ID: 934644701

View in Genome Browser
Species Human (GRCh38)
Location 2:96051800-96051822
Sequence CCATGAGGGTTCCTGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
934644694_934644701 12 Left 934644694 2:96051765-96051787 CCTGCCTGGCAGAAAGTGGGGGA No data
Right 934644701 2:96051800-96051822 CCATGAGGGTTCCTGAAGGCCGG No data
934644689_934644701 17 Left 934644689 2:96051760-96051782 CCTCTCCTGCCTGGCAGAAAGTG No data
Right 934644701 2:96051800-96051822 CCATGAGGGTTCCTGAAGGCCGG No data
934644695_934644701 8 Left 934644695 2:96051769-96051791 CCTGGCAGAAAGTGGGGGAAGAG No data
Right 934644701 2:96051800-96051822 CCATGAGGGTTCCTGAAGGCCGG No data
934644687_934644701 26 Left 934644687 2:96051751-96051773 CCTCAGCAGCCTCTCCTGCCTGG No data
Right 934644701 2:96051800-96051822 CCATGAGGGTTCCTGAAGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
934644701 Original CRISPR CCATGAGGGTTCCTGAAGGC CGG Intergenic