ID: 934642743

View in Genome Browser
Species Human (GRCh38)
Location 2:96036600-96036622
Sequence CCTGCCCCCAGCCACAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 695
Summary {0: 2, 1: 0, 2: 7, 3: 61, 4: 625}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934642743_934642749 0 Left 934642743 2:96036600-96036622 CCCTCCCTGTGGCTGGGGGCAGG 0: 2
1: 0
2: 7
3: 61
4: 625
Right 934642749 2:96036623-96036645 TGTTCCCTGAAGGCACTGACAGG 0: 2
1: 0
2: 0
3: 30
4: 173
934642743_934642753 23 Left 934642743 2:96036600-96036622 CCCTCCCTGTGGCTGGGGGCAGG 0: 2
1: 0
2: 7
3: 61
4: 625
Right 934642753 2:96036646-96036668 CCTTTCTCCTGTATATCACCTGG 0: 2
1: 0
2: 1
3: 26
4: 162
934642743_934642748 -10 Left 934642743 2:96036600-96036622 CCCTCCCTGTGGCTGGGGGCAGG 0: 2
1: 0
2: 7
3: 61
4: 625
Right 934642748 2:96036613-96036635 TGGGGGCAGGTGTTCCCTGAAGG 0: 2
1: 0
2: 1
3: 18
4: 249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934642743 Original CRISPR CCTGCCCCCAGCCACAGGGA GGG (reversed) Intronic
900237800 1:1600808-1600830 CCTCCCCACAGCCATCGGGAGGG - Intergenic
900301542 1:1980502-1980524 GCAGCCCCCGGGCACAGGGATGG + Intronic
900530606 1:3151188-3151210 CCTGCCCCCATGCCCAGCGAGGG - Intronic
900542402 1:3209731-3209753 CCTGGCCCAACCCTCAGGGAAGG - Intronic
900709859 1:4106964-4106986 CCTGACCACAGCCCCAGAGAGGG - Intergenic
900754083 1:4421509-4421531 CCTGCCCCCCAACACTGGGATGG + Intergenic
900801197 1:4738172-4738194 GCAGCCCCCAGCCACATGGCAGG + Intronic
901060024 1:6467691-6467713 CCTGCGCCCAGACACTGGGCAGG + Intronic
901144761 1:7057414-7057436 CCTGCTGCCTGCCACACGGAGGG - Intronic
901168545 1:7237060-7237082 CCTGCCACAAGGCACAGGGAAGG - Intronic
901829374 1:11882877-11882899 CCTGCTCCCAGCCTCAAGGCCGG - Intergenic
901843185 1:11966347-11966369 CCTGCCCCCTGCAGCAGGCAAGG - Intronic
901857666 1:12054578-12054600 CCCACTCCCAGCCACATGGAGGG + Intergenic
901936447 1:12630331-12630353 CCTGCCCCAACACAGAGGGATGG - Intergenic
902239780 1:15080827-15080849 CATGCCCTAAGGCACAGGGAGGG - Intronic
902503272 1:16924326-16924348 CCTGCTGCCGGCCACAGAGATGG + Exonic
902580541 1:17404920-17404942 CCATCCCCCAGCCACAGGCCTGG + Intergenic
902700645 1:18169620-18169642 CCTGCCCCCAGCCCAGGGTAGGG + Intronic
902788592 1:18749620-18749642 CCAGCCCCCAGCCTCAAGGTGGG - Intergenic
902823850 1:18959271-18959293 GCTGCCCCCACCCTCAAGGAGGG - Intergenic
903019553 1:20384555-20384577 CAGTCCCCCAGCCACAGGAAGGG - Intergenic
903071991 1:20731284-20731306 CCTGCCCTGGGCCACAGGGTCGG + Intronic
903233726 1:21936927-21936949 CCCGCCCCCAGCCCCACGAAGGG + Intronic
903368413 1:22818920-22818942 CCCGCCCCCAGGCTCAGAGATGG + Intronic
903448519 1:23437376-23437398 CCGGCCCCCACCCACAAGGCTGG + Intronic
903536046 1:24066982-24067004 CCTGCCCCCAGGCCCAGTGCAGG - Intronic
903666074 1:25008530-25008552 CCTGGCCCCAGCCACAGCCCTGG + Intergenic
903859275 1:26355199-26355221 CCAGCCCTCAGCCCCAGGGCGGG - Intergenic
904258650 1:29273913-29273935 CTTGCCCACAGTCACAGAGATGG - Intronic
904311800 1:29633962-29633984 CTTCCCTCCAGCCTCAGGGAAGG - Intergenic
904494412 1:30878586-30878608 ACTGCCCCCAGGCAGAGGTAGGG + Intronic
904594006 1:31631778-31631800 TCTGCCCCCAGTAAAAGGGAGGG - Intronic
904892692 1:33791351-33791373 CATGCTCCCAGGCACTGGGATGG - Intronic
905013743 1:34763254-34763276 TCTGCCCTCCGCTACAGGGATGG + Exonic
905399504 1:37691576-37691598 TCTGCCCACGGCCACAGGGTTGG - Intronic
905816439 1:40954593-40954615 CCTCCCCCCAGACACATGCACGG - Intergenic
906057021 1:42925132-42925154 CCTGTCCCCAGGCTCAGGCAGGG + Intergenic
906079859 1:43078530-43078552 CCTGCCACCAGCCACATGAGTGG + Intergenic
906411850 1:45584736-45584758 CCCGCCCCCTGCCCCAGGGCCGG - Intronic
906723043 1:48023213-48023235 CCTAACCCCATCCACATGGAGGG + Intergenic
907111332 1:51929061-51929083 GCCTCCCCCAGCCACTGGGATGG + Intronic
907366233 1:53963043-53963065 AAAGGCCCCAGCCACAGGGAAGG - Intronic
907475662 1:54703735-54703757 GCTGCCCACAACAACAGGGAAGG - Intronic
907830623 1:58061026-58061048 CCTTTCCCCTGCCAAAGGGAGGG - Intronic
908128291 1:61050957-61050979 CCTGCCCCCACCCACCGGCGCGG - Intronic
909079135 1:71087891-71087913 CCTGCCCACACTCACAGAGAGGG + Intergenic
909701652 1:78531097-78531119 CAAACCTCCAGCCACAGGGATGG - Intronic
910261995 1:85302229-85302251 CCAACCCCCAGGCACAGGGCTGG + Intergenic
912383586 1:109260512-109260534 CCTGGTCCCATCCCCAGGGAGGG + Intronic
912500511 1:110119032-110119054 CCTGCCCACATTCAGAGGGAGGG + Intergenic
912798087 1:112704956-112704978 CTTGCCCTGAGTCACAGGGAGGG - Intronic
912949008 1:114107543-114107565 CTTGCCACCAGGCACAGTGAGGG - Intronic
913196722 1:116462868-116462890 CCTGGCCACAGCCAAAGGGCTGG + Intergenic
914883112 1:151562892-151562914 CCTGGCCCCAGGCAAGGGGATGG + Intronic
915330258 1:155107221-155107243 CCTGCCCCCAACCCCAGGAGTGG + Intergenic
915451627 1:156009378-156009400 CCTGCTCTCAGCCATAGTGAAGG - Exonic
917927056 1:179798297-179798319 AATGCCCTCAGCCACACGGATGG - Intronic
918429421 1:184443715-184443737 CTTCCCCCTAACCACAGGGAAGG + Intronic
919855904 1:201705869-201705891 CCTGCCCCCAGCCACACTGTAGG + Intronic
919866846 1:201788857-201788879 CCCTCCCCCAGCCCCAGTGATGG - Intronic
920101910 1:203522067-203522089 CCTGCCACCAGACAGAGGCAGGG + Intergenic
920194305 1:204216808-204216830 CCTGCCCCCACCCCCAGCCATGG + Intergenic
920206591 1:204296633-204296655 TCTGCAGCCAGCCACAGAGAAGG - Intronic
920388270 1:205582883-205582905 CCTGCCTCCAGGGGCAGGGAAGG + Intronic
920837646 1:209526467-209526489 CCTGCCCCAAGACACAGCAAAGG + Intergenic
920945479 1:210524548-210524570 TCTTCCTCCAGCCTCAGGGAGGG - Intronic
921273578 1:213494128-213494150 CCTGCCCCCGGCTACAGAAATGG + Intergenic
921374524 1:214460095-214460117 CCTGCCCACAGTCACTGGGCTGG - Intronic
922161211 1:223080348-223080370 ACTGTCCCCAGCCACAGGACAGG + Intergenic
922617852 1:226973667-226973689 GCTGCCCCCAGCCTCAGGGGAGG - Intronic
922764005 1:228148354-228148376 CCAGGCCCCACCCACAGGCAAGG + Intronic
922780733 1:228250371-228250393 CCTTGGCCCAGCCACAGGGATGG - Intronic
922782572 1:228264522-228264544 CCTTGGCCCAGCCACAGGGATGG - Intronic
922801603 1:228367180-228367202 CCTGCCCTCAGCCCCTGAGACGG + Intronic
922804312 1:228377738-228377760 CCTGCCCCCCGCCCCAGGTGAGG - Intronic
1063105600 10:2989060-2989082 CCTGCCCCCATCACCAGTGAGGG - Intergenic
1064141346 10:12793217-12793239 ACTTTCCCCAGCCCCAGGGAAGG - Intronic
1066705756 10:38175830-38175852 CCTGGCCCCAGCCACAGCTTGGG - Intergenic
1069658034 10:70104958-70104980 CCGACCCCCTGCCACAGGGTGGG - Intronic
1069813578 10:71179714-71179736 CCTGCCTCCAGCACCTGGGAGGG - Intergenic
1070140141 10:73732783-73732805 CCGGGCCCCAGCCGCAGGGCTGG - Intergenic
1070683320 10:78464508-78464530 CTTGTCCCCAGCCAGAAGGAGGG + Intergenic
1070779070 10:79127097-79127119 CCTGTCCCCAGCAGGAGGGAAGG - Intronic
1070923484 10:80203730-80203752 CCTGCTCCCAGCAGGAGGGACGG - Intronic
1072006522 10:91255162-91255184 CTTTCCCCCACCCACAGAGAAGG - Intronic
1073249981 10:102115227-102115249 CCTCCCCCGAGCCCCAGGCACGG + Intronic
1073295916 10:102438620-102438642 CCTAGCCCCAGCCCCAGTGAGGG - Intergenic
1073792500 10:106954798-106954820 CCTGCCCTCAGCCACACGTTGGG + Intronic
1074297009 10:112199243-112199265 ACTGCGCCCAGCCACCTGGAGGG + Intronic
1074925513 10:118065927-118065949 CCTGCCCACACTCAAAGGGAGGG - Intergenic
1075297712 10:121292635-121292657 CCTGCCCCCACCGCCGGGGAGGG - Intergenic
1076045800 10:127293383-127293405 CATGGCACCAGCCACAGGTAAGG - Intronic
1076353420 10:129834175-129834197 CCAGCCTCCAGCCACTTGGAAGG + Intergenic
1076642643 10:131929232-131929254 CCTCCTCCCAGCCACTGGGCAGG + Intronic
1076714077 10:132354487-132354509 CCAGCCCCCAGCCCCAGCCAGGG - Intronic
1076894638 10:133303939-133303961 CCTGCCCCCTGACCCAGGGGTGG - Intronic
1076896710 10:133316764-133316786 CCACCCCCCAGACACAGAGATGG + Intronic
1076896943 10:133317640-133317662 CCCCCCCCCAGACACAGAGATGG + Intronic
1076896955 10:133317675-133317697 CCCCCCCCCAGACACAGAGATGG + Intronic
1076896967 10:133317710-133317732 CCCCCCCCCAGACACAGAGATGG + Intronic
1076896994 10:133317814-133317836 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897014 10:133317882-133317904 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897033 10:133317947-133317969 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897054 10:133318016-133318038 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897064 10:133318049-133318071 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897074 10:133318082-133318104 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897122 10:133318278-133318300 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897143 10:133318347-133318369 CCCCCCCCCAGACACAGAGATGG + Intronic
1076897153 10:133318380-133318402 CCCCCCCCCAGACACAGAGATGG + Intronic
1077017881 11:404935-404957 CATGCTGCCAGCCACAGGGTCGG - Intergenic
1077036100 11:495197-495219 CCTGCCCAGGGCCACAGGGACGG - Intronic
1077104700 11:837132-837154 CCAGCTCAGAGCCACAGGGAAGG - Intronic
1077279341 11:1735038-1735060 CCAGGCCCCAGACACAGGCAGGG + Exonic
1077467756 11:2741684-2741706 CCTGCCCCCACTCACAGCGATGG - Intronic
1078535701 11:12171561-12171583 TCAGCCTCCTGCCACAGGGAAGG + Intronic
1078825208 11:14923233-14923255 CCTGCCCCAAGTGCCAGGGATGG - Intronic
1079109777 11:17598833-17598855 CGTGCCCCTAGCCACATGGCGGG + Intronic
1079818566 11:25094620-25094642 CTGTCCCCCAGCCACAGGGCAGG - Intergenic
1079971523 11:27041302-27041324 CCTGCCCCCAGACACAGCTGAGG - Exonic
1080520519 11:33064506-33064528 CCTTCCCTCAGCCACACGGGTGG + Intronic
1080895561 11:36446459-36446481 CTTGCCCCAAGGCAGAGGGAGGG + Intronic
1081268193 11:41053156-41053178 CCTGTGCCCTGCCAAAGGGAAGG - Intronic
1081426593 11:42932596-42932618 CCTCTCCTCAGCCAAAGGGATGG - Intergenic
1081565265 11:44256883-44256905 CCTGCCCTTAGCCACTTGGATGG + Intergenic
1081651036 11:44824370-44824392 CCTGCCCCCAGCCCCAGTTGGGG - Intronic
1081692138 11:45085949-45085971 CTTGCCCCCAGCTTCAGGCAGGG - Intergenic
1081937126 11:46912786-46912808 CCTACACCCAGACAGAGGGAGGG + Intronic
1082092199 11:48099167-48099189 CCTGGACAGAGCCACAGGGATGG - Intronic
1083486286 11:62984701-62984723 TCAGCCCCCAGCCACTGGGCTGG - Exonic
1084031621 11:66484633-66484655 CCTTCCCCCAGCTCCAGGGGTGG - Intronic
1084043225 11:66554719-66554741 TCTGTCACAAGCCACAGGGAAGG + Intronic
1084399992 11:68937906-68937928 CCTGCCCCCAGGCACTGACAGGG + Intronic
1084409801 11:69000150-69000172 CCTGCCTCCAGCTCCTGGGAGGG + Intergenic
1084476923 11:69394470-69394492 ACTGACCCCAGCCATCGGGAAGG + Intergenic
1084478083 11:69400204-69400226 CCTACCCCCACTCCCAGGGATGG - Intergenic
1084480904 11:69419478-69419500 TCTGCCCCCTGCAGCAGGGAAGG - Intergenic
1084586227 11:70064311-70064333 TCTGACCCCAGCCACACAGATGG + Intergenic
1084698909 11:70773056-70773078 CCTGCCCACAGCCCTGGGGATGG - Intronic
1084974686 11:72790263-72790285 TCTGCCCACAGCCACATGGGAGG - Intronic
1085304313 11:75476586-75476608 CCTGCCCAAGGCCACAGGGCAGG - Intronic
1085307753 11:75497822-75497844 CCTGCTCCCAGCCCCATGGCCGG - Intronic
1085796154 11:79541819-79541841 AATGCCCCCAGCCAAGGGGAGGG - Intergenic
1086453394 11:86938721-86938743 CCTACCCCCAGCCCCTCGGAAGG - Intronic
1087301787 11:96444279-96444301 TCTTCTCCCAGCTACAGGGATGG + Intronic
1088888102 11:114023282-114023304 CCTGCCCCGAGGCAGAAGGATGG - Intergenic
1088906046 11:114156232-114156254 CCTGTCACCTGCCAGAGGGATGG + Intronic
1089165406 11:116472140-116472162 CCAGCCCCCAGCTCTAGGGAGGG + Intergenic
1089192091 11:116660604-116660626 CCTGCACCCAGCCAGGGGGATGG + Intergenic
1089442902 11:118531240-118531262 CCCGCCCCCCGCCACCGGGGCGG - Intronic
1090241147 11:125182764-125182786 CCTGCCAGCAGCTACAGAGAAGG + Intronic
1090390396 11:126383922-126383944 CCTGTCCCCAGGAACAGAGAAGG - Intronic
1091100037 11:132863533-132863555 TCTGCCGCCAGCCTCAGGGGAGG - Intronic
1091104150 11:132902690-132902712 CCTCACCCCTGGCACAGGGAGGG + Intronic
1091157237 11:133385020-133385042 CCTGCCCACAGCCACAAGGAGGG - Intronic
1091230787 11:133986751-133986773 CGGGCTCCCAGCCAGAGGGAAGG - Intergenic
1091346108 11:134855278-134855300 CCGGCCCCCATCCTCAGGAAAGG + Intergenic
1091386905 12:101568-101590 CCTGTCCCCAGCCAGGGGGAGGG - Intronic
1091692049 12:2604022-2604044 CCTGCCCCGACCCAGAAGGAGGG - Intronic
1092167101 12:6348916-6348938 CCTGGTCCCAGCCACAAGAAGGG - Intronic
1092312577 12:7374484-7374506 GCTGCCCCCAGCCGCGGGAAGGG + Exonic
1092856068 12:12674951-12674973 CCTGACCCCAGCCCAGGGGAGGG - Intronic
1094526614 12:31235296-31235318 CCTGTCCCCAGGCACAGAGAGGG - Intergenic
1095198687 12:39356297-39356319 CTTGCCCCCAGCCCCAGTCATGG + Intronic
1095844802 12:46732978-46733000 CCTGGCAACTGCCACAGGGAAGG + Intergenic
1095982007 12:47979335-47979357 CCTGCCCCCAGCCACCCTCAGGG + Intronic
1096024576 12:48350329-48350351 CCTGGCCCCTGCCACGGGTAGGG + Exonic
1096244195 12:49975245-49975267 CCTGGGCTCAGCCCCAGGGAGGG + Intronic
1096264453 12:50111991-50112013 CCGGCCTCCAGCCAGAGTGACGG + Exonic
1096585271 12:52615818-52615840 GCTGCTCTCTGCCACAGGGAAGG - Intronic
1097018568 12:56004387-56004409 CATGGCCCGAGCCAGAGGGATGG - Exonic
1097053612 12:56237765-56237787 CTTCCCCCCAACCACAGGAATGG + Exonic
1097580374 12:61448186-61448208 CCTGCCCAGAGCCAGAGGTAAGG - Intergenic
1097827241 12:64186743-64186765 CCTGGCCCCAGCCACCCGGGTGG - Intronic
1098302883 12:69071883-69071905 CCAGCCCCCAGCCACTGGGGAGG + Intergenic
1099723776 12:86398840-86398862 CCTGCCCCATACCAGAGGGAAGG + Intronic
1100613070 12:96208339-96208361 ACTGCACCCAGCCAGAGGGCAGG + Intronic
1101131805 12:101697801-101697823 CCTGCCCCCAGCGCCAGGCGCGG + Exonic
1101838796 12:108313133-108313155 CCTGTTCCCAGGCACAGGGAAGG + Intronic
1102663430 12:114549250-114549272 CCTGGACCCAGCCACACGGGGGG - Intergenic
1103253256 12:119519220-119519242 CCAGCCCCCAGCCTCAAGGCCGG + Intronic
1103476730 12:121224089-121224111 CCATTCCCCAGCCACAGAGATGG - Intronic
1103916860 12:124380255-124380277 CCAAGCCCCAGCCACAGGCAGGG + Intronic
1103943432 12:124513140-124513162 TCTGACCCCAGCCACAGAAAGGG + Intronic
1104003222 12:124873694-124873716 CCTCCCCTCAGCCCCAGGGTGGG + Intronic
1104309634 12:127642918-127642940 CCTCCCCCCATCCCAAGGGATGG + Intergenic
1104899219 12:132179333-132179355 ACTGGCCCCAGCCACACGCACGG - Intergenic
1105029203 12:132871068-132871090 CCAGCCCCTGGCCACACGGAAGG - Intronic
1105813371 13:24012903-24012925 CCTGTCCCCAGCCACAGCTGGGG - Intronic
1111871520 13:93838817-93838839 CCTGTCCCCAGAGTCAGGGATGG + Intronic
1112354929 13:98666213-98666235 CCAGCCAACAGCCACAGGAAGGG - Intergenic
1113244353 13:108377705-108377727 CCTTCCCCCAGCTTCAGGGGAGG - Intergenic
1113553956 13:111216348-111216370 CCTCCACCCAGCCACAGGGAAGG - Intronic
1113778517 13:112962704-112962726 CCTCCCCCCAGGCTCTGGGAGGG + Intronic
1113960051 13:114121192-114121214 CCTGCCCCCGGCCGCAGTGCTGG - Intronic
1113963882 13:114140827-114140849 CCTCCTCCCACCCACAAGGAAGG + Intergenic
1115641376 14:35337651-35337673 CCTGGCACTAGCCACAGGGGTGG - Intergenic
1115648176 14:35384533-35384555 CCTGCTCCCAGACACAAGCATGG + Intergenic
1115854109 14:37611263-37611285 CCGGCCCCTAGGCACAGGAAAGG + Intronic
1116187159 14:41611107-41611129 TCCGCCCTCAGCCTCAGGGAAGG + Intronic
1117328488 14:54690127-54690149 ACTGTCCCCACCCACAAGGAGGG + Intronic
1117402523 14:55371061-55371083 CCTGCAACCAGCTACAGGGTGGG + Intronic
1117971303 14:61253505-61253527 CCTGCCCCCCACCCCAGTGAAGG - Intronic
1118588686 14:67382737-67382759 CCCGTCCCCAGCCAGGGGGAAGG + Intronic
1118901002 14:69985721-69985743 CTGGCCCCAAGTCACAGGGAGGG - Intronic
1118904736 14:70015604-70015626 CTGGCCCCCACCCACAGGGGCGG - Intronic
1119208087 14:72809586-72809608 CCTGCCATCAGCCACATGCAGGG - Intronic
1119514744 14:75239345-75239367 CCTGCCCCCAGCCATGGTGGGGG - Intronic
1119662591 14:76462523-76462545 CCTGCAACCAGACACAGAGAGGG - Exonic
1119980590 14:79076459-79076481 CCTGCCACCAGCCATAGGTAAGG - Intronic
1120710212 14:87785697-87785719 CCACCCCCCAGCCCTAGGGAAGG + Intergenic
1121910624 14:97789199-97789221 CATGCCCCCTGGCACATGGAAGG - Intergenic
1122847480 14:104507819-104507841 CCTGCCCCACCCGACAGGGATGG + Intronic
1122924334 14:104892750-104892772 ACTCCCCACAGCCACAAGGAGGG - Intronic
1123036644 14:105474504-105474526 CCTGCCCGCCGCCCCGGGGACGG + Intronic
1202870332 14_GL000225v1_random:157169-157191 CCTTCCTCCAGGGACAGGGACGG + Intergenic
1123879262 15:24659898-24659920 CCTGACCACAGTCACTGGGAGGG + Intergenic
1124014679 15:25864630-25864652 CCATCCCCCAGTCACAGGGGTGG + Intronic
1124722149 15:32119742-32119764 CCTGCCCACTGCCACAGGCTGGG - Intronic
1125584841 15:40813007-40813029 CCAGCCCAGAGCCACAAGGAAGG + Intronic
1125767708 15:42146291-42146313 CCGGCCCCAGGCCACGGGGATGG - Intronic
1128107519 15:65055602-65055624 GCTTCCTCCAGCCACAGGCAGGG - Intronic
1128212406 15:65911983-65912005 CACGCCCCCCGCCACATGGAGGG - Intronic
1128249013 15:66151950-66151972 CCTGCCCCCCGCCCCATGGCAGG - Intronic
1128338228 15:66802262-66802284 CCTGCCCCCCGCCACACTGGTGG - Intergenic
1128451270 15:67807155-67807177 CCTGCCCCCAGCCCTGGGGGGGG - Intergenic
1128544030 15:68555468-68555490 CCAGCCCCCAGCCTCGGGGTGGG - Intergenic
1128757811 15:70195388-70195410 CCTGGCTCCAACCCCAGGGATGG - Intergenic
1128771219 15:70283902-70283924 CCTGATGTCAGCCACAGGGAAGG - Intergenic
1129455524 15:75674511-75674533 CCTGGCCTCAGCCAGTGGGATGG - Exonic
1130254529 15:82319803-82319825 CCTGCCCCCAGCCCCACTGGCGG + Intergenic
1130600436 15:85270167-85270189 CCTGCCCCCAGCCCCACTGGCGG - Intergenic
1131065704 15:89433771-89433793 CCTGCCCCCACCCAGAGAGAAGG - Intergenic
1131116502 15:89799381-89799403 CCTGCCCCCTGCCCCAGGACAGG - Intronic
1131234421 15:90683560-90683582 CCCGCCCCCAGCCACACCCATGG - Intergenic
1131989542 15:98079954-98079976 CCTACCCCCATCCACAGCCATGG + Intergenic
1132087369 15:98919284-98919306 CCTGCTGCCCGCCACACGGAAGG + Intronic
1132278603 15:100592435-100592457 CCTACCCCCAGTCTCAGGAAGGG - Intronic
1132289466 15:100689309-100689331 ACTGCTCCCAGCCAAAGGGCTGG + Intergenic
1132366936 15:101264675-101264697 CCAGACTCCTGCCACAGGGATGG - Intergenic
1132627088 16:896385-896407 TGTGCCCCCAACGACAGGGAGGG + Intronic
1132647641 16:1006538-1006560 CCAGCCCCCAGCACCAGGGGAGG + Intergenic
1132657377 16:1046919-1046941 CCCACCCTCAGCCACAGGGACGG + Intergenic
1132658248 16:1050154-1050176 CCTGCCCGCAGGCCCAGAGATGG - Intergenic
1132711238 16:1268910-1268932 CCTGCCCCCAACCCCAGAGCCGG - Intergenic
1132712230 16:1274145-1274167 CCTGCCCCCAGCCTCAGCTCAGG + Intergenic
1133115049 16:3573622-3573644 CCCGCCCCCAGCAGCAGGGCTGG - Intronic
1133235100 16:4384060-4384082 CCTGCCCCTGGCTACAGCGAGGG + Intronic
1133723547 16:8517001-8517023 CCAGCTCCCAGCCACAAAGATGG - Intergenic
1134084593 16:11347678-11347700 CCTGCCCTCAGCCGCAGCGTTGG + Intronic
1135725698 16:24852515-24852537 CCTCCCCGCGGGCACAGGGAGGG + Intronic
1136064726 16:27751015-27751037 CCTGCACCCAGCCACAGACCCGG + Intronic
1136365932 16:29809350-29809372 CCAGGCCCCAGGCTCAGGGAGGG + Intronic
1137612353 16:49827223-49827245 CCAGCCTCCAGCCACAGAGCAGG + Intronic
1138186572 16:54982039-54982061 CCTGCCCCCGGCTCTAGGGAAGG - Intergenic
1138346352 16:56322592-56322614 CCAGCCCCCAAGCAGAGGGAAGG - Intronic
1138535568 16:57658464-57658486 ACTGTCCCCAGCCACGAGGAAGG + Intronic
1138595344 16:58026526-58026548 CCAGCCCGCAGCCAAAGGGCAGG - Intronic
1139349238 16:66325014-66325036 CCAGCCGCCAGCCACAGCCAGGG + Intergenic
1139583469 16:67886398-67886420 CCTGGCCCCAGCCGCAAGCAAGG - Intronic
1140213099 16:72986207-72986229 CCTGCCCCCAACTTCAGGAAGGG + Intronic
1140393203 16:74606431-74606453 CCAGACCCCGGCAACAGGGAGGG + Intronic
1140615455 16:76657498-76657520 CCAGCACCCATTCACAGGGAAGG - Intergenic
1140777953 16:78267531-78267553 GCTGACCCCAGCAAGAGGGAAGG - Intronic
1141595077 16:85092447-85092469 CCCAGCCCCAGCCTCAGGGACGG + Exonic
1141750387 16:85954467-85954489 CCTGGCCCAGGCCACAGAGAGGG + Intergenic
1141774560 16:86114207-86114229 CCTGCACTTAGCCACTGGGATGG + Intergenic
1142868979 17:2808478-2808500 TCTGCCCCCTTCCACAGGGCAGG - Intronic
1143185681 17:5008661-5008683 CCTGGCCCAAGCCACATTGAGGG + Intronic
1143295194 17:5866045-5866067 CCTGCTCACAGCCACAGAGGCGG + Intronic
1143416706 17:6755979-6756001 CCAGCCCACAGCTTCAGGGAGGG - Exonic
1144792592 17:17869044-17869066 GCCACCCCCAGCCCCAGGGAGGG - Intronic
1145007290 17:19344841-19344863 CCAGCCCCCAACCCCAAGGAGGG + Intronic
1145102742 17:20090250-20090272 GCTGCCCACAGGCTCAGGGAAGG - Intronic
1145761040 17:27425645-27425667 CCTGTCCCCAGCCCCATGAAGGG - Intergenic
1145985367 17:29042547-29042569 CCTCTCCTCAGCCACAGAGAGGG - Intronic
1146191996 17:30776860-30776882 ACTGCACCCGGCCACACGGAAGG + Intronic
1146337171 17:31983567-31983589 ACTGCACCCGGCCACACGGAAGG + Intronic
1146682875 17:34821157-34821179 GCAGGCCCCAGACACAGGGAAGG - Intergenic
1147236599 17:39062241-39062263 GCTGTGCCCAGCCACAGGTAAGG - Intergenic
1147249489 17:39144497-39144519 CCTGTCCCAGGCAACAGGGAAGG - Intronic
1147742029 17:42675272-42675294 CCTGTCCCCAGGCTCAGGGAAGG + Intronic
1147773181 17:42881911-42881933 ACTGCACCCAGCCAAATGGATGG + Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1147910706 17:43854290-43854312 CCCTGCCCCAGCCTCAGGGACGG + Intronic
1147912223 17:43862482-43862504 CCTGCACCAAGCCCCAGAGATGG - Exonic
1148589342 17:48804060-48804082 CGTGTCCTCAGCAACAGGGACGG - Intronic
1148605642 17:48927183-48927205 CCTTCCCCCCACCCCAGGGATGG + Exonic
1148688257 17:49512739-49512761 CCTGCCCCCAGCCAAGCGGGAGG + Exonic
1149558062 17:57588269-57588291 ACAGCACCCAGCCTCAGGGATGG - Intronic
1149685581 17:58532698-58532720 ACTGTCCTCAGCCACAGGCAAGG - Intronic
1150124954 17:62629451-62629473 CCTGGACACAGCCCCAGGGAGGG - Intronic
1151426157 17:74032382-74032404 CCTGCTCCAAGCCACAGGTCGGG + Intergenic
1151449212 17:74187454-74187476 CCTGCCTCCAGGCACAGGGTAGG - Intergenic
1151451237 17:74199612-74199634 CCTGCCGGCAGCCAAAGGCAGGG + Intergenic
1151537186 17:74745582-74745604 TCTCCCCGCATCCACAGGGAGGG + Exonic
1151978013 17:77493188-77493210 CCTTGCCCCACCCAGAGGGAGGG + Intronic
1152244417 17:79177659-79177681 CCTGCACCCAGGCTCTGGGATGG - Intronic
1152258041 17:79251751-79251773 GCTGCCCACAGGCTCAGGGAAGG + Intronic
1152412968 17:80139106-80139128 CCTGCCTCCAGCCACACAGGTGG - Exonic
1152493451 17:80653742-80653764 CCAGCCCTCACACACAGGGAGGG - Intronic
1152750429 17:82060082-82060104 CCTCCCCTCAGGCCCAGGGAGGG - Exonic
1152830278 17:82493067-82493089 ACTGTGCCCAGCCACACGGAGGG + Intergenic
1153350628 18:4077481-4077503 CCTGCCCTCCGCCACAAGGAGGG - Intronic
1153503024 18:5768188-5768210 CTTGCTCCCAGCCACAGGGGAGG - Intergenic
1155100548 18:22606439-22606461 CATGCCCCCAGCTGCACGGAAGG + Intergenic
1155176634 18:23306921-23306943 GCTGCCCCTGGTCACAGGGAAGG + Intronic
1156511120 18:37637667-37637689 CCTGCCCTCATCCACTGGGCTGG - Intergenic
1157521380 18:48347817-48347839 CCAGGCTCCAGCCACATGGAAGG + Intronic
1158503875 18:58028735-58028757 CAGACCCCCAGCCACAGTGATGG - Intergenic
1159377691 18:67615002-67615024 CCTTCCCCCAGCAGAAGGGAGGG + Intergenic
1160246708 18:77165431-77165453 CCTGCATCCAGGCACAGTGAAGG - Intergenic
1160293535 18:77617121-77617143 CCTGCACACAGCCACACTGAGGG - Intergenic
1160514491 18:79470903-79470925 CCTGCCCCCCGCCCCAGGGAGGG - Intronic
1160617241 18:80140603-80140625 CCTGAACACAGCCACAGTGAAGG - Intronic
1160673176 19:375911-375933 CCTGCCCGCAGCCTCAGAGCTGG + Exonic
1160704939 19:525223-525245 CCCTCCCCCAGCCTCAGCGATGG + Intergenic
1160835443 19:1122629-1122651 CCCGCCCCCTGCCCCAGGCAGGG + Intronic
1160863150 19:1246006-1246028 CCTGCCCCCACCACCAGGGAGGG + Intergenic
1160983602 19:1827614-1827636 CCTGCCCCCAGCTGCAAAGACGG - Exonic
1161312773 19:3603968-3603990 CCTCTCCCCAGACACAGGGAGGG - Intronic
1161327787 19:3671739-3671761 CCTGCCCCCACCCCCTGGGCAGG - Intronic
1161349224 19:3783240-3783262 CATGAGCCCAGCCCCAGGGAGGG + Intronic
1161504263 19:4635692-4635714 CCAGCCCCCGACCCCAGGGAGGG + Intergenic
1161668136 19:5589464-5589486 CCTGCCCAGCGCCACAGGGTGGG - Intronic
1162449510 19:10746278-10746300 CCTGCCTCCAGCCACATTGGTGG - Intronic
1163002416 19:14376307-14376329 GCTGCCCTCTGCAACAGGGAGGG - Intergenic
1163476670 19:17530564-17530586 CCCTCACCCAGCCACATGGATGG + Intronic
1163684075 19:18700731-18700753 CGTGTCCCCAGCCAGAGGGACGG - Intronic
1163826687 19:19528154-19528176 CCTGCCCCTCCCCACTGGGACGG + Exonic
1164540070 19:29115525-29115547 CCTGCCCCAGGCCAATGGGATGG - Intergenic
1164623724 19:29713327-29713349 CCATCTGCCAGCCACAGGGAAGG + Intronic
1164778656 19:30874183-30874205 CCTTCCCCCAGACACAGAGCAGG - Intergenic
1164804932 19:31109284-31109306 TCTGCCCCCAGCACCAGAGAAGG - Intergenic
1165102271 19:33445975-33445997 CCTGCCCCCACCACCAAGGAAGG + Intronic
1165949543 19:39466414-39466436 CCTGACCCCAGACACAAGAAGGG - Intronic
1166000095 19:39872604-39872626 GCGGCCCACAGCCACAGGCAGGG + Exonic
1166297869 19:41897510-41897532 CCATCCCCCTGCCTCAGGGAAGG + Intronic
1166346033 19:42166558-42166580 CCTGCCCCCAGACACAAAGGAGG - Intronic
1166532108 19:43548934-43548956 TCTGCCCTAAGCCACAGGGAAGG + Intronic
1166971847 19:46574127-46574149 CCGGGCTCCAGCCACAGGGCTGG + Intronic
1166997824 19:46728172-46728194 CCTGCCCACTGCCCCACGGAGGG - Intronic
1167036245 19:46996551-46996573 CCTGCCTCCAGCCAGAGGACGGG + Intronic
1167281239 19:48570145-48570167 GGTTCCCACAGCCACAGGGAAGG - Intronic
1168317744 19:55491429-55491451 CCTGCCCTCTGCCACCGGGCTGG + Intronic
1168414202 19:56158633-56158655 CCAGCCCCCAGCACCGGGGAGGG + Intronic
925040628 2:731122-731144 CCAGCTCCCAGCCACAGAGGTGG + Intergenic
925147991 2:1593863-1593885 CCTGCTCACAGCCCCAGGGAGGG - Intergenic
925181382 2:1819131-1819153 CCTGCCTCCTGCCCAAGGGATGG + Intronic
925188922 2:1867510-1867532 CCTCTCCCCAGCCAGAGGCAAGG - Intronic
925918753 2:8625273-8625295 CCAACCACCTGCCACAGGGAAGG - Intergenic
926089281 2:10039953-10039975 CCTGCCCGCAGTCAGAGGGATGG - Intergenic
926136602 2:10341047-10341069 CCTGCCTCCAGACACATGAAGGG - Intronic
926292892 2:11544661-11544683 CCTGCTCTCATCCCCAGGGAAGG + Intronic
926620082 2:15039700-15039722 CCAGGCCACAGCCTCAGGGAGGG - Intergenic
926639314 2:15218767-15218789 CCTGGCCCCAGAGACAGGTAAGG - Exonic
926890734 2:17637123-17637145 CCTTCCCCTTCCCACAGGGAAGG + Intronic
927513867 2:23660654-23660676 ACTGCCACCTGCCACAGGGGAGG - Intronic
927928070 2:27026791-27026813 CCAGCCCCCAGCCATGGGGAAGG - Exonic
928112940 2:28525263-28525285 CCAGCCTCCAGACCCAGGGACGG + Exonic
928248416 2:29652630-29652652 CCATCCCTCAGCCTCAGGGAAGG + Intronic
928402977 2:30992604-30992626 CCTGCCCCCAGCCTCCTGGTGGG + Intronic
929565289 2:42979973-42979995 CCTGCCCCCACCCACTTGCAGGG - Intergenic
929825549 2:45306828-45306850 CCCACCCCCATCCCCAGGGAGGG - Intergenic
929954621 2:46446766-46446788 CCATCCCCCATCCTCAGGGAGGG + Intronic
931794162 2:65693452-65693474 AGTGGGCCCAGCCACAGGGAGGG + Intergenic
932068192 2:68589156-68589178 CCTGCCTCCAGTCCCTGGGAAGG - Intronic
933089511 2:78103771-78103793 CCTGGACCCAGCCACACTGAGGG + Intergenic
933695796 2:85216238-85216260 GCTGCCCGGAGCCACGGGGAAGG - Intronic
933871093 2:86566248-86566270 CCTCCACCCAGAAACAGGGAAGG - Intronic
934567577 2:95349094-95349116 CCCGCCCCCCGTCAGAGGGAGGG + Intronic
934618150 2:95787959-95787981 CCTGCCCCCAGCCACAGGGAGGG + Intergenic
934642743 2:96036600-96036622 CCTGCCCCCAGCCACAGGGAGGG - Intronic
934713247 2:96528948-96528970 CCAGCCTGCAGCCATAGGGAGGG + Intergenic
935205923 2:100896395-100896417 CCTGCCCACAGACACAGGCTTGG - Intronic
935597134 2:104887774-104887796 CCCACGCCCAGCCACAAGGATGG + Intergenic
935648734 2:105363855-105363877 CCTGCTCCCAGCCACAGGGCTGG - Intronic
936520632 2:113210121-113210143 CCAGCAGCCAGCCCCAGGGAGGG - Intergenic
937257283 2:120564516-120564538 CCATCCTCCTGCCACAGGGAGGG - Intergenic
937258827 2:120572702-120572724 CTTTCCTCCAGCCACTGGGATGG - Intergenic
937991401 2:127664301-127664323 CCCGCCGCCAGCCACGGGGTAGG - Exonic
938019388 2:127893598-127893620 CCTTGCCCCACCCACCGGGAAGG + Intergenic
938091690 2:128438684-128438706 CCTGACCCCAGAGACGGGGAAGG - Intergenic
938114048 2:128591396-128591418 CCAGGCCCCAGCAACAGGGGAGG - Intergenic
938187278 2:129242909-129242931 CCTGGCCCCAGCCAAAAGGGGGG - Intergenic
938774791 2:134531851-134531873 CCAGCCCCCAGCCTCTGGCAAGG - Intronic
939060807 2:137419517-137419539 CCTGGACCCAGCCACACTGAGGG - Intronic
940742341 2:157523098-157523120 CCTGGTCCCAGCTACTGGGAAGG + Intergenic
941649480 2:168078543-168078565 CCTGGCCCCTGACACAGGAATGG + Intronic
941928435 2:170917884-170917906 CCTGGACCCAGCCACACTGAGGG - Intergenic
941929890 2:170929129-170929151 CCTGCCGCGAGCCACTGGAAGGG - Exonic
942095793 2:172535590-172535612 CCTCCCCCCAGCTTCATGGAAGG + Intergenic
942326128 2:174778539-174778561 CCTGCCCCTCGCCCCAGTGATGG + Intergenic
942408085 2:175676725-175676747 CCTGCTCCCAGCCCCAGAAATGG + Intergenic
944143365 2:196480498-196480520 CCATCCCCCAGCCACAGTGATGG + Intronic
944546025 2:200799767-200799789 ACTGCCCCCAGCCACATTTAAGG - Intergenic
946408639 2:219505768-219505790 ACTGGTCCCAGCCCCAGGGAGGG + Intronic
946773506 2:223113314-223113336 TCTGCCCACATTCACAGGGAGGG + Intronic
947740415 2:232482379-232482401 CCTGCCCTCAGCCACAAACAGGG + Intronic
947743256 2:232494594-232494616 CCAGCCCACAGCCCCAGGGTGGG - Intergenic
948115601 2:235493095-235493117 CCTGCCCCCAGCCATCGGCGTGG - Intergenic
948190628 2:236055569-236055591 CCTGGCCCCAGCCGCAGAGCGGG + Intronic
948455680 2:238103622-238103644 CCTGCTCCCAGCCACCGCGCTGG + Intronic
948596515 2:239082858-239082880 TCTGCCCCGGGCCACAGGGCAGG + Intronic
948800489 2:240431159-240431181 GCTGCCCTCAGCCACAGTGCAGG - Intergenic
948816280 2:240511903-240511925 CCTGCCCCCCTCCTCCGGGAGGG + Exonic
948893996 2:240919846-240919868 CCTGCCCCCATCTCCTGGGAGGG - Intronic
949070019 2:242018804-242018826 CCTCATCCCAGCAACAGGGAAGG + Intergenic
1169133968 20:3185037-3185059 CATGGCCCCAGCCACAAGTAGGG - Intergenic
1169216817 20:3799026-3799048 CATGCCCACAGCCAAGGGGATGG - Intronic
1169219774 20:3815219-3815241 TCTGCCCACAGTCAGAGGGAGGG + Intergenic
1170572120 20:17638334-17638356 CATTCCCACAGCCACATGGATGG + Intronic
1170717006 20:18840457-18840479 CATGTCCCCAGCTACAGGGTGGG + Intergenic
1171193786 20:23180855-23180877 ACTGTCCCCAGCCATGGGGAGGG - Intergenic
1171401398 20:24874949-24874971 CCTGGGCTCAACCACAGGGAGGG + Intergenic
1172873602 20:38150866-38150888 GCTGCCCCCAGACACAGGGCCGG + Intronic
1173235286 20:41239623-41239645 CCCACCCCCAGCTCCAGGGATGG - Intronic
1173573151 20:44091247-44091269 CCTGCCCCCAGACACAGAGGAGG + Intergenic
1174059068 20:47819546-47819568 CCTTCCCCGAGACACAAGGATGG + Intergenic
1174080385 20:47967223-47967245 CCTGCCCCCAGCCCCAGCAGTGG - Intergenic
1174112498 20:48206042-48206064 CCAGCTCCCAGCCCCAGGGAAGG + Intergenic
1174137208 20:48388050-48388072 CCTGCCCCCAGCCCCAGCAGTGG + Intergenic
1174451750 20:50624886-50624908 CCTGCCCCCAGCCTCCAGGCGGG + Intronic
1174454658 20:50640626-50640648 CCTGCCCCCCTCCGCAGGGCTGG + Intronic
1174472142 20:50769096-50769118 CCTGCCCCCCTCCGCAGGGCTGG - Intergenic
1174648468 20:52105089-52105111 CCGGCCCCCAGCCCCCGGGCGGG + Intronic
1175151711 20:56940217-56940239 CCAGCCCCAAGCCAAAGGCAGGG + Intergenic
1175160337 20:57003535-57003557 CCTGCATCCAGACACAGGGACGG + Intergenic
1175900876 20:62359465-62359487 CCAGGCCCCAGGCCCAGGGAAGG - Intronic
1176045277 20:63089478-63089500 CCTGCACCCAGGGACAGAGATGG - Intergenic
1176070178 20:63222161-63222183 CCTCCCCCCACCCCCAGGAATGG - Intergenic
1176297699 21:5083005-5083027 CATGGCCCCAGCCTCAGGGAGGG + Intergenic
1176428012 21:6560565-6560587 CCCGCCCCCAGCCCCAGGAGGGG - Intergenic
1179363431 21:40733785-40733807 CCTTCCCCCAACCACAAGCAGGG - Intronic
1179703503 21:43168882-43168904 CCCGCCCCCAGCCCCAGGAGGGG - Intergenic
1179810869 21:43868463-43868485 CCTGTCCCCAGTGACTGGGAAGG + Intronic
1179859330 21:44178944-44178966 CATGGCCCCAGCCTCAGGGAGGG - Intergenic
1180037614 21:45257762-45257784 CCAGCCTGCAGCCACAGGGCAGG + Intergenic
1180147754 21:45930654-45930676 TCTGGCCACAGCCACAGGCATGG - Intronic
1180150645 21:45945495-45945517 CCCTCCCACAGCCCCAGGGAGGG - Intergenic
1180612373 22:17106364-17106386 GCTGCCCTGAGCCACAGGGGTGG + Intronic
1180631333 22:17232253-17232275 CCTTCCTCCAGCAGCAGGGAGGG + Intergenic
1180710026 22:17833148-17833170 CCTGCCTCCCTCCACAGGGCAGG - Intronic
1180950230 22:19717512-19717534 CCTGCCCTCAGAGACAGGGGTGG - Intronic
1180950738 22:19719376-19719398 CCTGGCCCCAATCCCAGGGAGGG - Intronic
1180957649 22:19748064-19748086 CCTGCCCCTTGCCACTGGGTAGG + Intergenic
1181085511 22:20437747-20437769 CCTGCCCCGCGCCTCATGGAGGG - Exonic
1181462383 22:23093450-23093472 CCTACCCCCAGCCAGAGTGCGGG - Intronic
1181534643 22:23535058-23535080 CCTGCCCACTCCCAGAGGGACGG - Intergenic
1181539984 22:23567832-23567854 CCTGCCACCAGGCACAGAGAAGG + Intergenic
1181570069 22:23763691-23763713 CCCGCCTCCAGCCAGAGGCACGG - Intronic
1182015866 22:27039238-27039260 CCTGCCCTCAGCCCCAGGGGTGG + Intergenic
1182062090 22:27405771-27405793 CCTTGGACCAGCCACAGGGATGG + Intergenic
1183022442 22:35038263-35038285 CCATCCCTCAGCCACTGGGAGGG - Intergenic
1183346602 22:37311644-37311666 GCAGCCCTGAGCCACAGGGAAGG - Intronic
1183504813 22:38202974-38202996 CGCGCCCGCAGCCACAGGGTGGG + Intronic
1184274931 22:43404799-43404821 CCTGCCCACAACCACATAGAGGG + Intergenic
1184286965 22:43477320-43477342 CCTGCTCCCAGCCCCAGACAGGG - Intronic
1184324722 22:43774552-43774574 GATGCCCACAGCCTCAGGGAGGG + Intronic
1184445640 22:44545317-44545339 CCTGCGCTCAGTCACAGCGAGGG - Intergenic
1184733888 22:46386537-46386559 CCTGGCCCCAGCCACCAGGGCGG - Exonic
1184786160 22:46673004-46673026 CCGGCCCCCAGCTGCGGGGATGG + Intronic
1184827924 22:46965733-46965755 CAGGCCACCGGCCACAGGGACGG - Intronic
1184832491 22:46997732-46997754 CCTCCCCCCGCCCACAGAGAGGG - Intronic
1185152042 22:49169368-49169390 CCTGTCTCCAGGCCCAGGGATGG + Intergenic
1185362198 22:50414995-50415017 CCTGCTCTAAGCCACAGGGGTGG - Intronic
949122449 3:403085-403107 CCTGCCAACAGCCACACGAATGG - Intronic
949540711 3:5030007-5030029 CCTGCCCCCACCCCCAGTAAAGG - Intergenic
949871659 3:8594589-8594611 CCTGCCCCTTACCACAGGCATGG + Intergenic
949980839 3:9500866-9500888 CCTGCTCCCTGCCAAGGGGAAGG + Exonic
950125398 3:10507028-10507050 TCAGCCCCCAGCCCCATGGAAGG + Intronic
950431406 3:12953163-12953185 CCTGCAGCCAGGCACAGGGTGGG - Intronic
950867353 3:16199765-16199787 GCTGCCCCCAGCCCCAGTCATGG - Intronic
951472693 3:23072778-23072800 TCTCCCCCCAGCCTCAGTGAGGG - Intergenic
952905578 3:38137451-38137473 CCTGCCCGCAGCCAAACGGAAGG + Intergenic
953684596 3:45066778-45066800 TCTTCCCCCAAGCACAGGGAGGG - Intergenic
953703974 3:45217582-45217604 CCTGCTCCCAGCCACCAGGCAGG + Intergenic
953726707 3:45405853-45405875 CCTTCTCCCAGCCACAGAGATGG - Intronic
953756148 3:45647496-45647518 CCTGCCCCTGAACACAGGGAAGG - Intronic
954076895 3:48188143-48188165 CCAGCCACCAGCCACAGGCACGG + Exonic
954210350 3:49093730-49093752 CCCTCCCCCATCCACAGGGCGGG + Intronic
954652397 3:52173186-52173208 CTTGCCCACAGCCACAGAGCCGG - Intergenic
956487909 3:69740800-69740822 CCAGGCCCCATCCACAGCGAAGG - Intronic
957915434 3:86682539-86682561 CATGCCTCCCTCCACAGGGATGG - Intergenic
958592472 3:96175472-96175494 CCTGGACCCAGCCACACTGAGGG + Intergenic
960054500 3:113267575-113267597 CCTGCCCCCAGCCCCAAGGAAGG + Intronic
960065012 3:113362258-113362280 CCTTCACCCAGACACATGGAAGG - Intronic
960293788 3:115918028-115918050 CCTGCCCACAGCCACAGCACTGG - Intronic
960801546 3:121545573-121545595 CCAGGCCCCAGTCACAGAGAAGG + Intronic
960992242 3:123319569-123319591 CATGCCCCCAGCACCACGGAAGG - Intronic
961361551 3:126371202-126371224 CCTGCGCCCAGCCCAAGGGCAGG + Intergenic
961575418 3:127831997-127832019 CCTCCCCCCAGCCTCAGTGCAGG - Intergenic
961823815 3:129588523-129588545 CCTCTCCCCAGCCACAGCGGTGG + Intronic
962375614 3:134856335-134856357 CCTGCCCCCACTCACACTGAGGG - Intronic
962413485 3:135161861-135161883 CTTGTCCCCATCCAGAGGGATGG + Intronic
962915858 3:139902805-139902827 CCACCCCACAGCCACAGGAAGGG + Intergenic
964275548 3:155005104-155005126 CTTGTACCCAGCCACAGGGGTGG + Intergenic
966912275 3:184566219-184566241 CCTGCCAGCAGCCAGAAGGACGG - Intronic
966919441 3:184602282-184602304 CCTGCCCCCCGTCCCAGCGAGGG - Intronic
967095311 3:186172997-186173019 CCAGCTGCCAGCCAAAGGGAGGG - Intronic
967105507 3:186252061-186252083 CGTTCCCCGAGCCACAGAGAAGG + Intronic
967881990 3:194307999-194308021 ACTGCCCACAGCCACAGGACAGG - Intergenic
967965287 3:194955866-194955888 CACGCCCCCAGACACAGGGAGGG + Intergenic
968049236 3:195642742-195642764 CCTCATCCCAGCAACAGGGAAGG + Intergenic
968098166 3:195946888-195946910 CCTCATCCCAGCAACAGGGAAGG - Intergenic
968106671 3:196006400-196006422 CCTCATCCCAGCAACAGGGAAGG - Intergenic
968305379 3:197647192-197647214 CCTCATCCCAGCAACAGGGAAGG - Intergenic
968442336 4:630227-630249 ACTCCCCTCGGCCACAGGGATGG - Intronic
968894399 4:3390211-3390233 CCTGCCCCCATCCTGAGCGATGG + Intronic
969184177 4:5463301-5463323 CCAGCACACAGCCTCAGGGAAGG - Intronic
969204210 4:5630349-5630371 CCTGCTCACAGACGCAGGGAAGG + Intronic
969232862 4:5843612-5843634 CCTGCCCAAAGTCACAGAGACGG - Intronic
969239595 4:5889755-5889777 CCAGCCCCCAACCACAGTGCTGG - Intronic
969486595 4:7475592-7475614 CATGTCTGCAGCCACAGGGAAGG - Intronic
969858406 4:10018024-10018046 CCTACCACCACCCACAGGCAAGG - Intronic
974670533 4:65024456-65024478 CCTGCCCCCACCAACAGCAAAGG + Intergenic
975221726 4:71820359-71820381 CCTGTACCCAGCCATAGTGAAGG - Intergenic
975271110 4:72434595-72434617 CCTGCCCACACTCAAAGGGAGGG - Intronic
977249259 4:94671086-94671108 CCTACCCCCAGCCATGAGGAGGG - Intergenic
980275057 4:130640041-130640063 CCTGCTCCCTGAGACAGGGATGG - Intergenic
980557773 4:134431263-134431285 CCTGCCACCCTCCACAGGGATGG + Intergenic
982067914 4:151671041-151671063 CCTGTCCCAAGCCACAGCTATGG - Exonic
982452598 4:155570784-155570806 CCCACCTCCAGCCACAGTGAAGG - Intergenic
984180902 4:176481116-176481138 TCTGCCTCCAGCCCCAGGTATGG + Intergenic
985505800 5:279582-279604 CCTCATCCCAGCAACAGGGAAGG + Intronic
985610297 5:884164-884186 CCTGCCCTCAGACACAGAGCTGG + Intronic
985732075 5:1554815-1554837 CCTGCCCTCGGCCACACGGCTGG - Intergenic
985742400 5:1626336-1626358 CCTCATCCCAGCAACAGGGAAGG - Intergenic
986139635 5:5017659-5017681 CCTGACCACCGCCACAGGGGAGG + Intergenic
986779937 5:11055849-11055871 ACTGCCACAAGCCACAGGCAGGG + Intronic
987156082 5:15090753-15090775 CCTGCCCCCAGGCAGAGACAAGG - Intergenic
988481993 5:31639057-31639079 CCTTCCCCGAGTGACAGGGACGG - Intergenic
990346904 5:54880461-54880483 CCAGGCCCCAGCCACAGGCATGG + Intergenic
991371184 5:65921781-65921803 CCTGAGCCCAGCCATTGGGAAGG + Intergenic
992612699 5:78520834-78520856 CCTGCCCCGGGCCGCAGAGATGG + Intronic
992716169 5:79513745-79513767 CCTGCCCCCAGCTCCAGGGCGGG + Exonic
994096700 5:95853726-95853748 GCTGCCCCCACCCACTGGAATGG + Intronic
994405097 5:99335133-99335155 CCTGCGCTCAGCCTCAGGGAGGG - Intergenic
995108509 5:108401616-108401638 CCTGCTCCCAGCAACAAAGAAGG + Intergenic
996341271 5:122441496-122441518 CCTGCCCCAAGCCACATGAAGGG + Intronic
996885891 5:128353219-128353241 CCTGCCCCCAAACACAGAAAGGG + Intronic
997524206 5:134541966-134541988 CCTTCCCTCAGCCAGAGTGAAGG + Intronic
997558730 5:134824864-134824886 CCTCCCACCAGGCAAAGGGAAGG + Intronic
997594820 5:135100064-135100086 CTTGCCCCAAACCACAGGTATGG + Intronic
997662958 5:135603546-135603568 CCCACCACCAGACACAGGGAGGG - Intergenic
997733861 5:136199458-136199480 CCTGCCCTCAGCCATGGGTAGGG - Intergenic
998006629 5:138661533-138661555 CCTGCCCACAGTCACAGGGGAGG + Intronic
998041066 5:138951382-138951404 CCTGCCCTGAGGCCCAGGGAAGG + Intronic
998377142 5:141698624-141698646 CCTAGTGCCAGCCACAGGGAAGG + Intergenic
999380696 5:151119134-151119156 CTTTTCCCCAGACACAGGGATGG + Intronic
1001144734 5:169173927-169173949 CCAGGCCCCATCCACAGTGATGG + Intronic
1001425410 5:171619239-171619261 TCCACCCCCAGCCCCAGGGAGGG + Intergenic
1001530327 5:172456598-172456620 CCTGCCCCCAGCCACACCATGGG + Intergenic
1001647848 5:173295433-173295455 CCCCCCCCCACCCACAAGGAGGG - Intergenic
1001705281 5:173737079-173737101 TCTTCCCCCAGCCCCAGGGGTGG - Intergenic
1002013129 5:176300609-176300631 ACTGCACCCAGCCACAGAGTTGG + Intronic
1002214707 5:177622139-177622161 ACTGCACCCAGCCACAGAGTTGG - Intergenic
1002779890 6:357920-357942 CCTGACCCCAGTCACAGGCAAGG + Intergenic
1003180013 6:3783209-3783231 CCTGCACCCAGCCCCAGGGAGGG - Intergenic
1003208624 6:4038550-4038572 ACTGCACCCAGCCACAATGAGGG + Intronic
1003386160 6:5669499-5669521 GCTCTCCCCAGCCACAGTGAAGG - Intronic
1005957873 6:30677112-30677134 TCTGCCCCCAGAAACAGGGTGGG + Exonic
1006454791 6:34125596-34125618 CTGGCCCCAATCCACAGGGAAGG + Intronic
1007259832 6:40555720-40555742 CCTGCCCCCACCCCCATGGCAGG + Intronic
1007368969 6:41413727-41413749 CCTGCCCCCATCAATAGGCATGG + Intergenic
1007637413 6:43307779-43307801 CCAGCTCCCAGCCACAAGGAGGG + Intronic
1007699775 6:43759754-43759776 CCTGGCCCCAGGCACTGGGGAGG - Intergenic
1008872569 6:56289898-56289920 CCAGCCCACAGCCACTGGGCTGG + Intronic
1010793087 6:80087590-80087612 CCTGCCCTTAGCCACATGGCAGG - Intergenic
1011970800 6:93220291-93220313 CATGCAACTAGCCACAGGGATGG - Intergenic
1013183902 6:107740904-107740926 CCTTCCCCCATCCACTGTGAAGG + Intronic
1013190554 6:107801433-107801455 CCTGCCCCCCACCCCAGGTATGG + Intronic
1017030097 6:150213575-150213597 ACTCCTTCCAGCCACAGGGATGG - Intronic
1017416775 6:154229078-154229100 TCTGCCTCCAGCCCCAGGGGCGG + Intronic
1017995465 6:159528130-159528152 CCTGTCCCCTGCTACAGAGAGGG + Intergenic
1018068066 6:160137513-160137535 CCTGCACCCAGCCACATGCTGGG + Intronic
1018365670 6:163117346-163117368 CCTGGCTCCAGCCACTGGGGAGG + Intronic
1018867290 6:167756053-167756075 CCTGCTTTCAGCCTCAGGGAGGG + Intergenic
1019067024 6:169311013-169311035 CCTGGCCCCTGCCCCATGGAAGG - Intergenic
1019140208 6:169938033-169938055 CCTGCCCCCTGCCAGATGAAAGG + Intergenic
1019328731 7:452461-452483 CCGGCCCCACGCCCCAGGGAGGG + Intergenic
1019384812 7:748629-748651 CCTGCCCCCTACCACAGTGGAGG + Intronic
1019815542 7:3197255-3197277 CCTGCCCCCAGCCTCATGCCAGG - Intergenic
1020141252 7:5613065-5613087 CCTGCCCACAGCCCAAAGGACGG - Intergenic
1020282798 7:6658851-6658873 CCTGCCCCCAGCTCCAGGAAGGG + Intergenic
1021147019 7:17101567-17101589 CCCAGACCCAGCCACAGGGAAGG - Intergenic
1021633123 7:22665596-22665618 CCGGCCCCCAGGCAGAGGGAAGG - Intergenic
1021839811 7:24713458-24713480 CCTGAACCCCGTCACAGGGAAGG + Intronic
1021934734 7:25618736-25618758 ACTGCCCCCAACCAAAGGAAAGG - Intergenic
1022574718 7:31486468-31486490 CTTGCCCTAAGCCATAGGGATGG + Intergenic
1023057252 7:36300199-36300221 CCTACCTCCAGCCACTAGGAGGG - Exonic
1023515449 7:40997045-40997067 CCTGCCCCAAGCCACACAGCTGG + Intergenic
1023518719 7:41029424-41029446 CCTGACCCCAGCCACAGAGGTGG - Intergenic
1023834366 7:44059666-44059688 CCTGGCCCCAGCCCCAGTGTAGG - Intronic
1023850824 7:44149359-44149381 CCTGCCCCCACCCAAAGTGAAGG - Intronic
1024009045 7:45252342-45252364 CCAGAACCCAGCCCCAGGGATGG + Intergenic
1025235840 7:57234480-57234502 CCTTCCCCGAGACACAAGGATGG - Intergenic
1025236862 7:57240247-57240269 CCTGCCACCTGTCACATGGAGGG + Intergenic
1026009995 7:66629046-66629068 ACTGCCCAGAGCCAGAGGGATGG + Exonic
1026589688 7:71684143-71684165 CCTGCACCCAGGCCCAGGGTGGG + Intronic
1028001450 7:85502532-85502554 CTTGCCACCACCCAAAGGGAAGG + Intergenic
1028455823 7:91036928-91036950 CCTGCTCCCACCCACACTGAAGG + Intronic
1029457175 7:100677273-100677295 CCTTCTCCCACCCAAAGGGAAGG + Intronic
1029642240 7:101828630-101828652 CCTTTGCCCAGACACAGGGACGG - Intronic
1032263793 7:130356484-130356506 CCTTCCCCCAGCCCCAGGAATGG + Intronic
1033755745 7:144397399-144397421 CCTGCCCCCAGGCTCTGGGCAGG - Exonic
1034138065 7:148789885-148789907 CCTGTCCCCTTCCACAGTGAAGG - Intronic
1034405708 7:150901252-150901274 CCTGCCCCCAGCTCCAGAGCAGG + Intergenic
1034424346 7:151006810-151006832 CCCAGCCCCAGCCCCAGGGACGG - Intronic
1034890803 7:154837525-154837547 CCTGCCCCCACCCCCAGAGCTGG - Intronic
1035066333 7:156107882-156107904 CCAGCCCCAACCCACGGGGAGGG - Intergenic
1035319167 7:158017418-158017440 TCTGCCCCCAAGCACTGGGATGG - Intronic
1035536513 8:395246-395268 CCAGCTCCCATCCACACGGAAGG + Intergenic
1035565429 8:637695-637717 CCTGCTCCCAGGCACACGGTGGG - Intronic
1035836740 8:2762769-2762791 GCTGCCCCCAGCCAGAGCGCAGG + Intergenic
1036587717 8:10140242-10140264 CCTTCCTCCAGTTACAGGGAGGG + Intronic
1036635603 8:10547994-10548016 CCTACCCCAGGTCACAGGGAAGG + Intronic
1036650304 8:10637944-10637966 CCTGCCTGCAGCCCCAGGGCTGG + Intronic
1036770995 8:11578396-11578418 CCTGCCTCCATCCACAGGCCCGG - Intergenic
1037012661 8:13863115-13863137 CCTACCCCCACCTACAGAGAGGG - Intergenic
1037526222 8:19727085-19727107 CCTTCCCTCAGCCCCAGGAATGG - Intronic
1037653812 8:20865916-20865938 CCTGCCCACACTCAGAGGGAGGG - Intergenic
1037689715 8:21171817-21171839 CCTGTTCTCAGCCCCAGGGATGG + Intergenic
1037728749 8:21505991-21506013 CCTGGCCCCAGTGACCGGGAGGG + Intergenic
1037789121 8:21920430-21920452 CGTCCCCCTAGCCACAGTGAAGG + Intronic
1038423568 8:27450686-27450708 CCTGCTCTCAGACTCAGGGAGGG - Intronic
1038506997 8:28092974-28092996 CCTGCCCCGGGTCTCAGGGATGG - Exonic
1038811429 8:30849892-30849914 TCTGCCCCCAGCCCCCGAGATGG - Intronic
1038855218 8:31323802-31323824 CCTGCCCCCAACCCCACGGCAGG + Intergenic
1039072550 8:33659961-33659983 CCAGCCCCCAGCTCCAGGGCTGG - Intergenic
1040574670 8:48641056-48641078 CCTGCCAACAGGAACAGGGATGG + Intergenic
1041279494 8:56196609-56196631 CCTGCCCCAAGTCTCGGGGATGG + Intronic
1048609757 8:136009595-136009617 CATGCCCCCAGCCAGTAGGACGG - Intergenic
1049160658 8:141095658-141095680 CTTGCCCACAGCCACACGGAGGG + Intergenic
1049263194 8:141650788-141650810 CCTGCCCCCAGACACATGGGAGG + Intergenic
1049277325 8:141726327-141726349 CCTCCCGCCAGCCACAGTGGTGG + Intergenic
1049280407 8:141741282-141741304 GGGGACCCCAGCCACAGGGAGGG - Intergenic
1049320530 8:141993827-141993849 CCTTCCCCCAACCCCAGAGAGGG + Intergenic
1049367765 8:142248982-142249004 CCTGCCCAAGGCCACAGGGCTGG - Intronic
1049406328 8:142453213-142453235 CGTGCCCCCAGCCTCCCGGACGG - Intronic
1049488261 8:142877528-142877550 CCTCCCCCCTACTACAGGGAGGG - Intronic
1049543883 8:143220711-143220733 CCTGCCCCCTGCCTCAGGCTAGG + Intergenic
1049574685 8:143384697-143384719 CCTGCTGCCAGCCAGGGGGAGGG + Intergenic
1049656611 8:143801798-143801820 TCTGCCCCCAACACCAGGGAGGG + Intronic
1049660905 8:143819331-143819353 CCTCCCCACACCCTCAGGGACGG + Intronic
1050660559 9:7879022-7879044 CCTTACTCCATCCACAGGGAAGG + Intronic
1051264870 9:15300594-15300616 ACTGCAACCAGCCACATGGAAGG - Intronic
1052081329 9:24209747-24209769 CCTCCCCGCCACCACAGGGATGG + Intergenic
1053022104 9:34701799-34701821 CCTTCCCCCGGCCACCGGGCTGG - Intergenic
1054810000 9:69427027-69427049 CATGCCCCCGGCAGCAGGGAGGG + Intergenic
1056454408 9:86746167-86746189 CATGCCCCCACCCACAGGGATGG - Intergenic
1056825221 9:89872420-89872442 CATGCCCCAAAGCACAGGGATGG - Intergenic
1057205222 9:93167922-93167944 CCTGCCCACAGTGACATGGAGGG + Intergenic
1057784695 9:98078007-98078029 CCTGCCCTCGGCCACAGGAAAGG - Intronic
1057903879 9:98969623-98969645 GATGCCCCCAGCCATAGGGAGGG + Intronic
1058549437 9:106098234-106098256 CCTGCCCCCACCCACACTGGAGG + Intergenic
1059383110 9:113943811-113943833 CCTGACCACCGGCACAGGGAAGG - Intronic
1059461037 9:114430240-114430262 CCTTCCCCCAGCCTCATAGAAGG - Intronic
1060209680 9:121701933-121701955 CCTCTCCCCAGCCAGAGGCATGG - Intronic
1060223479 9:121776413-121776435 CCTGGCCACAGGCACAGGCAGGG + Intronic
1060793809 9:126501896-126501918 ACTGCACCCAGCCCCAGGGAGGG - Intronic
1060893858 9:127205054-127205076 CCTGGCCTCAGCCACAGGTGTGG - Intronic
1061047710 9:128176083-128176105 CCTGTCCTCTCCCACAGGGATGG + Intronic
1061166685 9:128926905-128926927 CCTGTCCCCAACCCCAGGCATGG - Intronic
1061235723 9:129341590-129341612 CCCGCCTCCAGCCCCAGGGGAGG + Intergenic
1061276176 9:129570373-129570395 CCTGCCACCAGGCACAGAGAAGG + Intergenic
1061536655 9:131254479-131254501 CCTGCACACAGGCACAGAGATGG + Intergenic
1061564150 9:131426530-131426552 CCTGGACCTAGCCTCAGGGAGGG + Intronic
1061613193 9:131762393-131762415 CCTTGACCCAGCCACTGGGAGGG + Intergenic
1061759841 9:132843034-132843056 CCTGCCCCCACTCAAGGGGAGGG + Intronic
1061973407 9:134056562-134056584 CCTGGCACCAGCCAGTGGGAGGG + Intronic
1061977036 9:134074140-134074162 CATATCCCCAGCCACAGAGAAGG + Intergenic
1062005144 9:134235178-134235200 CGTGACCCCAGACACTGGGAAGG - Intergenic
1062119051 9:134824290-134824312 CCTGCCCTCAGCCACACAAAAGG - Intronic
1062270638 9:135706785-135706807 CCTGACCCCAGCCACATTGAGGG + Intronic
1062334013 9:136057014-136057036 CCAGCCCCCACCCCCAGGGTGGG + Intronic
1062361075 9:136188425-136188447 CCCGCCCCCGGCCCCAGGGTTGG - Intergenic
1062395941 9:136352828-136352850 CCCGCCCACAGGCACGGGGAGGG + Intronic
1062396123 9:136353590-136353612 GCTGGCCCCAGCCTCAGGGAAGG + Intronic
1062413220 9:136434967-136434989 GCTGCCCCCAGCCCCAAGCAAGG + Intronic
1062454681 9:136629931-136629953 CCTCCCCCCTGCAACAGGCAGGG - Intergenic
1062696585 9:137878866-137878888 CCTGCCCCCATCCCTAGGGGCGG - Intronic
1203734123 Un_GL000216v2:119411-119433 CCTTCCTCCAGGGACAGGGACGG - Intergenic
1185695951 X:2194757-2194779 ACTTCCTCCAGCCACAGGAAGGG + Intergenic
1186356717 X:8799272-8799294 TCTGCAGCCAGCCCCAGGGAGGG - Intronic
1186357045 X:8800387-8800409 TCTGCAGCCAGCCCCAGGGACGG - Intronic
1189714011 X:43845907-43845929 TCTGCCCCCGGTGACAGGGATGG - Intronic
1190410850 X:50135861-50135883 CCAGCCACCAGCCACAGGGGTGG - Intergenic
1191209769 X:57872269-57872291 CCAGCCACCAACAACAGGGAAGG - Intergenic
1191611232 X:63115396-63115418 CCTGCCACCAACATCAGGGAGGG + Intergenic
1192888022 X:75357815-75357837 CCAGCCCACAACCACAGGGGAGG - Intergenic
1197075760 X:122350756-122350778 CCTGCCCTGGGCCAGAGGGAGGG + Intergenic
1198048983 X:132930452-132930474 ACTGCGCCCAGCCACTGGAAAGG + Intronic
1200052736 X:153443577-153443599 CCTGGCCCGGGCCACAAGGAAGG + Intergenic
1201010414 Y:9545430-9545452 CCTGCCACCAGTAACTGGGATGG + Intergenic
1202626889 Y:56869006-56869028 CCTTCCTCCAGGGACAGGGACGG + Intergenic