCTGTGCCAGGCAGGACTAGG - Intronic
1122348730 14:101075956-101075978 GCTCTGTTCCGGGCATGCTTTGG - Intergenic
1124142346 15:27088453-27088475 GCTGTGTGCCGGGCAGGCTGCGG + Intronic
1124153891 15:27208539-27208561 CCTCATTGCAGGGCTGGCTTGGG + Intronic
1130414548 15:83680027-83680049 ACTCTTTGCAGGGCAGGAGTTGG + Intronic
1131757416 15:95580346-95580368 TTGCTTTGCTGGGCAGGCTTGGG - Intergenic
1137830064 16:51535918-51535940 CCTCCTTGCCAGACAGGCTTGGG + Intergenic
1138127105 16:54448014-54448036 CCTCTTTGCCGGGGAAGGTTTGG - Intergenic
1138228087 16:55316148-55316170 TCTGATTGCCTGGCAGGCTTTGG - Intergenic
1139661116 16:68421485-68421507 GCTCATTGCCATGCTGGCTTTGG - Intronic
1141038797 16:80654171-80654193 GCGCTCTGCCGGGCTGGGTTGGG + Intronic
1142428996 16:90016396-90016418 GCTCAATGCCAGGCAGGCATGGG + Intronic
1143844995 17:9767238-9767260 GGTGTTTTCCCGGCAGGCTTTGG + Intergenic
1144338592 17:14295067-14295089 GCTCTCTTCCGGGCGGGCATCGG - Intergenic
1145989708 17:29071649-29071671 TCTCTTTGGCGGGGAGGATTGGG - Intergenic
1152708070 17:81855662-81855684 GCTCTCTGCCAGCCAGGCTGAGG + Intronic
1156450387 18:37263265-37263287 GCTCTCAGCCAGGCAGGCTGTGG + Intronic
1158440872 18:57473166-57473188 CCTCTTTGCAGGGCAGCCTCTGG - Intronic
1158947806 18:62463004-62463026 GCTCTTTGCTTTGCTGGCTTTGG - Intergenic
1159578464 18:70207481-70207503 AATCTTGGCCAGGCAGGCTTAGG - Intergenic
1160622447 18:80180530-80180552 GCTCTCTGCCGGGCACACTGCGG + Intronic
1163305044 19:16472363-16472385 GCGCTTTGCGGGGCAGGGTGAGG - Intergenic
1164128478 19:22340079-22340101 GCTCACTGCAGGCCAGGCTTAGG + Intergenic
1165092733 19:33395317-33395339 GCTCTGTGCCTGGCATGCTGCGG + Intronic
933491724 2:82993082-82993104 CCTCATTGCTGAGCAGGCTTAGG + Intergenic
934618688 2:95791180-95791202 GCTCTTTGCCGGGCAGGCTTGGG + Intergenic
934642205 2:96033377-96033399 GCTCTTTGCCGGGCAGGCTTGGG - Intronic
946621933 2:221571507-221571529 GCTCTTCGCCCCGCAGACTTGGG - Intronic
948394172 2:237632356-237632378 GCTCTCTGCGGGCCAGGCTGAGG + Intronic
948844015 2:240674640-240674662 GCCCTTTGCCTGGCAGGATCTGG + Intergenic
948849795 2:240699995-240700017 GCCCTTTGCCTGGCAGGGTCTGG - Intergenic
1171291918 20:23987266-23987288 GCTCTGTGCCATGCAGGCTTAGG + Intronic
1172097559 20:32467760-32467782 CCTCCTTGCCAGGCAGCCTTGGG - Intronic
1174304529 20:49605683-49605705 ACTCTTTCCTGGGCAGGGTTGGG - Intergenic
1174419337 20:50389589-50389611 GCTCTGTGCCGGGCAGGCGCTGG - Intergenic
1175900614 20:62358548-62358570 GCTCTCTGGCTGGCCGGCTTGGG - Intronic
1175905616 20:62378025-62378047 TCCCTTTGCAGGGCAGCCTTAGG + Intergenic
1178352780 21:31884808-31884830 ACTCTTTGTCGGCCAGGCTGGGG + Intronic
1180765478 22:18343840-18343862 GCTCTGTGCCATGCAGGCTTAGG - Intergenic
1180780837 22:18518552-18518574 GCTCTGTGCCATGCAGGCTTAGG + Intergenic
1180813551 22:18775859-18775881 GCTCTGTGCCATGCAGGCTTAGG + Intergenic
1180919670 22:19515003-19515025 GGTGTTTGCTGAGCAGGCTTAGG - Exonic
1181028310 22:20138088-20138110 GCTCTTGGCCAGGCGGGCGTGGG + Intronic
1181199735 22:21210189-21210211 TCTCTGTGCCATGCAGGCTTAGG + Intronic
1181400026 22:22645669-22645691 GCTCTGTGCCATGCAGGCTTAGG - Intronic
1181649337 22:24250121-24250143 GCTCTGTGCCATGCAGGCTTAGG + Intergenic
1181702001 22:24626767-24626789 GCTCTGTGCCATGCAGGCTTAGG - Intronic
1184719311 22:46300640-46300662 GCTAGGTGCCAGGCAGGCTTGGG - Intronic
1203227100 22_KI270731v1_random:84730-84752 GCTCTGTGCCATGCAGGCTTAGG - Intergenic
1203263651 22_KI270734v1_random:1541-1563 GCTCTGTGCCATGCAGGCTTAGG + Intergenic
950487322 3:13281440-13281462 GCTCTGTGCGTGGCAGGCGTGGG - Intergenic
952967216 3:38628784-38628806 GCTCTTTGCTAGGCACGCTGGGG - Intronic
958881009 3:99669848-99669870 GCTCTTTGAGGGGTGGGCTTGGG + Intronic
961483989 3:127204816-127204838 GCTCTTGCCTGGACAGGCTTGGG + Intergenic
961497493 3:127304989-127305011 TCCCTTTGGCAGGCAGGCTTTGG + Intergenic
963041250 3:141071656-141071678 GCTCAGTGGTGGGCAGGCTTGGG - Intronic
965626685 3:170688982-170689004 GTTCTTTGGCGGGCAGGAGTGGG + Intronic
966289883 3:178343346-178343368 GCTGCTTGCAGGGCAGTCTTGGG + Intergenic
968271616 3:197407638-197407660 CCTCTTCACAGGGCAGGCTTCGG - Intergenic
969343480 4:6556956-6556978 GATCTCTGCCGGGGAGTCTTTGG - Intronic
970101177 4:12524339-12524361 CCTGTTTGCAGGGCAGTCTTGGG + Intergenic
973669107 4:53196510-53196532 GGTCTTTGCCTGGCTTGCTTAGG - Intronic
975389435 4:73799643-73799665 GCTCTGTGCTGCGTAGGCTTAGG - Intergenic
975735175 4:77373615-77373637 GCTCTCTGCCAGTGAGGCTTAGG + Intronic
984393939 4:179170295-179170317 GTTCTTTGGCGGGCAGGAGTGGG + Intergenic
985679009 5:1246332-1246354 GCGCTTGGCCGGGCTGGCTCAGG + Intergenic
986050072 5:4081724-4081746 GCTCTTTTCCTGGAAGTCTTTGG + Intergenic
986729929 5:10627925-10627947 GCTCTTTGCAGGGCAGGCAGGGG - Intronic
986919944 5:12668058-12668080 GTTCTTTGGCGGGCAGGAGTGGG + Intergenic
990574814 5:57114220-57114242 GCTCTTTGCCATGAAGGTTTGGG - Intergenic
995878993 5:116822463-116822485 GTTCTCTGGCGGGCAGGCGTGGG - Intergenic
998735633 5:145137109-145137131 GATCTTTGCCCGGCAGGGTGCGG + Intergenic
999019974 5:148154386-148154408 TCTGTTTGCAGTGCAGGCTTTGG + Intergenic
1008497637 6:52149291-52149313 GCTCTTCCCCTGGCTGGCTTAGG - Intergenic
1010841620 6:80653150-80653172 GTTCTCTGGCGGGCAGGGTTGGG + Intergenic
1012895547 6:104941625-104941647 GCTTTGTACCGGGCAGGCGTCGG + Intergenic
1013407432 6:109855951-109855973 GTTCTTTGGCGGGCAGGAGTGGG + Intergenic
1019261178 7:82728-82750 GCTCTTAGCTGGGCAGGCCGAGG - Intergenic
1019713017 7:2525952-2525974 GCTCTGAGCAGGTCAGGCTTGGG - Intronic
1021540299 7:21749895-21749917 GATGTTTGCTGGGCAGTCTTTGG + Intronic
1022042252 7:26592205-26592227 GCTGTGTGCCAGGCAGCCTTGGG + Intergenic
1023780184 7:43647879-43647901 GCTCTGTGCTGGGCTGGCTGGGG - Intronic
1024526557 7:50354408-50354430 GCCCTGTGCCTGGGAGGCTTTGG - Intronic
1025251611 7:57354894-57354916 GCTCTGTGCCGGGCAGGCGCTGG + Intergenic
1026976356 7:74501191-74501213 GTTCACTGCCGGGCAGGGTTGGG + Intronic
1028240863 7:88418836-88418858 GCCCATTGCCAGTCAGGCTTGGG + Intergenic
1030234340 7:107242453-107242475 TCTCTTCACCGGGCAGGCCTGGG + Intronic
1030820834 7:114088221-114088243 GCTCCCTGGTGGGCAGGCTTTGG + Intronic
1031727500 7:125259129-125259151 GTTCTCTGCCGGGCAGGAGTGGG - Intergenic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1038690632 8:29759863-29759885 ATTCTGTGCCAGGCAGGCTTTGG + Intergenic
1048292195 8:133189754-133189776 GCTGTGTGATGGGCAGGCTTTGG + Intergenic
1050332273 9:4557320-4557342 GCTCTTTGCCTTGCAAGCATGGG - Intronic
1050895788 9:10885194-10885216 GTTCTCTGCGGGGCAGGGTTGGG - Intergenic
1051742442 9:20264938-20264960 GCTCATTGCCGGAGTGGCTTAGG - Intergenic
1052720160 9:32164537-32164559 GCTCTCTGGCGGGCAGGTGTGGG + Intergenic
1054763552 9:69024290-69024312 GCTCTTTCCAGACCAGGCTTGGG - Intergenic
1062634048 9:137480688-137480710 GCTCGTTGAGGGGCAGGCTGGGG + Intronic
1185682924 X:1903364-1903386 GGTCTTTGCAGAGCAGGATTTGG + Intergenic
1198684353 X:139211836-139211858 GCTCCCTGCCGGGTAGGCTAAGG + Intronic
1202075681 Y:21036095-21036117 GTTCTCTGCCGGGCAGGAATAGG + Intergenic